ID: 1108299169

View in Genome Browser
Species Human (GRCh38)
Location 13:49056652-49056674
Sequence CCAGTTCACCTGTTTTCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108299167_1108299169 6 Left 1108299167 13:49056623-49056645 CCTTTCTATATTTTACATATTTT 0: 1
1: 3
2: 26
3: 203
4: 1855
Right 1108299169 13:49056652-49056674 CCAGTTCACCTGTTTTCTACTGG 0: 1
1: 0
2: 2
3: 19
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108299169 Original CRISPR CCAGTTCACCTGTTTTCTAC TGG Intronic
900937578 1:5776205-5776227 CCAGGTCACCTGTCTTCATCTGG + Intergenic
901812429 1:11775597-11775619 CTAGCTCACCTGCTTTCTGCCGG - Exonic
902849894 1:19146817-19146839 CAAGTTCACCTGTTTCCATCTGG + Exonic
902856642 1:19210894-19210916 CGTGTTCCCCTTTTTTCTACTGG + Intergenic
905660396 1:39718263-39718285 CCATGTCAGCTGTTTTCTTCAGG - Intronic
909127224 1:71688271-71688293 CCAGTTCACCTTTGTTTTCCGGG - Intronic
911912132 1:103650398-103650420 CCAGTTCACCCTTTTTCTCCAGG - Intergenic
911916322 1:103701550-103701572 CCAGTTCACCCTTTTTCTCCAGG + Intronic
911919547 1:103744536-103744558 CCAGTTCACCCTTTTTCTCCAGG - Intronic
912396783 1:109351410-109351432 TCAGTGCACCTGTCTTCTTCAGG - Intronic
912482164 1:109991441-109991463 CCAGTTCACTTGTTTTAAAGTGG + Intronic
916119454 1:161514708-161514730 CAAGTTCATCTGTTTCCAACAGG + Intronic
916129220 1:161596365-161596387 CAAGTTCATCTGTTTCCAACAGG + Intronic
918647038 1:186917192-186917214 CCAGTTCACCCTTTCTCTCCAGG - Intronic
919134056 1:193486915-193486937 CCAAATGACCTGTTTTCTAATGG + Intergenic
919807782 1:201390915-201390937 CAAGTTCATCTGTTTCCTTCAGG - Intronic
1063150458 10:3332041-3332063 CCAGCTCTCCGGTTTTCTCCAGG + Intergenic
1064406107 10:15065067-15065089 GCACTTCAGCTGTTTCCTACTGG + Intronic
1065238243 10:23677297-23677319 CCATTTCACCTGATTGCCACAGG - Intergenic
1067069903 10:43123892-43123914 CCACTTCTCCTGGTTTCTCCTGG - Intronic
1067711413 10:48654205-48654227 CCAGTTCTCCTGTTTGCTTCTGG + Intronic
1071282376 10:84114358-84114380 CCAGTTCACCCTTTCTCTCCAGG + Intergenic
1071452222 10:85807552-85807574 CCATTTCTCATTTTTTCTACGGG - Intronic
1079443053 11:20534529-20534551 CCAGCTCACCTGTTTTCATGAGG + Intergenic
1082677487 11:56124604-56124626 GCCTTTCTCCTGTTTTCTACAGG + Intergenic
1084907477 11:72359061-72359083 CAATCTCACCTGTTTTCTAGTGG + Intronic
1086931752 11:92700953-92700975 CCATTTCACTTATTTTCTGCAGG - Intronic
1090794808 11:130125585-130125607 CCAGTTCAACTTTTTTCTGTCGG - Intronic
1091039557 11:132263955-132263977 CCAGTTTTCCTGTTTTCTGTTGG + Intronic
1091133414 11:133165784-133165806 TCACTTCACGTGTTTTCTCCAGG + Intronic
1098517638 12:71395840-71395862 CCATTTCATATGTTTTATACAGG - Intronic
1098748787 12:74270218-74270240 CCAGTTCACCCCTTCTCTCCAGG + Intergenic
1100223087 12:92527725-92527747 CCAGTTCACCCCTTTTCCACTGG + Intergenic
1100358432 12:93854175-93854197 CCAGCTCAGCTGATTTCTGCTGG + Intronic
1101028371 12:100635866-100635888 CCAGTTCACCCTTTCTCTCCAGG - Intergenic
1107015595 13:35706051-35706073 CCAGGACACTTCTTTTCTACTGG - Intergenic
1107490358 13:40875468-40875490 CCAGTTCACCCTTTCTCTCCAGG - Intergenic
1108299169 13:49056652-49056674 CCAGTTCACCTGTTTTCTACTGG + Intronic
1108367797 13:49733922-49733944 CCAGTTCAACTGTTTTCTGCAGG - Intronic
1108367814 13:49734172-49734194 CCACTTTAACTGTATTCTACAGG + Intronic
1109803147 13:67403082-67403104 CCAGTTCACCCTTTCTCTCCAGG + Intergenic
1111301204 13:86353030-86353052 CCAGTTAACCTTTTTTCTATTGG + Intergenic
1112651267 13:101401111-101401133 CCAGTTAGCTTGTTTTCTTCTGG - Intronic
1112916085 13:104552149-104552171 CAAGTTCACCAGTTTTCTGTGGG + Intergenic
1120637909 14:86974298-86974320 CCACCCCACCTGTGTTCTACAGG + Intergenic
1120668254 14:87333205-87333227 CCAGTTCTCCTGATTCCCACTGG - Intergenic
1121124161 14:91395254-91395276 CTTGTTCACCTGTATTCTGCAGG - Intronic
1123016747 14:105379320-105379342 CATGTTCACCTGTTTGCTGCAGG + Intronic
1124005682 15:25793813-25793835 ACAGTTGACCTCTTTTCCACTGG + Intronic
1127195551 15:56582046-56582068 CCAATTCAACTCTTTTCTATAGG + Intergenic
1132186094 15:99803105-99803127 CCACATCACCTGTTTTATATAGG - Intergenic
1133155296 16:3870518-3870540 GCAGTTCAACTGTTTTTTATTGG - Intronic
1137420947 16:48333499-48333521 CCAGGTGTCCTGTTTTCTAACGG - Intronic
1139252714 16:65511271-65511293 CCAGATCACCTTTTTACTTCAGG + Intergenic
1140110941 16:72004341-72004363 CCACGTCAGCTGTTTTCTTCAGG + Intergenic
1141268469 16:82518225-82518247 CCAGGTCTCCAGTTTTCTCCAGG + Intergenic
1142788415 17:2243836-2243858 CCACTAGACCAGTTTTCTACTGG - Intronic
1146565566 17:33909923-33909945 CCAGTTCCTCTGTTTGCTAATGG + Intronic
1147540630 17:41354883-41354905 CTAGTTCACCTTTTTACTAAGGG - Intergenic
1148054123 17:44783514-44783536 CCAGTTCACCTTTTCCCAACTGG + Intergenic
1148083116 17:44978303-44978325 CCAGGTCAGCTGTTTTCCCCTGG - Intergenic
1152163587 17:78685753-78685775 GCATTTCACATGTTTTCTTCAGG + Intronic
1156509468 18:37624238-37624260 CCAGTTCACCTGACTTCCAGAGG + Intergenic
1157305584 18:46514792-46514814 CCATTTCACTAGGTTTCTACTGG + Intronic
1163405956 19:17122513-17122535 CCAGATCACCTGTTTTTTTGAGG - Intronic
1163943062 19:20512684-20512706 CCAGTTCACCTTTTCTCTCCAGG - Intergenic
1164183962 19:22845498-22845520 CAGTTTCACCTGTTTACTACAGG + Intergenic
1166713385 19:44951345-44951367 CCAGGGCCCCTGTTTTTTACTGG - Intronic
1167581911 19:50349835-50349857 CCAGTTCACCCTTTTTCTCCAGG - Intronic
1168467732 19:56617845-56617867 CCAGCTCTCCTGATTTCTCCAGG + Intronic
929207699 2:39316440-39316462 CCAGTTCACCTCTGTTCTAAAGG - Intronic
929436043 2:41929151-41929173 GGACTTCACCTGTGTTCTACAGG - Intergenic
930874168 2:56194769-56194791 CCAGTTTACCTGTTGTCTTGAGG + Intronic
932784784 2:74590535-74590557 CCAATTCATCTGTTTACTAAAGG - Intronic
933218998 2:79666857-79666879 CCAGTTCACCTGTCTTCTCCTGG + Intronic
935331133 2:101978820-101978842 CCAGCCCAACTGTTTTCTGCAGG + Intergenic
935965920 2:108475622-108475644 TCAGCTCACCTCTTTTCTGCTGG - Exonic
936578723 2:113676892-113676914 ACAGCGCACCTGTTTTCTTCTGG - Intergenic
941830040 2:169946149-169946171 CCAGTTCACAAATTTTCTAAAGG - Intronic
944847643 2:203684708-203684730 CCAAGTCACCTGTTTTCAACAGG + Intergenic
945843082 2:214911322-214911344 CCAGTTTCTCTGTTTTCTATTGG + Intergenic
946262684 2:218508047-218508069 TCAGTGTTCCTGTTTTCTACTGG - Intronic
946452330 2:219791434-219791456 CCACTTCTGCTGTGTTCTACGGG - Intergenic
946643482 2:221808781-221808803 GCAGTGAACGTGTTTTCTACTGG + Intergenic
946677424 2:222176425-222176447 CCGGTCCACATGTTTTCTTCTGG + Intergenic
1170701743 20:18709898-18709920 CCAGATTGCCTGTTTTCTAATGG - Intronic
1170803226 20:19607530-19607552 CCATTTCACCTGAGTTCTTCTGG + Intronic
1171408680 20:24931325-24931347 CCAGTTCACCTTTTCTCCCCAGG + Intergenic
1171987808 20:31672716-31672738 CCTTTTCACCTGACTTCTACAGG - Intronic
1172201400 20:33129000-33129022 CCAGTTCACATGTTTTTAAATGG + Intergenic
1177776512 21:25573424-25573446 CCAATTAACCTGTTTTATAAGGG - Intergenic
1178746727 21:35258803-35258825 CCAGCTCAACTGTTTTCTTTGGG - Intronic
1183196350 22:36356188-36356210 CATGTTCACCTGTGTTCTCCAGG - Intronic
1185272902 22:49936820-49936842 TCAGTTCACCTGTTTACTTCAGG + Intergenic
950233190 3:11294521-11294543 CCAAATCACCTGTTTTCCATTGG + Intronic
956339731 3:68208902-68208924 CCATTACACCTGTTTTTTAAAGG - Intronic
957406356 3:79778161-79778183 CCAGTTCACCCTTTCTCTCCAGG + Intergenic
957474103 3:80702106-80702128 CCTGGTCTCCTATTTTCTACCGG + Intergenic
959382760 3:105661536-105661558 ACAATTAACTTGTTTTCTACGGG + Intronic
960914202 3:122680617-122680639 TCAGTTCACCTGTGCTCCACGGG - Exonic
961240011 3:125402484-125402506 CCAGTTTACTTGGTTTCTAGAGG + Intergenic
962005176 3:131342163-131342185 CCAGTTCACCTGCCTGCTTCTGG + Intronic
962315531 3:134357280-134357302 CCAGTCCACCTGGTGTCCACGGG + Exonic
962376239 3:134861060-134861082 ACAGTTCACCAGTTTCCTCCTGG - Intronic
963429908 3:145187005-145187027 CCAGTTAACCCTTTTTCTTCTGG + Intergenic
963643011 3:147881398-147881420 CCAGGTCCCCTTTTCTCTACAGG - Intergenic
963686744 3:148444781-148444803 ACAGTTCACCTGTTTGCTTAAGG - Intergenic
964522252 3:157582026-157582048 CCAGTTCACCCTTTCTCTCCAGG - Intronic
966051051 3:175618229-175618251 CCAGGTCCCCTTTTCTCTACAGG - Intronic
968278881 3:197460355-197460377 ACAGTTCTACTGTTTTCTAAAGG - Intergenic
968943936 4:3653833-3653855 CTTGTTCACCTGTCTTCTGCTGG + Intergenic
969968744 4:11024248-11024270 TCAGTTCATCTGTTTCTTACAGG + Intergenic
972077616 4:35106395-35106417 CCAGTTCACCCTTTTTCTCCAGG + Intergenic
973662209 4:53119733-53119755 TCAATTTATCTGTTTTCTACAGG - Intronic
974565923 4:63578328-63578350 CCAGGTACCCTTTTTTCTACAGG - Intergenic
976969878 4:91091839-91091861 CCAGTTCACCCTTTTTCTCCAGG - Intronic
980780300 4:137484211-137484233 CCAGTTCACCCTTTCTCTCCAGG + Intergenic
981286089 4:143020541-143020563 CCAATTCACCATTTTTCTAGGGG + Intergenic
981616694 4:146650250-146650272 CCAGGTCCCCTGTTTTCCCCGGG - Intergenic
986601392 5:9476769-9476791 ACAGTTCTGCTGTTTTCTAATGG - Intronic
986606505 5:9528528-9528550 CCACTTCCACTGTATTCTACTGG - Intronic
986914280 5:12598054-12598076 CTAGTCCACCTGTGTTCTCCAGG + Intergenic
989644861 5:43620194-43620216 CCAGTTAACCTGTAACCTACAGG - Intronic
991713130 5:69427822-69427844 CCACTGCACCTGTTCTCTATTGG - Intronic
992027992 5:72690336-72690358 CCAGTTCACATGTTTTAAATGGG - Intergenic
995377321 5:111490284-111490306 GCAGTTCATCTGTTTTGTAAAGG + Exonic
995473976 5:112529815-112529837 CCAGTTCACCCGTTCTCTCCAGG + Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1001087970 5:168715337-168715359 GCCGTTCCTCTGTTTTCTACTGG + Intronic
1002407981 5:179051283-179051305 CCAGTTCACCCTTTTTCTCCAGG - Intergenic
1002885977 6:1294737-1294759 CAAGTTAACCTGTATTCAACTGG + Intergenic
1006208681 6:32374365-32374387 CCAGGTCACCTTCTTCCTACAGG + Intergenic
1008187584 6:48412959-48412981 CCATTTCTCCTGTGTTGTACAGG - Intergenic
1008266504 6:49434073-49434095 CCAATTCAAATGTTTTCTACTGG + Intronic
1008375404 6:50785821-50785843 CCAGTTCTTCAGCTTTCTACAGG + Intergenic
1011221894 6:85063511-85063533 CCAGGTCAACTGCTTTCTAAGGG - Intergenic
1015279689 6:131419672-131419694 ACTGTCCATCTGTTTTCTACTGG + Intergenic
1016164101 6:140918103-140918125 TCAGTTCACCTTTTTTGTAATGG + Intergenic
1016322915 6:142866950-142866972 CCTGTTCACCAGTTTACCACAGG - Intronic
1017212996 6:151877678-151877700 TCAGTTCTCCTGTCTTCTTCTGG + Intronic
1018631427 6:165826205-165826227 CCAGGTCACCTGGAGTCTACAGG - Intronic
1021058329 7:16078344-16078366 GAAGTTCACCTTTTTTCTTCAGG - Intergenic
1021155990 7:17210445-17210467 CCAGATCACCTGTTTGCAGCTGG - Intergenic
1023639502 7:42243103-42243125 CCAGTTCACCTGGTCTTGACTGG - Intergenic
1029091044 7:98048653-98048675 CAAGTGCCCCTGTTTTCTATAGG + Intergenic
1031954116 7:127924608-127924630 CCAGGTCACCTGCTTCCTAGAGG - Intronic
1036408934 8:8480229-8480251 CCAGTCTATCTGCTTTCTACTGG + Intergenic
1038464475 8:27748530-27748552 CCATGTCAGCTGTTTTCTTCAGG + Exonic
1041915815 8:63137766-63137788 CCTGTTCAGTTGTTTTCCACGGG + Intergenic
1044403614 8:91800299-91800321 ACAGTTTAACTGTTTACTACAGG + Intergenic
1045229751 8:100292619-100292641 TCCCTTCACATGTTTTCTACTGG + Intronic
1045327565 8:101127878-101127900 CCAGGAGACCTGTTTTCTCCAGG - Intergenic
1046195046 8:110851536-110851558 CCAGTATTCCTGTTTTCAACAGG + Intergenic
1048643145 8:136387032-136387054 CCATATCACAAGTTTTCTACAGG + Intergenic
1048731632 8:137448335-137448357 CCAGTTAACCTATTAGCTACTGG + Intergenic
1049382446 8:142324178-142324200 CCAGTTCACTTGGTTTCTTTTGG - Intronic
1049935435 9:497373-497395 CCAGTTCACCTTTTCTCTGAGGG + Intronic
1051310606 9:15766947-15766969 CCACTGCACCTGGTTTCTACTGG + Intronic
1051370946 9:16358546-16358568 CCAGTACAACTGTTCTCTCCTGG + Intergenic
1053560833 9:39192388-39192410 CCTGTTCTCCAGTTTTATACAGG + Intronic
1054136286 9:61426567-61426589 CCTGTTCTCCAGTTTTATACAGG - Intergenic
1055108269 9:72535178-72535200 CCAGTTCACCTCTGTTCCAAGGG + Intronic
1055336967 9:75242024-75242046 ACTTTTCACCTGTTGTCTACTGG - Intergenic
1055939663 9:81637358-81637380 CCAGTTCATCTTTTTTCTTTTGG - Intronic
1056188186 9:84157689-84157711 TCAGTTCACCTGTTTGTTTCTGG + Intergenic
1058028259 9:100166644-100166666 CCTGTTCACCTGTATGATACTGG + Intronic
1058382472 9:104392552-104392574 CAAGTTCAGTTGTCTTCTACAGG - Intergenic
1186409828 X:9336928-9336950 CCAGTTGTCCTGTTTTTTCCAGG - Intergenic
1190425685 X:50332777-50332799 CCAGTTCACCCTTTCTCTCCAGG - Intronic
1190938807 X:55020509-55020531 CCTTTTCTCCTGTTTTCTCCTGG - Intronic
1193070369 X:77299769-77299791 CCAGTTCACCCTTTCTCTCCAGG + Intergenic
1194124079 X:89992287-89992309 CCAGGTCCCCTTTTCTCTACAGG - Intergenic
1195042367 X:101026119-101026141 CTAGTTCAACTGTTGTTTACTGG + Intronic
1198125223 X:133637102-133637124 CCAGTGCACCTGTCTTGTATTGG - Intronic
1198884987 X:141325268-141325290 TCAGTCTACCTGTTTTCTTCAGG + Intergenic
1198970223 X:142271109-142271131 CCAGTTCACCCTTTTTCTCCAGG + Intergenic
1199393721 X:147309915-147309937 CCAGTCCACAGGTTTTCTGCCGG - Intergenic
1200476966 Y:3649909-3649931 CCAGGTCCCCTTTTCTCTACAGG - Intergenic
1200912367 Y:8542430-8542452 CCAGTTCACCTCTTCTCCCCAGG + Intergenic
1200943510 Y:8808896-8808918 CCAGTTCACCCTTTCTCTCCAGG + Intergenic
1200948438 Y:8868580-8868602 CCAGTTCACCTTTTCTCCCCAGG + Intergenic
1201270478 Y:12249163-12249185 CCAGTTCACGCTTTTTCTCCAGG + Intergenic
1201680385 Y:16638903-16638925 CCAGTTCACCCTTTTTCTCCAGG - Intergenic