ID: 1108293554

View in Genome Browser
Species Human (GRCh38)
Location 13:48988226-48988248
Sequence CAGTATTAGATCAACGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 4, 2: 5, 3: 15, 4: 43}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108293550_1108293554 16 Left 1108293550 13:48988187-48988209 CCACACAGTAATAGTGGGAGACT 0: 72
1: 1472
2: 7459
3: 3442
4: 1572
Right 1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG 0: 1
1: 4
2: 5
3: 15
4: 43
1108293549_1108293554 17 Left 1108293549 13:48988186-48988208 CCCACACAGTAATAGTGGGAGAC 0: 68
1: 1389
2: 7267
3: 3125
4: 1593
Right 1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG 0: 1
1: 4
2: 5
3: 15
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108293554 Original CRISPR CAGTATTAGATCAACGAGAC AGG Intronic
903163280 1:21504163-21504185 CAGTATTAGAGGAACAAGCCCGG + Intergenic
904590850 1:31614650-31614672 CAGGATTAGATCAACAAGGCTGG + Intergenic
905423610 1:37865499-37865521 GGGTGATAGATCAACGAGACTGG + Intronic
907792981 1:57685487-57685509 CAGTGTTAGATCAACAAGGTAGG + Intronic
912967704 1:114250757-114250779 CATTATTAAATCAAAGAGAGAGG + Intergenic
917362604 1:174193552-174193574 CAATATTAGTTTAAGGAGACAGG - Intronic
920447045 1:206025422-206025444 CAGTGAAAGATCAACAAGACGGG - Intergenic
921659424 1:217782196-217782218 AAGTATTAGAACAACGCTACAGG + Exonic
1065287346 10:24198921-24198943 CAGTATTACATGAACAAGCCAGG + Intronic
1067184270 10:44013894-44013916 GAGTATTAGTTCCAGGAGACAGG - Intergenic
1070343406 10:75519267-75519289 CAATATTAGATCAACGAGACAGG - Intronic
1072831856 10:98666357-98666379 CAGTGTTAGATCATTGAGGCAGG + Intronic
1074651098 10:115525309-115525331 CATAATTAGATCAACAAGATTGG - Intronic
1074827343 10:117223943-117223965 CAGTGTTAGTTCCACGAGGCAGG + Intergenic
1081067927 11:38570657-38570679 AACTATTAGATCAAACAGACCGG + Intergenic
1088034460 11:105295349-105295371 CAATATTAGATCAATGAGACAGG - Intergenic
1091529066 12:1337114-1337136 CAGTATTAGATCAAAGATTAAGG - Intronic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1095259214 12:40079665-40079687 CAGTGTTAGATCATCGAGGCAGG - Intronic
1096485607 12:51978858-51978880 CAGGATTGGATCAGAGAGACAGG + Intronic
1097119689 12:56721593-56721615 CAGGATTAGATAAAGGTGACAGG + Intronic
1103037816 12:117670753-117670775 CTGTAATAGATGAAGGAGACAGG + Intronic
1105802298 13:23917583-23917605 CAGCATTAGATCATCAAGGCAGG + Intergenic
1106231813 13:27826487-27826509 CAGCATGAGATCAATGAGCCAGG + Intergenic
1107297034 13:38920599-38920621 GAGTATTAGATCATCGAGGCAGG - Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1114898566 14:27026341-27026363 CAGCATTATATCAAGGAGAGAGG - Intergenic
1117256350 14:53981766-53981788 CAATATTGAATCAATGAGACTGG - Intergenic
1124953310 15:34343042-34343064 CAGTATTACCTCAACGAGCAGGG - Exonic
1126239719 15:46427487-46427509 CAACATTAGATCAATGAGACAGG + Intergenic
1127317599 15:57812691-57812713 CAATATTAGATCAACCATACAGG - Intergenic
1127965197 15:63918011-63918033 CAGTGTTTGTTCAACGGGACTGG + Intronic
1131902980 15:97108970-97108992 AAATATTAGATCAATAAGACAGG + Intergenic
1139001747 16:62519216-62519238 CAATATTAGATCAACGAGACAGG + Intergenic
1144213566 17:13035123-13035145 CAGCATTAGATGAAAGAGAGAGG + Intergenic
1147480001 17:40751470-40751492 GAGAATTAGGTCAACGGGACAGG - Intronic
1153151285 18:2096411-2096433 CAAGAGTAGATCAAGGAGACTGG + Intergenic
1157066288 18:44354756-44354778 CAATATTAGATCAACGAGACAGG - Intergenic
936848746 2:116870869-116870891 CAATATTAGAACAATGAGACAGG - Intergenic
945553111 2:211246064-211246086 CAGTAAGAGATGAATGAGACAGG - Intergenic
948187606 2:236033974-236033996 CATTATGAGATCAACTCGACAGG - Intronic
1169189751 20:3650754-3650776 CAGAATTAGTTCAACGAAACAGG - Exonic
949093265 3:54833-54855 CAGGATTAGGTCATAGAGACAGG + Intergenic
957033518 3:75270901-75270923 CAGGATTAGGTCATAGAGACAGG + Intergenic
959879403 3:111425775-111425797 CAGTATTAGATCACTGAGGCAGG + Intronic
963615057 3:147526454-147526476 CAGTATTAGATCATTAAGGCAGG - Intergenic
963925584 3:150947481-150947503 CAGTATTAGATCATGGAGGCAGG + Intronic
972090447 4:35275102-35275124 CAGTATAAAAGCAAAGAGACAGG + Intergenic
973673877 4:53244165-53244187 CAGTATTAGATCATTGAGGCAGG + Intronic
976550012 4:86382817-86382839 CTGTTTTAGTTCAACGTGACAGG + Intronic
977332663 4:95657267-95657289 CAGTATTAGATCATCAAGGCAGG - Intergenic
978657100 4:111077138-111077160 CAGTGTTAGATCAATGAGACAGG + Intergenic
983438238 4:167745175-167745197 CAGAAATAGATCAACTTGACAGG + Intergenic
986415529 5:7524543-7524565 CTGTAGAAGATCAAAGAGACTGG - Intronic
989681357 5:44032811-44032833 CAGTATTAGAACAAAGAGAGAGG + Intergenic
996488511 5:124065156-124065178 GAGTATGAGATCATGGAGACAGG + Intergenic
1004172887 6:13312218-13312240 CAGTAATACACCAACCAGACGGG + Intronic
1004593475 6:17076013-17076035 CAATATTAGATCAATGAGACAGG + Intergenic
1031191534 7:118558293-118558315 CAGTATTAGACCACCCAGCCAGG - Intergenic
1036457947 8:8925960-8925982 CAGTATAACATCAACGAGGAAGG - Intergenic
1045070908 8:98503954-98503976 CAATATTAGATCAACAAGACAGG - Intronic
1051205325 9:14682614-14682636 CAACATTAGATCAACGAGACAGG + Intronic
1052212533 9:25923258-25923280 CAGTAATAGAACATCCAGACAGG + Intergenic
1186866686 X:13727181-13727203 CAATATCAGATCAACAAGACAGG + Intronic
1191949528 X:66573131-66573153 CAGTATTAGATCATTGAGGCAGG - Intergenic
1195990542 X:110677987-110678009 CTATATTAAATCAATGAGACGGG - Intronic
1196600142 X:117592050-117592072 CAATATTAGATCATTGAGACAGG + Intergenic
1199528224 X:148816561-148816583 CAGTATTAGAATAATGAGAATGG + Intronic