ID: 1108293549

View in Genome Browser
Species Human (GRCh38)
Location 13:48988186-48988208
Sequence GTCTCCCACTATTACTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13442
Summary {0: 68, 1: 1389, 2: 7267, 3: 3125, 4: 1593}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108293549_1108293555 29 Left 1108293549 13:48988186-48988208 CCCACACAGTAATAGTGGGAGAC 0: 68
1: 1389
2: 7267
3: 3125
4: 1593
Right 1108293555 13:48988238-48988260 AACGAGACAGGAAATTAACAAGG 0: 6
1: 379
2: 2982
3: 4875
4: 3023
1108293549_1108293554 17 Left 1108293549 13:48988186-48988208 CCCACACAGTAATAGTGGGAGAC 0: 68
1: 1389
2: 7267
3: 3125
4: 1593
Right 1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG 0: 1
1: 4
2: 5
3: 15
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108293549 Original CRISPR GTCTCCCACTATTACTGTGT GGG (reversed) Intronic
Too many off-targets to display for this crispr