ID: 1108284127

View in Genome Browser
Species Human (GRCh38)
Location 13:48889078-48889100
Sequence CAGCCAGAAGGTCAGTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108284124_1108284127 15 Left 1108284124 13:48889040-48889062 CCTTGGTCATCTCATTTAGAGTC No data
Right 1108284127 13:48889078-48889100 CAGCCAGAAGGTCAGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108284127 Original CRISPR CAGCCAGAAGGTCAGTTCTG TGG Intergenic
No off target data available for this crispr