ID: 1108292690

View in Genome Browser
Species Human (GRCh38)
Location 13:48976548-48976570
Sequence CTACGCGGCTCGCCGCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 20 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108292690_1108292705 1 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292705 13:48976572-48976594 TCCGGAGGGCTCGGGGGCGGGGG 0: 1
1: 0
2: 0
3: 30
4: 328
1108292690_1108292716 18 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292716 13:48976589-48976611 CGGGGGCGGGGGCGGGGGCTGGG 0: 1
1: 101
2: 230
3: 1198
4: 4843
1108292690_1108292707 4 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292707 13:48976575-48976597 GGAGGGCTCGGGGGCGGGGGCGG 0: 1
1: 0
2: 24
3: 425
4: 2782
1108292690_1108292699 -7 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292699 13:48976564-48976586 CGCGTAGCTCCGGAGGGCTCGGG 0: 1
1: 0
2: 0
3: 4
4: 104
1108292690_1108292701 -5 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292701 13:48976566-48976588 CGTAGCTCCGGAGGGCTCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 59
1108292690_1108292708 5 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292708 13:48976576-48976598 GAGGGCTCGGGGGCGGGGGCGGG 0: 1
1: 1
2: 25
3: 334
4: 3238
1108292690_1108292715 17 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292715 13:48976588-48976610 GCGGGGGCGGGGGCGGGGGCTGG 0: 75
1: 157
2: 514
3: 2492
4: 10549
1108292690_1108292709 6 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292709 13:48976577-48976599 AGGGCTCGGGGGCGGGGGCGGGG 0: 1
1: 3
2: 29
3: 314
4: 1872
1108292690_1108292711 10 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292711 13:48976581-48976603 CTCGGGGGCGGGGGCGGGGGCGG 0: 1
1: 11
2: 204
3: 771
4: 4054
1108292690_1108292713 12 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292713 13:48976583-48976605 CGGGGGCGGGGGCGGGGGCGGGG 0: 79
1: 135
2: 508
3: 1876
4: 8520
1108292690_1108292718 22 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292718 13:48976593-48976615 GGCGGGGGCGGGGGCTGGGGCGG 0: 1
1: 122
2: 300
3: 1534
4: 8835
1108292690_1108292710 7 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292710 13:48976578-48976600 GGGCTCGGGGGCGGGGGCGGGGG 0: 1
1: 8
2: 151
3: 692
4: 3737
1108292690_1108292700 -6 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292700 13:48976565-48976587 GCGTAGCTCCGGAGGGCTCGGGG 0: 1
1: 0
2: 0
3: 5
4: 49
1108292690_1108292704 0 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292704 13:48976571-48976593 CTCCGGAGGGCTCGGGGGCGGGG 0: 1
1: 0
2: 0
3: 23
4: 266
1108292690_1108292698 -8 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292698 13:48976563-48976585 CCGCGTAGCTCCGGAGGGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 50
1108292690_1108292714 13 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292714 13:48976584-48976606 GGGGGCGGGGGCGGGGGCGGGGG 0: 91
1: 160
2: 656
3: 4846
4: 14217
1108292690_1108292702 -2 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292702 13:48976569-48976591 AGCTCCGGAGGGCTCGGGGGCGG 0: 1
1: 0
2: 1
3: 17
4: 234
1108292690_1108292703 -1 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292703 13:48976570-48976592 GCTCCGGAGGGCTCGGGGGCGGG 0: 1
1: 0
2: 4
3: 30
4: 323
1108292690_1108292712 11 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292712 13:48976582-48976604 TCGGGGGCGGGGGCGGGGGCGGG 0: 4
1: 96
2: 252
3: 1012
4: 5110
1108292690_1108292717 19 Left 1108292690 13:48976548-48976570 CCTCCCCGCGGCGAGCCGCGTAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1108292717 13:48976590-48976612 GGGGGCGGGGGCGGGGGCTGGGG 0: 3
1: 120
2: 318
3: 1867
4: 9989

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108292690 Original CRISPR CTACGCGGCTCGCCGCGGGG AGG (reversed) Intronic
908669804 1:66533792-66533814 CTAAGTGGCTCGCTGCGGAGGGG - Intronic
910258833 1:85276633-85276655 CGACGCGCCTCGCCGTGGGGCGG - Exonic
914313441 1:146487298-146487320 CTTCTCGGCACCCCGCGGGGCGG + Intergenic
914500909 1:148246083-148246105 CTTCTCGGCACCCCGCGGGGCGG - Intergenic
1091122018 11:133064745-133064767 CCACACGGCCCGGCGCGGGGCGG + Intronic
1108292690 13:48976548-48976570 CTACGCGGCTCGCCGCGGGGAGG - Intronic
1108484495 13:50910235-50910257 CTACCCGGCCCGGCGCGGGATGG + Intronic
1112461373 13:99606496-99606518 CCTCGGGACTCGCCGCGGGGCGG + Intergenic
1112461459 13:99606788-99606810 CGGCCCGGCTCGCCGCGGGTCGG + Intronic
1120881092 14:89416337-89416359 TTTCGAGGCTCGCCGCGGTGCGG - Intronic
1122779188 14:104136489-104136511 TTGCGGGGCGCGCCGCGGGGCGG - Intergenic
1132255653 15:100373800-100373822 CCTCGCGGCTCGGCGCGCGGAGG - Intergenic
1132797012 16:1729579-1729601 GTACGCGGGGCGCGGCGGGGTGG + Intronic
1132797021 16:1729604-1729626 GTACGCGGGGCGCGGCGGGGCGG + Intronic
1136141592 16:28292361-28292383 CTCCGCGGCGCGCGGCGGGAGGG + Intergenic
1143137008 17:4717675-4717697 CTACGCCGCAGGCCTCGGGGAGG - Exonic
1143371637 17:6444239-6444261 CCACGAGGCTGGCGGCGGGGCGG + Intergenic
1145265109 17:21376304-21376326 CTGCGCGGCGCGGCGCGGCGCGG + Exonic
1145265112 17:21376309-21376331 CGGCGCGGCGCGGCGCGGGGCGG + Exonic
1146703245 17:34980631-34980653 CTACGCGGCGCGGCACGGCGCGG + Intronic
1161370461 19:3908378-3908400 CGAGGCTGCTCGCCGCGGGCGGG - Intronic
1163051818 19:14690092-14690114 CTGCGCGGCGCGGCGCGGTGCGG + Exonic
928964954 2:36966757-36966779 CTACGCGGCGAGCCGGGGCGGGG - Intergenic
932152723 2:69387450-69387472 TCCCGCGGCTCGCCCCGGGGCGG - Intergenic
932779040 2:74548849-74548871 ATACGCGCCCCGCCCCGGGGCGG + Intronic
937221768 2:120346141-120346163 CGACTCGGCTCGCCTCGCGGCGG + Exonic
947992339 2:234497257-234497279 CTGCGCGGCGCGGCGCGGGAGGG - Intergenic
1169262423 20:4148709-4148731 CTTCCCGGCTCCCGGCGGGGCGG + Intronic
1176247079 20:64102433-64102455 CCTCCCGGCTGGCCGCGGGGCGG + Intergenic
1177225264 21:18245214-18245236 CCACGCGGCTCATCGCGGCGCGG - Exonic
954202098 3:49029496-49029518 CTACCCGCCTCGCTGCGGCGGGG + Intergenic
954413329 3:50380783-50380805 CTTGGGGGCTCGCCACGGGGTGG + Exonic
957066634 3:75528172-75528194 CTAGGCTGCTCACCGCAGGGGGG + Intergenic
961599886 3:128052394-128052416 CGGCGCGGCGCGGCGCGGGGCGG - Exonic
964438039 3:156674669-156674691 GTGCGCGGCTCGCCGCGTCGCGG + Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968035172 3:195542761-195542783 CTGCCCGGCTAGCCGCGGGTGGG - Intronic
968457168 4:705740-705762 CCACGCCCCTTGCCGCGGGGTGG + Intronic
972960748 4:44448840-44448862 CTGCTCGGCTCTCCGTGGGGAGG + Intergenic
981321363 4:143395892-143395914 CTACGCTGCTCTCCCGGGGGCGG - Intronic
982784434 4:159523817-159523839 CGAGGCGGCTGGCCGGGGGGGGG - Intergenic
985791519 5:1930933-1930955 CTACGGGGGTCGCCGGGTGGTGG - Intergenic
990382995 5:55233760-55233782 CTCCGCGGCCCGCCGGGGGGAGG + Intergenic
1002771052 6:291691-291713 CTACGTGACTCACCCCGGGGAGG - Intronic
1015773608 6:136792549-136792571 CTGCGCGGCGCGGCGCGGCGCGG - Intergenic
1026523128 7:71133061-71133083 CTCCGGGGCTCGACGCGGGCGGG + Intronic
1034978019 7:155459083-155459105 CGTCCCGGCTCGCCGCGGGGAGG + Intronic
1037828924 8:22176970-22176992 CTACGTGGGTCGCCGCGGCGGGG + Exonic
1049896130 9:113517-113539 CTCCGCGGGGCGGCGCGGGGCGG + Intergenic
1050744256 9:8858138-8858160 CTCCGCCGCTCGCGGCTGGGGGG + Intronic
1057379403 9:94554617-94554639 CTCCGCGGCTCGCCTCGCTGCGG - Intergenic
1060530149 9:124343190-124343212 CTGTGCGGCTCGCAGCTGGGGGG + Intronic
1061006382 9:127930643-127930665 CCGCGCCGCTCGCCGAGGGGAGG + Intronic
1062554604 9:137108228-137108250 CCACACGGCTCGCCTGGGGGTGG + Intronic
1200234237 X:154460492-154460514 CTATGCGGCCCGCCGCCTGGTGG + Exonic