ID: 1108286129 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:48909740-48909762 |
| Sequence | ATTTCAGACAGGCTTGCTTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1108286129_1108286134 | 19 | Left | 1108286129 | 13:48909740-48909762 | CCCCAAGCAAGCCTGTCTGAAAT | No data | ||
| Right | 1108286134 | 13:48909782-48909804 | TTCCCTACTGCTGTGCTCCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1108286129 | Original CRISPR | ATTTCAGACAGGCTTGCTTG GGG (reversed) | Intergenic | ||