ID: 1108301099

View in Genome Browser
Species Human (GRCh38)
Location 13:49076926-49076948
Sequence TGGAAGGCCAAGAATTGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108301099_1108301107 23 Left 1108301099 13:49076926-49076948 CCCCTTCAATTCTTGGCCTTCCA 0: 1
1: 0
2: 1
3: 15
4: 219
Right 1108301107 13:49076972-49076994 TTATTGCTTTAGTTTAAAAAGGG 0: 1
1: 0
2: 6
3: 68
4: 740
1108301099_1108301106 22 Left 1108301099 13:49076926-49076948 CCCCTTCAATTCTTGGCCTTCCA 0: 1
1: 0
2: 1
3: 15
4: 219
Right 1108301106 13:49076971-49076993 GTTATTGCTTTAGTTTAAAAAGG 0: 1
1: 0
2: 3
3: 34
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108301099 Original CRISPR TGGAAGGCCAAGAATTGAAG GGG (reversed) Intronic
901106761 1:6762453-6762475 TGGAAGGTCAAGAATAGACCTGG - Intergenic
902845440 1:19106728-19106750 TGCAAGGCCAAGGGTTGCAGGGG + Intronic
903433301 1:23326113-23326135 TGGAGGGCCAAGAAAGGAACAGG - Intronic
904841273 1:33373420-33373442 AGGAAGGGAAAGAATTAAAGGGG - Intronic
908684122 1:66695410-66695432 TGTATGGCCAGGAGTTGAAGCGG - Intronic
908800402 1:67874050-67874072 TGGGAAACCAAGAATAGAAGAGG + Intergenic
909417283 1:75421102-75421124 TGAAAGGGCAAAATTTGAAGTGG - Intronic
910169989 1:84367482-84367504 TGAAAGGCCCAGAATTGAAGAGG + Intronic
915613207 1:157012848-157012870 TGAATGGCCAAGAAATGATGAGG - Intronic
915821167 1:159025229-159025251 AAGAAGGCCAAGACTTCAAGAGG - Intronic
916395992 1:164387842-164387864 TGAGAGGCCAAGATTTCAAGAGG - Intergenic
916829999 1:168481206-168481228 TTGCAGGCTGAGAATTGAAGGGG + Intergenic
917537663 1:175886112-175886134 TGGAAGGCCAAGAGGAGAAAGGG - Intergenic
920128399 1:203712093-203712115 TAGAAGGCAAAGAATTCAACCGG + Exonic
921061914 1:211592403-211592425 TGGGAGGCAAAGAATGAAAGTGG - Intergenic
924677422 1:246193834-246193856 AAGAAGGCCTAGAATTAAAGAGG - Intronic
1064143200 10:12807321-12807343 TGGAAGGCCTAGCACTGATGCGG + Intronic
1065772696 10:29092414-29092436 TGGAAGGCCATCTATTGTAGTGG - Intergenic
1066288111 10:33988241-33988263 TGGATGGCCAAATATGGAAGAGG - Intergenic
1066671562 10:37845720-37845742 TGAAAAGCCTAGAAATGAAGGGG + Intronic
1066939356 10:41869374-41869396 TGGAAGGGAAAGAAATGAAATGG + Intergenic
1068086297 10:52377197-52377219 TGGAAAGCCAAGAAATGAAAAGG - Intergenic
1068588667 10:58830567-58830589 AGTAAGAACAAGAATTGAAGAGG + Exonic
1068948441 10:62753715-62753737 TGGAAGTACATAAATTGAAGAGG - Intergenic
1069332173 10:67305625-67305647 TGGAGGGGCAAGACTAGAAGTGG + Intronic
1069471200 10:68691163-68691185 TGGAAGGCTCAGAATTAATGAGG - Exonic
1070833330 10:79433383-79433405 TGGAAGCCCAAGGAGGGAAGTGG + Intronic
1070861140 10:79663363-79663385 TGGAAGCCCCAGAATTGATTGGG + Intergenic
1070876115 10:79812234-79812256 TGGAAGCCCCAGAATTGATTGGG - Intergenic
1071643048 10:87334367-87334389 TGGAAGCCCCAGAATTGATTGGG - Intergenic
1073798297 10:107012978-107013000 TAGGAGGCCAAGACATGAAGTGG - Intronic
1076273777 10:129178956-129178978 TGGAAGGACACGAATTTAGGGGG + Intergenic
1079469380 11:20763812-20763834 TGGAAGGGCAGGAATGGAGGGGG + Intronic
1079881695 11:25936017-25936039 TCGAAGGGAAAAAATTGAAGTGG + Intergenic
1080407129 11:31989074-31989096 TGGAGGGGCAAGAGTGGAAGAGG + Intronic
1080487350 11:32723580-32723602 TTCAGGGTCAAGAATTGAAGAGG + Intronic
1081689525 11:45068187-45068209 TGGAAGGTGAAGAAAGGAAGAGG - Intergenic
1082561151 11:54622561-54622583 TGGAAAGCCAAAAAATGCAGGGG - Intergenic
1083105541 11:60354897-60354919 TGTAAGGCCAATACTTGATGTGG - Intronic
1084906268 11:72350196-72350218 TGGAAGACCAGGCCTTGAAGGGG - Intronic
1087955700 11:104285211-104285233 TGGAGGGCCTAGAATTTATGGGG - Intergenic
1088926389 11:114307494-114307516 TGGAGGGGCAAGAGTGGAAGTGG - Intronic
1090490752 11:127158655-127158677 TGGAAGGTCAAGATTTGGAAGGG + Intergenic
1092679300 12:10960115-10960137 TGATAGGCCAATAGTTGAAGAGG + Intronic
1092680975 12:10980951-10980973 TGATAGGCCAATAGTTGAAGAGG + Intronic
1095775034 12:46001435-46001457 TGGAAGGCCCAGAAGGGAGGTGG + Intergenic
1100699388 12:97130243-97130265 TGGAACGTCAAGAATTGAGAAGG - Intergenic
1102143251 12:110634289-110634311 GGGCAGGACAAGAATTGGAGGGG + Intronic
1102578085 12:113869697-113869719 AGGAAGGACAAAAATTAAAGAGG + Intronic
1103037931 12:117671575-117671597 TGGAAGGCAAAGAATTAGAAGGG - Intronic
1103722348 12:122981547-122981569 TGGAAGGCCAGGAGGGGAAGAGG - Exonic
1105400990 13:20095908-20095930 AGGAAAGCAAAGAAATGAAGTGG - Intergenic
1106915687 13:34511500-34511522 TGGTAGCCCAAGAACTCAAGGGG - Intergenic
1108301099 13:49076926-49076948 TGGAAGGCCAAGAATTGAAGGGG - Intronic
1108708185 13:53008791-53008813 TGGAAGGCCAAGACAGGAGGAGG - Intergenic
1109431839 13:62246484-62246506 TGGAAATCTAGGAATTGAAGGGG + Intergenic
1109657597 13:65414189-65414211 TGGAAAGCCTAGAATTTAAGAGG - Intergenic
1110499694 13:76212848-76212870 TGGAACGCCAAGAGTTGAAAGGG - Intergenic
1110872742 13:80471473-80471495 TGGAAAGAGAAGAGTTGAAGTGG - Intergenic
1111092830 13:83469778-83469800 TGGAAGGCAAGTAAATGAAGTGG - Intergenic
1112453941 13:99540624-99540646 TGGAAGGACAAGCTTTGAATGGG + Intronic
1112673253 13:101666298-101666320 AGGCAGTCCAAGAATTTAAGAGG - Intronic
1112911592 13:104492102-104492124 AGGAAGGCCAAGTATTCAACAGG - Intergenic
1114868134 14:26622967-26622989 TCAAAGGCCCAGAATTTAAGAGG + Intergenic
1115143445 14:30199689-30199711 TGTAAGTCCAAGAATTCAAAGGG - Intergenic
1117818263 14:59620702-59620724 TGGACTGCCAAAAAGTGAAGAGG + Intronic
1118079925 14:62347035-62347057 TGGAAGGAAAAGAATTGTATTGG + Intergenic
1118901191 14:69987285-69987307 GGAGAGCCCAAGAATTGAAGGGG + Intronic
1119655358 14:76413457-76413479 TGCCAGGCCAAGAAGGGAAGAGG - Intronic
1121463054 14:94096888-94096910 TGGAAGTCCAAGAATCCGAGTGG + Exonic
1121605751 14:95238589-95238611 TGGCAGGCCAAGTCTTGTAGAGG + Intronic
1122244200 14:100389982-100390004 AGAAAGGCCAAGAAATAAAGAGG - Intronic
1123104734 14:105835580-105835602 AGGAAGGCCAAGAAGAGAAGAGG - Intergenic
1127221285 15:56884169-56884191 TGGAAGGCCAGGTCTTGAAATGG + Intronic
1129078388 15:73017878-73017900 TGGAAGACGAAGAATTGTACTGG - Intergenic
1129428089 15:75479485-75479507 TGAGAGGCCAAGAATAGCAGTGG - Intronic
1131349785 15:91688802-91688824 TGGAAGGGAAGGAATTGAATTGG - Intergenic
1131809617 15:96159072-96159094 TGGAAGTCAAAGATTGGAAGAGG - Intergenic
1132202360 15:99963659-99963681 TCCAAGGCAAAGAAATGAAGTGG + Intergenic
1132263872 15:100449130-100449152 TGGAAGGCCCAGAAATTAACTGG + Intronic
1132461403 16:56947-56969 GGGAAGGCCAGGAAGTGCAGTGG - Intronic
1135413715 16:22253419-22253441 TGGAAGGCCGCAAATTGCAGAGG - Intronic
1140578298 16:76198856-76198878 AGGAAATCCAAGAATGGAAGTGG - Intergenic
1145344167 17:21978261-21978283 TGGAATGCAAAGAAATGCAGTGG + Intergenic
1145400695 17:22529963-22529985 TGGAAGGCCTAGAATTGTGGGGG - Intergenic
1145699221 17:26815412-26815434 TGGAATGGAAAGAACTGAAGTGG + Intergenic
1146755917 17:35431994-35432016 TTGAAGGCCAAGGAGTGAATGGG - Intronic
1147704021 17:42413699-42413721 TGGAAGCCCAAGAATGGGACTGG - Intronic
1149833341 17:59890764-59890786 TGGAAGGCCTGGCTTTGAAGGGG + Intronic
1151396584 17:73826972-73826994 TGGAAGGCCAAAGAGTGAACAGG - Intergenic
1153872089 18:9330906-9330928 AGGAAGGCCTAGAATTGAAAGGG + Intergenic
1154193194 18:12247165-12247187 TGGAAGCCAAAGAACTGCAGCGG - Intergenic
1155400632 18:25435228-25435250 AACAAGGCCAAGAATTGAATGGG - Intergenic
1163363062 19:16860136-16860158 AGCAAGGTCCAGAATTGAAGCGG + Intronic
1163417709 19:17196453-17196475 TGGGAGGCCAAGAGTTTGAGAGG + Intronic
1163645196 19:18485322-18485344 TGGAAGGCCCAAAAGTGAGGTGG - Intronic
1164370112 19:27636597-27636619 TAGAATGCCTAGAATTGACGAGG + Intergenic
1164884572 19:31767654-31767676 TGGAAGCCTGAGAAATGAAGTGG - Intergenic
1165816435 19:38645266-38645288 TGGAGGTGCACGAATTGAAGAGG + Intergenic
1166209032 19:41293754-41293776 TGGGAGGCCAAGAAGGGAGGAGG + Intronic
927022796 2:19034971-19034993 TGGCAGAACAAGAATGGAAGAGG - Intergenic
929251149 2:39757035-39757057 AGGGAAGCCAAGAAATGAAGAGG + Intronic
930476971 2:51893637-51893659 TGGAAAGCAAAGAATAGCAGGGG + Intergenic
930654699 2:53996290-53996312 TGGAAGTGCAAGAAGTGTAGGGG + Intronic
931732474 2:65165441-65165463 TAGAAGGTAGAGAATTGAAGAGG + Intergenic
933562677 2:83907909-83907931 TGGAAGGGGAAGGATTGTAGGGG + Intergenic
940341689 2:152588239-152588261 TGGAAGCCAAAGAATCTAAGTGG - Intronic
942017057 2:171828206-171828228 CTGAAGGCCAAGAAGTGAATGGG + Intronic
944749698 2:202696359-202696381 TGGAAGACGAAGAATTGTATTGG + Intronic
945936891 2:215911727-215911749 TGGAAGGGCTAGAATCGCAGTGG - Intergenic
946993496 2:225363348-225363370 AGGAACGCCAAGTTTTGAAGGGG + Intergenic
1170579537 20:17687382-17687404 TGGAGGGCTAAGAAATGAATGGG + Intergenic
1170882482 20:20309357-20309379 TGAAATGAAAAGAATTGAAGGGG + Intronic
1170926504 20:20729496-20729518 TGTAAGGCTTAGAATTGAACTGG + Intergenic
1171373183 20:24674716-24674738 TGGAAGGCCAAGGCTCAAAGAGG + Intergenic
1172060085 20:32181516-32181538 TGGTAGACCAAGCATTGACGCGG - Intergenic
1172887728 20:38242259-38242281 TGGAGGGCTAAGACTTGAATTGG - Intronic
1173487531 20:43452364-43452386 TGGCAGGCCAAGATTTGACTGGG + Intergenic
1174037189 20:47675564-47675586 TTGAAGGCCAAGGCCTGAAGTGG - Intronic
1174435238 20:50501889-50501911 TGGAAAACCAAGGATTGGAGAGG + Intergenic
1174770515 20:53295264-53295286 TGCAAGGCCAAGATTTGAACAGG - Intronic
1175880892 20:62258215-62258237 TTGAAGCCCAAGAACTGAGGGGG - Intronic
1177444818 21:21180096-21180118 AGGAAGGCCAAGTAGTGATGAGG - Intronic
1182715880 22:32356028-32356050 TGTAAGGTGAAGAATTGAGGCGG + Intronic
1184827823 22:46965020-46965042 TCGAAGACCAAGGATTGATGAGG + Intronic
1203302618 22_KI270736v1_random:87655-87677 TGGAATGCAATGAATTGGAGTGG + Intergenic
949588384 3:5466273-5466295 TAGAAGGCTAAGATTTGGAGAGG + Intergenic
951950736 3:28197626-28197648 TGGAAGTCAAAGAAATGAGGAGG + Intergenic
952339326 3:32432307-32432329 TGGAAGGCCAGGAAGTGATTTGG - Intronic
953701696 3:45201073-45201095 TGGAAGGCCTATACATGAAGAGG - Intergenic
954551473 3:51485230-51485252 GAGAAGGCCAAGAAATGAAATGG + Intronic
954619739 3:51988711-51988733 GAGAAAGCGAAGAATTGAAGGGG - Intronic
955052112 3:55423126-55423148 TGGAAGGACAAGGGTGGAAGTGG - Intergenic
956591839 3:70923603-70923625 AGGAAGGCCAAGAATAGAGAAGG + Intergenic
956941788 3:74170508-74170530 AGGAAGACCAAGAAATGTAGGGG + Intergenic
956998913 3:74861596-74861618 TGAAAGGCCAAGCATTAAAATGG - Intergenic
957242580 3:77677589-77677611 GGAAAGGGCAAGAATTGAGGAGG - Intergenic
959663872 3:108900186-108900208 TGGAGGGACAAGGGTTGAAGTGG + Intergenic
963148035 3:142014981-142015003 TTGAAGGCCAAGAATTTCAGTGG - Intronic
963178692 3:142330257-142330279 TGGAATTGCAAGAATTGAGGTGG - Intronic
965750287 3:171968793-171968815 TCTAAGGGCAAGAATTGTAGAGG - Intergenic
968327380 3:197830522-197830544 TGGACGAACAAGAATTGCAGAGG + Intronic
973554228 4:52066066-52066088 TGGTTGACCAAGAATGGAAGTGG - Intronic
974894279 4:67920038-67920060 TTGAAGGTCAAGAATGGATGTGG + Intronic
975538988 4:75484522-75484544 TGCAAGAAGAAGAATTGAAGAGG - Intronic
976144453 4:82028021-82028043 GGGAAGGTCAAGAACTGCAGGGG + Intronic
980071010 4:128243004-128243026 TGGGAGGTGAAGAATTGGAGAGG + Intergenic
980078941 4:128323374-128323396 TGGAAAACCAAGAATTATAGAGG - Intergenic
980839748 4:138243706-138243728 TGGATGGCAAAGCATTGAGGTGG - Intergenic
982609608 4:157557269-157557291 TGGGAGCCCAATAATAGAAGTGG - Intergenic
982793869 4:159622749-159622771 TGGAAGGCAAATAATAGATGTGG + Intergenic
982823702 4:159976473-159976495 TGGAAGCCCAGATATTGAAGGGG + Intergenic
983382858 4:167019933-167019955 TGGAAGGTCAGGTACTGAAGAGG + Intronic
984244754 4:177261733-177261755 TGTAATCCCAACAATTGAAGAGG + Intergenic
984505620 4:180614732-180614754 AGGAAGGTCAAGAATTTCAGAGG + Intergenic
985730010 5:1542262-1542284 TGGGAGGCCAGGAAAGGAAGAGG - Intergenic
986240321 5:5954807-5954829 TGGAAGGGCAAGGAGGGAAGGGG - Intergenic
986270177 5:6223270-6223292 TGGAGGGTCAAGAAATGTAGTGG + Intergenic
987263425 5:16226853-16226875 TGGAAGGGAAAGAAATGAATAGG + Intergenic
987938645 5:24503162-24503184 TGGAAGGCAAAGCATTGGATGGG - Intronic
988195832 5:28004288-28004310 TGGAAAGCAAAAAATTGCAGGGG + Intergenic
988601557 5:32644584-32644606 TGGAAGGCCAAGAAAGGACTTGG + Intergenic
989314776 5:40065459-40065481 TGGAAGAGGAAGAATTAAAGTGG + Intergenic
991188198 5:63835888-63835910 TCGAAAGCCAACAATTGGAGAGG - Intergenic
992310461 5:75493258-75493280 TGGAAGGGTATGAATTGATGAGG - Intronic
993250858 5:85520366-85520388 TGGACTTCCAAGAATTGAATTGG + Intergenic
998126618 5:139627430-139627452 TGAAAGGCCAAAGGTTGAAGGGG - Exonic
1000282813 5:159796868-159796890 TGAGAGGCCAAGAAATCAAGTGG + Intergenic
1002395834 5:178953502-178953524 TGAACGGCCAAGGATAGAAGGGG - Intronic
1003167090 6:3689476-3689498 TGGAAGGGGAAGGATGGAAGGGG - Intergenic
1003768897 6:9274687-9274709 TAGAAGTCCAAGAATTTAAGGGG - Intergenic
1004647634 6:17577976-17577998 TGGAAGGTCAGAAATAGAAGGGG - Intergenic
1005424771 6:25691072-25691094 TGGAAGGCCCAGAAGTGGATGGG + Exonic
1005691844 6:28314161-28314183 AGGAAGCCCAAGAGTTGGAGAGG + Intergenic
1005927774 6:30458136-30458158 TGGAAGGCCAACAATTCACCTGG + Intergenic
1007900781 6:45410104-45410126 GGGAAGGCCAGGACATGAAGGGG + Intronic
1009294351 6:61926417-61926439 TTGAAAGACAAGAATTGAAAAGG + Intronic
1011220571 6:85050531-85050553 TGGAAGCCTAACAATGGAAGTGG + Intergenic
1013094021 6:106927854-106927876 TAGAAGGCTAAGAAGAGAAGGGG + Intergenic
1015166614 6:130206442-130206464 TGGAAAGCCAGGGAGTGAAGTGG - Intronic
1017914611 6:158821541-158821563 GGGAATGCCAAAAAATGAAGTGG + Intergenic
1023753439 7:43393577-43393599 TGAAAAGCCAAGAATTTAGGTGG + Intronic
1024037147 7:45516790-45516812 TGGAAGGCCAAAGAGAGAAGAGG - Intergenic
1024872850 7:53985658-53985680 TGGAAGAGCAAGACTTCAAGAGG - Intergenic
1027607557 7:80318810-80318832 GGGAAGGCAAAGATTTGAAGTGG - Intergenic
1031913837 7:127544315-127544337 GGGAAGGCCAAGATCTGAACTGG - Intergenic
1032442790 7:131954966-131954988 AGGAAGGCAAAGAAATGATGGGG - Intergenic
1033609486 7:142952376-142952398 TGGAAAGCCAAGACATGGAGGGG + Intronic
1034181693 7:149144077-149144099 TTTAAGGCCAAGAATTAAATAGG + Intronic
1036638035 8:10564880-10564902 TGGAAGGCAAAGGAGTCAAGTGG + Intergenic
1038230685 8:25696910-25696932 TGGAAGGCCAACAAGCAAAGAGG + Intergenic
1038335168 8:26640270-26640292 TATAAGGCCAAGAACTGCAGGGG - Intronic
1039079074 8:33718132-33718154 TGGAAGGCCATGAAATGGACAGG - Intergenic
1041554524 8:59137765-59137787 TTTAAGGCCAAGACTTGAAGTGG - Intergenic
1044331028 8:90920517-90920539 TGGGAAGACAAGACTTGAAGTGG + Intronic
1045203975 8:100017220-100017242 TGGGAGGCCAAGAAGCCAAGAGG - Intronic
1045339895 8:101244283-101244305 TTGAAGGGCAAGAGTGGAAGTGG - Intergenic
1046436313 8:114193998-114194020 TGGAGGGTCAAGAATGGAACTGG + Intergenic
1048430726 8:134368143-134368165 TGGAAGGCCATATATTTAAGTGG - Intergenic
1049002011 8:139832239-139832261 TGGAAGGCCAAGGAAGAAAGAGG - Intronic
1050085735 9:1963846-1963868 AAGAAAGCCACGAATTGAAGAGG - Intergenic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1052107973 9:24543988-24544010 TGAAAGGCTGAGAAATGAAGAGG - Intronic
1052332406 9:27283127-27283149 TGGTATGGTAAGAATTGAAGAGG + Intergenic
1052793794 9:32903330-32903352 TTAAAGGCCAGGAATTAAAGCGG - Intergenic
1055634851 9:78266633-78266655 TGGAAGTCAAAGAAAAGAAGAGG + Exonic
1057360513 9:94369445-94369467 TGGAAGGCAAATAATTGAGGAGG + Intergenic
1058405464 9:104668133-104668155 TGGCTGGCCAGGAACTGAAGAGG - Intergenic
1059731468 9:117061189-117061211 AAGAATGCCAAGAATTGCAGGGG + Intronic
1060289571 9:122288686-122288708 TGGAAGGCCAGTAATTGATATGG + Intronic
1061738854 9:132684431-132684453 TGGAGGGGCAAGGATGGAAGTGG - Intronic
1061922406 9:133789301-133789323 TGGAAGACCAAAGATTGACGGGG - Exonic
1203343692 Un_KI270442v1:16455-16477 TGGAATGCAGAGAATTGTAGTGG + Intergenic
1186929375 X:14371494-14371516 TGGAAGGCAAAAAATAGCAGGGG + Intergenic
1188089718 X:25949381-25949403 TGGGAGGCAGATAATTGAAGTGG + Intergenic
1189048461 X:37618390-37618412 TGTAAGGGCAGGAAGTGAAGAGG - Intronic
1192339844 X:70254940-70254962 GGGAAGGCCTAGAATTGAGTTGG + Intergenic
1193170439 X:78329616-78329638 TTGAAGCTCAAGGATTGAAGGGG - Intergenic
1195979907 X:110566703-110566725 GGGAAGGCCCAAACTTGAAGGGG - Intergenic
1196874506 X:120145484-120145506 TAGAAGGCCAAGACCTTAAGAGG + Intergenic
1200965387 Y:9031433-9031455 TGGAAAGGCAAGAATTGCAAAGG + Intergenic
1201114984 Y:10828600-10828622 TGGAATGCAAAGGAATGAAGTGG - Intergenic
1201131104 Y:10952599-10952621 TGGAATGCCATGGATTGGAGTGG - Intergenic
1201138225 Y:11006940-11006962 TGGAAGGTGATGCATTGAAGAGG - Intergenic
1201140955 Y:11027575-11027597 TGGAAGGGAAAGAAGTGGAGTGG - Intergenic
1201849585 Y:18463230-18463252 TGGAGAGACAAGAATTGAAGAGG - Intergenic
1201883733 Y:18857145-18857167 TGGAGAGACAAGAATTGAAGAGG + Intergenic
1202607091 Y:26648367-26648389 TGGAAGGCAGTGAATTGGAGTGG + Intergenic
1202607463 Y:26651240-26651262 TGGAAGGCAGTGAATTGGAGTGG + Intergenic
1202608304 Y:26657750-26657772 TGGAAGGCAGTGAATTGGAGTGG + Intergenic
1202608674 Y:26660643-26660665 TGGAAGGCAGTGAATTGGAGTGG + Intergenic
1202608968 Y:26662988-26663010 TGGAATGCGATGAATTGGAGCGG + Intergenic
1202609040 Y:26663491-26663513 TGGAAGGCAGTGAATTGGAGTGG + Intergenic
1202609416 Y:26666344-26666366 TGGAAGGCAGTGAATTGGAGTGG + Intergenic
1202609925 Y:26670195-26670217 TGGAAGGCAGTGAATTGGAGTGG + Intergenic
1202610310 Y:26673067-26673089 TGGAAGGCAGTGAATTGGAGTGG + Intergenic