ID: 1108293550

View in Genome Browser
Species Human (GRCh38)
Location 13:48988187-48988209
Sequence AGTCTCCCACTATTACTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14017
Summary {0: 72, 1: 1472, 2: 7459, 3: 3442, 4: 1572}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108293550_1108293554 16 Left 1108293550 13:48988187-48988209 CCACACAGTAATAGTGGGAGACT 0: 72
1: 1472
2: 7459
3: 3442
4: 1572
Right 1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG 0: 1
1: 4
2: 5
3: 15
4: 43
1108293550_1108293555 28 Left 1108293550 13:48988187-48988209 CCACACAGTAATAGTGGGAGACT 0: 72
1: 1472
2: 7459
3: 3442
4: 1572
Right 1108293555 13:48988238-48988260 AACGAGACAGGAAATTAACAAGG 0: 6
1: 379
2: 2982
3: 4875
4: 3023

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108293550 Original CRISPR AGTCTCCCACTATTACTGTG TGG (reversed) Intronic
Too many off-targets to display for this crispr