ID: 1108286129

View in Genome Browser
Species Human (GRCh38)
Location 13:48909740-48909762
Sequence ATTTCAGACAGGCTTGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108286129_1108286134 19 Left 1108286129 13:48909740-48909762 CCCCAAGCAAGCCTGTCTGAAAT No data
Right 1108286134 13:48909782-48909804 TTCCCTACTGCTGTGCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108286129 Original CRISPR ATTTCAGACAGGCTTGCTTG GGG (reversed) Intergenic