ID: 1108301719

View in Genome Browser
Species Human (GRCh38)
Location 13:49084061-49084083
Sequence CTAGTTGATATACTATTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108301719_1108301720 2 Left 1108301719 13:49084061-49084083 CCTATAAATAGTATATCAACTAG 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1108301720 13:49084086-49084108 AATTTATTAATACCCACTACTGG 0: 1
1: 0
2: 0
3: 10
4: 164
1108301719_1108301723 20 Left 1108301719 13:49084061-49084083 CCTATAAATAGTATATCAACTAG 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1108301723 13:49084104-49084126 ACTGGTGAAATAAATACTTGAGG 0: 1
1: 0
2: 2
3: 23
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108301719 Original CRISPR CTAGTTGATATACTATTTAT AGG (reversed) Intronic
907541791 1:55222199-55222221 CTAGTTGATATGTTATTTAAGGG + Intergenic
907998810 1:59659738-59659760 CTAGTAGGTATAATATTTGTAGG + Intronic
910338708 1:86161428-86161450 CTAATTTATCTAATATTTATGGG + Intergenic
912153597 1:106888325-106888347 CCAGTTTATTTACTATTTGTAGG + Intergenic
913182809 1:116338651-116338673 AAAGTTGACATACTACTTATAGG + Intergenic
913472939 1:119208108-119208130 ATATTGGAAATACTATTTATTGG + Intergenic
915324934 1:155076858-155076880 GAAGTTGAGATACTCTTTATAGG - Intergenic
916197764 1:162240788-162240810 CTGGGTGATATACTAAGTATTGG + Intronic
917394465 1:174577556-174577578 CAAGAGGATATACTATTTTTAGG - Intronic
923775655 1:236976293-236976315 CTATTTGATATTCTACTTCTAGG + Intergenic
924538646 1:244960426-244960448 CTAGTTAATATTCTACTTAAAGG + Intergenic
1067373681 10:45708010-45708032 ATAGATACTATACTATTTATAGG + Intergenic
1067881503 10:50049781-50049803 ATAGATACTATACTATTTATAGG + Intergenic
1068988966 10:63131960-63131982 CTAGTTGATTGACTAATTATGGG - Intergenic
1071735934 10:88300879-88300901 CAAGTAGATTTACTCTTTATGGG + Intronic
1072319462 10:94234422-94234444 ATAGTTGTTATATTATTTCTGGG + Intronic
1073925841 10:108514147-108514169 CTAGTTGATAAACCCTTTAGAGG - Intergenic
1075836181 10:125454676-125454698 CTATTCAATACACTATTTATTGG - Intergenic
1080733499 11:34985544-34985566 CTATTCGATGTACTATTTTTTGG - Intronic
1088498496 11:110457632-110457654 CTAGCTGATATACTATTTCAAGG + Intronic
1090794158 11:130120100-130120122 GTAGGTGATATATTATTTTTAGG + Intronic
1090932181 11:131307900-131307922 TTAGTTGATATACAATTAACTGG - Intergenic
1093220206 12:16411989-16412011 CTAGTTTATACACTTTATATGGG - Intronic
1096611217 12:52803250-52803272 CTAGTCTATAAATTATTTATGGG - Intergenic
1098218455 12:68243875-68243897 CCAGTTGCTAAACTATTTACAGG + Intergenic
1098673652 12:73262285-73262307 CTAGTTGTTATACAATTTAAAGG + Intergenic
1098732510 12:74056142-74056164 CCAGTTTGTATGCTATTTATTGG + Intergenic
1099304150 12:80934697-80934719 CAAGTTGCTCTACTATTTAGTGG - Intronic
1099393841 12:82114315-82114337 CTAGCTGATATACTGTTTCATGG - Intergenic
1099530121 12:83768550-83768572 ATTGTTAATATACTGTTTATAGG - Intergenic
1099530860 12:83779214-83779236 CAAAATCATATACTATTTATAGG + Intergenic
1103250735 12:119497812-119497834 CTAGTTTAAATATTGTTTATAGG + Intronic
1108301719 13:49084061-49084083 CTAGTTGATATACTATTTATAGG - Intronic
1110426461 13:75372756-75372778 CTAGTTAATTTACTTTTTATGGG - Intronic
1110947727 13:81444209-81444231 CTATTTGATATATTTTATATTGG + Intergenic
1111074979 13:83222362-83222384 CAAGTTGTTATACTTTATATTGG - Intergenic
1111504744 13:89173006-89173028 GTATTTTATATACTAGTTATTGG - Intergenic
1112703472 13:102038889-102038911 CTAGTAGAAATAGTATTTATGGG - Intronic
1113123146 13:106946214-106946236 TAAATTGATATAGTATTTATAGG + Intergenic
1114413532 14:22522817-22522839 CTAGATGAAACATTATTTATGGG - Intergenic
1114833078 14:26168567-26168589 TTACTTGATTTACTACTTATAGG + Intergenic
1117130386 14:52680841-52680863 CAATGTCATATACTATTTATGGG - Intronic
1119699502 14:76743698-76743720 CTGGTTCATATACTATAAATTGG - Intergenic
1121543261 14:94744415-94744437 ATAGCAGATATAATATTTATTGG + Intergenic
1122057185 14:99108680-99108702 CTAGAAGATATCCTATTAATTGG + Intergenic
1123820349 15:24023439-24023461 CTGGTTGCTGAACTATTTATAGG + Intergenic
1126563305 15:50068405-50068427 CTTGTTGATATCCTAGTTATTGG - Intronic
1126714097 15:51495424-51495446 ATAGTTAATATATTTTTTATTGG - Intronic
1127095458 15:55508245-55508267 CTTGTTGCTCTCCTATTTATAGG + Intergenic
1127775410 15:62260611-62260633 CTAGTTGATCCACAATTTCTTGG + Intergenic
1130156039 15:81350853-81350875 CTTGGTGATTTTCTATTTATGGG + Intronic
1136715244 16:32275392-32275414 CAAGTTAATATACTACATATTGG + Intergenic
1136752671 16:32654336-32654358 CAAGTTAATATACTACATATTGG - Intergenic
1136821920 16:33326106-33326128 CAAGTTAATATACTACATATTGG + Intergenic
1136828483 16:33382645-33382667 CAAGTTAATATACTACATATTGG + Intergenic
1136833549 16:33481418-33481440 CAAGTTAATATACTACATATTGG + Intergenic
1137868699 16:51928774-51928796 CTGGTTGATATATTATCCATTGG - Intergenic
1138321334 16:56115261-56115283 CTAGGTTATATACTGTTTTTAGG - Intergenic
1139806597 16:69570619-69570641 ATAGTTTATAAACTATTTCTTGG + Intronic
1202994021 16_KI270728v1_random:39001-39023 CAAGTTAATATACTACATATTGG + Intergenic
1203011367 16_KI270728v1_random:243104-243126 CAAGTTAATATACTACATATTGG - Intergenic
1203054810 16_KI270728v1_random:914377-914399 CAAGTTAATATACTACATATTGG - Intergenic
1143406475 17:6680940-6680962 CTAGATTATATAATATTTCTAGG + Intergenic
1155637583 18:27973994-27974016 CTAGTTGAAAATGTATTTATTGG - Intronic
1156083706 18:33373851-33373873 GTAGTTGATATACTGCTTAGTGG - Intronic
1157042652 18:44059217-44059239 CTGCTAGATATACTATTTATAGG + Intergenic
1159820104 18:73130809-73130831 CTAGTTGCTATGGTATTAATGGG + Intergenic
1166555006 19:43693106-43693128 CTAATTGAAATAGTATTTACTGG + Intergenic
1166603682 19:44120584-44120606 CTTGTTGGGATACTATTTTTAGG + Intronic
1168410101 19:56134474-56134496 CCATTTCATATACTATTTTTGGG - Intronic
927416149 2:22882659-22882681 CTCCTTGTTTTACTATTTATTGG - Intergenic
931101392 2:59005476-59005498 TTACATGATATACTATTCATTGG + Intergenic
931750090 2:65322733-65322755 CTATTAGATATAATATTTCTAGG + Intronic
933340515 2:81019757-81019779 CTATTTGATATCCAATTTGTTGG - Intergenic
935311728 2:101790620-101790642 ATAGTTGAGATACGATTTGTTGG + Intronic
936692504 2:114907872-114907894 CTAGTTGTTCTACTTATTATTGG + Intronic
938254056 2:129840471-129840493 CTAAATCATATACTATTTAAAGG + Intergenic
938630439 2:133160814-133160836 CTAGATGATAATCTATTTCTAGG + Intronic
938808895 2:134833548-134833570 CTATTTGCCCTACTATTTATGGG + Intergenic
939652272 2:144778438-144778460 TTAGTTCACATACTGTTTATTGG + Intergenic
940458118 2:153927866-153927888 CTAGTTAATAAAGTATTAATAGG - Intronic
940768213 2:157812458-157812480 CTACATAATATACTATTTCTTGG + Intronic
941433325 2:165437195-165437217 CTAGTTGAGAAGCTATTTAAAGG - Intergenic
942695535 2:178639009-178639031 ATAGTTCATATACAATTAATAGG + Intronic
943181710 2:184552276-184552298 TTACTTGAAAAACTATTTATAGG + Intergenic
944386933 2:199176838-199176860 ATAGTATATATAGTATTTATGGG + Intergenic
947202719 2:227629246-227629268 CTATTTCATAAACTATTTTTTGG - Intronic
947328731 2:229005566-229005588 TTATTTTATTTACTATTTATAGG - Intronic
1170178038 20:13494860-13494882 CTTGGTGACTTACTATTTATAGG - Intronic
1171822509 20:29866395-29866417 CTAGTATATATACTATATACTGG - Intergenic
1173699542 20:45056075-45056097 GTAGTTGAAATAGTATTTAAAGG - Intronic
1176727438 21:10451210-10451232 TTAGTTGATAAACCATTTAAGGG + Intergenic
1177105951 21:16955813-16955835 ATGGTTGATAAACTATCTATTGG - Intergenic
1177268069 21:18809808-18809830 CCAGTGGATATACTATTATTGGG + Intergenic
1177368116 21:20165157-20165179 TTTGTTGATATCCTAATTATAGG + Intergenic
1178207286 21:30484867-30484889 ATAGTTGGTAAACTATTTCTGGG + Intronic
1180286960 22:10755817-10755839 TTAGTTGATAAACCATTTAAGGG - Intergenic
949109783 3:245474-245496 CTAGTCGTGATACTAATTATTGG - Intronic
951348118 3:21571478-21571500 CTAGGTTATAGAATATTTATAGG + Intronic
951796135 3:26540716-26540738 AAAGTTGCTATACTATTGATAGG + Intergenic
952245142 3:31580075-31580097 TCAGTTCACATACTATTTATGGG + Exonic
953954853 3:47223889-47223911 ATAGTTGATATATTGTTTGTGGG - Intergenic
960155937 3:114297394-114297416 CTAGTTTTTATGCTATTTATTGG + Intronic
962778917 3:138692563-138692585 CTATTTTTTACACTATTTATAGG - Intronic
963557262 3:146807931-146807953 CTAACTGATATACTCTTTAAAGG + Intergenic
965526509 3:169725071-169725093 ATAGTAGGTATATTATTTATGGG + Intergenic
965921249 3:173917114-173917136 CAAGTTGATAAACTATATAATGG + Intronic
966278422 3:178203119-178203141 TTAGTTGATATAATATGAATGGG + Intergenic
966321345 3:178704516-178704538 CTAGTGGCTATTGTATTTATTGG + Intronic
966501112 3:180640754-180640776 TTGGTTTATATACTGTTTATAGG - Intronic
967395575 3:189004885-189004907 ATAGTAGGTATATTATTTATGGG + Intronic
967483944 3:190008479-190008501 CTATTTGATATAATTTTTCTAGG - Intronic
967981404 3:195067889-195067911 CTACTTGATTTCCTATTTATAGG - Intergenic
971935938 4:33147506-33147528 TCAGTTGATAAACTATTTAAAGG - Intergenic
974424980 4:61730654-61730676 ATAAATTATATACTATTTATAGG + Intronic
975474204 4:74804127-74804149 TTAGTTCATCTACTATTTAAAGG - Intergenic
978010291 4:103673815-103673837 CTACTAGAAATATTATTTATAGG - Intronic
979952949 4:126917704-126917726 TTAGTTGATATAATAGTTCTTGG - Intergenic
981268128 4:142811541-142811563 CAATGTGATATACTATTTCTGGG - Intronic
981499196 4:145430291-145430313 CTATTTTTTATACTATTTAATGG - Intergenic
984848085 4:184124995-184125017 CTAGTTGAGTAAATATTTATTGG + Intronic
986580761 5:9263433-9263455 CTAGGTTATCTACTCTTTATGGG + Intronic
991411460 5:66349579-66349601 AAAGTTGTTATCCTATTTATGGG + Intergenic
992369650 5:76129711-76129733 TCAGTTGATATACAATTTCTTGG + Intronic
993242049 5:85403088-85403110 CTAGTTGATATATTATTTGCTGG - Intergenic
993536270 5:89090389-89090411 CCAGTTCATAAATTATTTATTGG + Intergenic
994512988 5:100731418-100731440 ATAGTTAATATACTATTTTTTGG - Intergenic
994896647 5:105713088-105713110 TAAGCTGATATAGTATTTATTGG + Intergenic
995739150 5:115336264-115336286 CAAGTTGTTGTACCATTTATTGG - Intergenic
1000288898 5:159851480-159851502 ATTGTTAATATACTATTTTTGGG - Intergenic
1003083455 6:3041357-3041379 CCAGTTGCTGAACTATTTATAGG - Intergenic
1004227207 6:13796987-13797009 CTAGGTGATTTAATCTTTATGGG + Intronic
1006011883 6:31049364-31049386 ATAATTTATATACTATTCATAGG - Intergenic
1010986918 6:82435320-82435342 GAAGCTGATATACTACTTATGGG + Intergenic
1016266913 6:142243316-142243338 CTAGTGAAGATAATATTTATAGG - Intergenic
1016613908 6:146025421-146025443 CTATTTAATACACTATTTAGTGG - Intergenic
1017229631 6:152059040-152059062 CTAGTTGAAAAAATATTAATTGG + Intronic
1017360498 6:153563956-153563978 CCAGTTTATATAGTATTTAGTGG - Intergenic
1017504175 6:155052379-155052401 TTACTTGATATATTAGTTATAGG + Intronic
1017641835 6:156502138-156502160 CTTGTTGCTATACAGTTTATGGG + Intergenic
1018174064 6:161163999-161164021 ATCGGTGATATTCTATTTATAGG - Intronic
1020821781 7:12978099-12978121 GCAGTTGATATAATATTTACTGG + Intergenic
1023880846 7:44320654-44320676 CTAGTTTAGTTACTATTTAATGG - Intronic
1024867142 7:53916351-53916373 CTTGTTGAAAAATTATTTATTGG + Intergenic
1027847897 7:83407305-83407327 TCAGATGATATACAATTTATTGG - Intronic
1028848052 7:95504995-95505017 CAAGTTGATAGTCTATTTAGTGG + Intronic
1030253464 7:107478660-107478682 GTACATGATATACTATATATAGG + Intronic
1030351973 7:108499822-108499844 CTACAAGATAAACTATTTATTGG + Intronic
1033765646 7:144487519-144487541 CTACATGATTTACTATTGATTGG + Intronic
1034602667 7:152276775-152276797 TTAGTTGATACACCATTTAAGGG - Intronic
1035663006 8:1361342-1361364 CTACTTCAGATGCTATTTATAGG + Intergenic
1040450886 8:47545740-47545762 ATAGTTAATATTATATTTATTGG - Intronic
1041272654 8:56124210-56124232 CTGGTTGAAATAGTATTTTTAGG - Intergenic
1043171328 8:76970997-76971019 TAAGTAGATATACAATTTATTGG + Intergenic
1048645979 8:136420237-136420259 CTATTTAATAGACTAATTATTGG + Intergenic
1049068980 8:140342313-140342335 TTAGTGGATATACTAGTTATAGG - Intronic
1049975018 9:853289-853311 CTTGTTGATGTACTTTTTAATGG + Intronic
1051180016 9:14401529-14401551 CTTGTTGAGTAACTATTTATAGG - Intergenic
1052138728 9:24949769-24949791 CTAGTTGATATAGAATTTCAAGG - Intergenic
1052850456 9:33375258-33375280 CTAGTTGATATACACAGTATGGG + Intergenic
1056009985 9:82318506-82318528 TTAATTGATATACTAGTAATAGG + Intergenic
1186405386 X:9297371-9297393 ATAATTGATATATTAATTATAGG + Intergenic
1188256432 X:27966770-27966792 CAACTTGATATACTATCTTTTGG + Intergenic
1188515817 X:30984616-30984638 TAAGTTTATATACTACTTATAGG + Intergenic
1188765323 X:34083595-34083617 TAATTCGATATACTATTTATAGG + Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1190576389 X:51843531-51843553 CTAGGTGAGATGCTATTTACTGG - Intronic
1192023112 X:67416747-67416769 TAAGTTGATATAATATTTTTAGG + Intergenic
1192319691 X:70079627-70079649 CTACTTGATAGACAATTTAAGGG - Intergenic
1192677708 X:73215754-73215776 CTATTTGATAATGTATTTATAGG + Intergenic
1195836627 X:109122594-109122616 ATATTTTAGATACTATTTATTGG - Intergenic
1196043417 X:111230761-111230783 TTAGTTTATATACCATTTAAAGG - Intergenic
1201748777 Y:17409839-17409861 CTAGGTAATATACTTTTTAGGGG + Intergenic
1201993099 Y:20051019-20051041 CTAATTGTTTTACTTTTTATTGG - Intergenic