ID: 1108302109

View in Genome Browser
Species Human (GRCh38)
Location 13:49089271-49089293
Sequence ATTATTTAAGCTCTGGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108302109_1108302113 -3 Left 1108302109 13:49089271-49089293 CCTGAAGCCAGAGCTTAAATAAT 0: 1
1: 0
2: 1
3: 20
4: 193
Right 1108302113 13:49089291-49089313 AATGTGGTAGGCAAAATTCTAGG 0: 1
1: 0
2: 2
3: 45
4: 310
1108302109_1108302114 1 Left 1108302109 13:49089271-49089293 CCTGAAGCCAGAGCTTAAATAAT 0: 1
1: 0
2: 1
3: 20
4: 193
Right 1108302114 13:49089295-49089317 TGGTAGGCAAAATTCTAGGATGG 0: 1
1: 4
2: 52
3: 142
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108302109 Original CRISPR ATTATTTAAGCTCTGGCTTC AGG (reversed) Intronic
900969127 1:5979834-5979856 ATTACTGATGCTCTGGCATCTGG + Intronic
903235521 1:21948235-21948257 ATTAATTAAGCTCTTGGTTTTGG - Intergenic
904305659 1:29587336-29587358 ATTATTGATGCTCTGGCATTTGG + Intergenic
909349499 1:74634551-74634573 ATTATTTAAGCTCTGCTGGCTGG - Intronic
911367724 1:96959333-96959355 ATTCCTTACGCTCTGGCTCCTGG + Intergenic
912549250 1:110473988-110474010 ATTCTTGATGCTCTGGCATCTGG - Intergenic
913224827 1:116689705-116689727 TTTATGAAAGCCCTGGCTTCTGG - Intergenic
917196236 1:172468927-172468949 GTTATTTCAGCTCTTTCTTCAGG + Intergenic
917196265 1:172469221-172469243 GTTATTTCAGCTCTTTCTTCAGG + Intergenic
918411612 1:184264395-184264417 ATTATTTTAGCTATATCTTCTGG - Intergenic
918411852 1:184267431-184267453 AGGATTTTTGCTCTGGCTTCTGG + Intergenic
920201760 1:204263831-204263853 ATTAATAAAGCTCTGACTCCAGG - Intronic
920601972 1:207335801-207335823 ATGATGTAATCTCTTGCTTCAGG + Intronic
922651281 1:227341166-227341188 ATTCTTGATGCTCTGGCATCTGG - Intergenic
923367921 1:233281727-233281749 ATTTTTAAAGATCTGGATTCTGG + Intronic
1063826009 10:9897970-9897992 ATTATTTAATCTTTCACTTCAGG - Intergenic
1064283234 10:13969896-13969918 AGTTTTGAAGCCCTGGCTTCTGG - Intronic
1064387098 10:14905552-14905574 AGTATTTAATCTTCGGCTTCAGG + Intronic
1064941022 10:20735563-20735585 TTCCTTTAATCTCTGGCTTCTGG - Intergenic
1067196889 10:44127855-44127877 AGTATCTAAGCTCTGGCTCTGGG + Intergenic
1067869731 10:49946969-49946991 ATTGTATAAGGTCTGTCTTCTGG - Intronic
1068262711 10:54603595-54603617 AGTATATAAGCCCTGGGTTCTGG - Intronic
1069529549 10:69206426-69206448 TTTATTTAAACTCTTGCTTGAGG + Intronic
1069577968 10:69544247-69544269 ATTATTTAAGCTCAGTATTTTGG + Intergenic
1072307271 10:94119799-94119821 ATTATTTTATCTCTAGCTACTGG + Intronic
1076092396 10:127699167-127699189 ATTTTCTAAGCCCTGGATTCGGG - Intergenic
1077606108 11:3613815-3613837 ATTATTTTTGCTCTGATTTCAGG + Intergenic
1079558036 11:21785719-21785741 ATTTTTTATGGTCTGGCTTTTGG + Intergenic
1079800918 11:24867519-24867541 TTTATTTTAGGTGTGGCTTCAGG + Intronic
1079942992 11:26705141-26705163 ATTAATTAAGGTCTGGATTGGGG + Intronic
1084128525 11:67117620-67117642 ACTCTTTAAGCTCTGACTCCTGG - Intergenic
1084725107 11:70936666-70936688 ACTGTTTCAGCTCTGGCTTTTGG - Intronic
1086508928 11:87534610-87534632 ATTATGTAATCTCTGGCTTTTGG + Intergenic
1086850247 11:91799822-91799844 TATTATTAAGCTCTGGCTTCGGG - Intergenic
1090501870 11:127268725-127268747 ATTTTTTCAGCTCTGGCTCTTGG - Intergenic
1090618234 11:128536742-128536764 GTTATTTAAGCAATGACTTCAGG + Intronic
1091092876 11:132789237-132789259 TTTATTTCATGTCTGGCTTCAGG + Intronic
1093524568 12:20091939-20091961 ATTATTTAAGCTGCGTCTTGAGG + Intergenic
1096439009 12:51622980-51623002 ATTGTTCTAGCTTTGGCTTCTGG + Intronic
1096978182 12:55712292-55712314 TTTCTTTGAGCACTGGCTTCAGG + Intronic
1099919060 12:88934520-88934542 ATTAATTAAGCTCTGTGTTTAGG + Intergenic
1101508745 12:105373688-105373710 ATTGTTCCAGCTTTGGCTTCTGG + Intronic
1102793965 12:115672639-115672661 ATTCTTGAAGCTCTAGCTCCAGG - Intergenic
1102810708 12:115821756-115821778 AATATTTTAGCTCTGGGTTTTGG + Intergenic
1103315025 12:120046253-120046275 TTTTCTTAAGCTCTGTCTTCAGG + Intronic
1105703346 13:22950310-22950332 ATTATTCCAGCTTTGGCTACTGG + Intergenic
1105855995 13:24372481-24372503 ATTATTCCAGCTCTGGCTATTGG + Intergenic
1107342789 13:39426582-39426604 AGTATTTAACCTTTTGCTTCTGG + Intronic
1107452983 13:40528632-40528654 ATTATTTCAGCTTTGGCTGTTGG - Intergenic
1107589485 13:41887379-41887401 ATCATTTATGCTATAGCTTCCGG - Intronic
1108302109 13:49089271-49089293 ATTATTTAAGCTCTGGCTTCAGG - Intronic
1109338566 13:61025138-61025160 ATTATATAATCTCTGCTTTCCGG + Intergenic
1109724766 13:66325748-66325770 ATTTTTAAAGCTAAGGCTTCTGG + Intronic
1110142191 13:72144125-72144147 ATAATTAAAGCTCTGTCTTAAGG - Intergenic
1110542901 13:76726029-76726051 ATTGTTCAAGGTCTTGCTTCTGG - Intergenic
1110715615 13:78700582-78700604 CTTATTTTTGCTCTGGCTTCTGG + Intergenic
1111158385 13:84358914-84358936 ATAATTCAAGCTTTGGCTGCTGG - Intergenic
1111449182 13:88391444-88391466 CTTATTTAGGCTCTGGCTCCTGG + Intergenic
1113137529 13:107109812-107109834 CTCAATTAAGCTTTGGCTTCAGG + Intergenic
1115054334 14:29104363-29104385 ATTCTATGTGCTCTGGCTTCTGG - Intergenic
1116454062 14:45097901-45097923 AATATTTTAGCTCTTTCTTCTGG + Intronic
1118473904 14:66099666-66099688 ATTATTTCAGCTCTGCCATCTGG - Intergenic
1119644045 14:76335788-76335810 ATTCTGCAAGCTCTGGTTTCAGG + Intronic
1120173426 14:81269477-81269499 ATTCTTTGAGCTCAGGGTTCAGG + Intronic
1202848867 14_GL000225v1_random:3108-3130 CTTGTCTAAGCTCTGGCTACTGG - Intergenic
1202850680 14_GL000225v1_random:16367-16389 ATTATCTAGGCTCTGCCTACAGG - Intergenic
1202851170 14_GL000225v1_random:20873-20895 ATTATTTAGGCTCTGCCTACAGG - Intergenic
1202854058 14_GL000225v1_random:38876-38898 CTTATCTAAGCTCTGCCTACAGG - Intergenic
1202854153 14_GL000225v1_random:39697-39719 TTTATCTAGGCTCTGCCTTCCGG - Intergenic
1202865503 14_GL000225v1_random:114570-114592 CTTATTTAGGCTCTGCCTACAGG - Intergenic
1202868697 14_GL000225v1_random:139448-139470 CTCATTTAAGCTCTGCCTACAGG + Intergenic
1123700318 15:22909929-22909951 TCTTTTTAAGCTCTGGCTTTTGG + Intronic
1126483555 15:49155006-49155028 ACTATTTAAGCTATGTCTCCAGG + Intronic
1128534896 15:68482820-68482842 ATTCTTTTAGCTCTTTCTTCTGG - Intergenic
1129736130 15:77965642-77965664 ATGATTTAACCTCTTGCTTTTGG - Intergenic
1131571092 15:93537068-93537090 ATTGTTTCAGCTTTGGCCTCTGG + Intergenic
1131753321 15:95533519-95533541 ATTATTTCAGCTTTGGCTGTTGG - Intergenic
1131770788 15:95735194-95735216 ATTTTTTGTGCTCTGGCTTCAGG + Intergenic
1132444821 15:101905369-101905391 GTTATTTAAGAGCTGACTTCTGG + Intergenic
1135771769 16:25223296-25223318 AATAATTGAGCTCAGGCTTCAGG + Intronic
1135869518 16:26136528-26136550 ACTATTTATCCTCTGTCTTCAGG - Exonic
1137662760 16:50223262-50223284 ATTATTTAAAGACTGGCATCCGG + Exonic
1139665353 16:68451277-68451299 AGGGTTTCAGCTCTGGCTTCAGG - Intergenic
1143211882 17:5194083-5194105 CTTACTTAAGCTCTGCCTCCTGG - Intergenic
1150502756 17:65666951-65666973 ATTATTTAAACACTGGCATCTGG + Intronic
1150635083 17:66907455-66907477 ATTATTTAAGGTCATGCTCCTGG + Intergenic
1155396890 18:25395609-25395631 ATTATTTCAGCTTTTGCTTTAGG - Intergenic
1155453648 18:25988426-25988448 ATTTTTTGAGCTCTCTCTTCTGG - Intergenic
1156091919 18:33481791-33481813 ATTGTTTAAGCACTGGATTTTGG - Intergenic
1156594306 18:38529630-38529652 ATAATTTGAGTTCTGGCTACTGG + Intergenic
1157351383 18:46889882-46889904 ATTATTTTAGCTGTTTCTTCTGG - Intronic
1157442575 18:47721965-47721987 ATTATTGATGCTCTTGCCTCGGG - Intergenic
1159558668 18:69971190-69971212 ATTATTTAAGTTCAGGGTTTTGG - Intergenic
1159600419 18:70423683-70423705 ATTCTTGATGCTCTGGCATCTGG - Intergenic
1161227912 19:3155841-3155863 ATTTCTTACGCTCTGACTTCTGG - Exonic
1161765239 19:6204063-6204085 CTTATGTAGGCTCTGGCTGCTGG - Intergenic
1163072854 19:14859299-14859321 AGCATTGAAGCTCTGGCTTCTGG - Intergenic
925045570 2:770921-770943 ATTATGTGAGCTTTGGCATCAGG + Intergenic
930391272 2:50764438-50764460 ACTATTTCAGCTCTGGCTACAGG + Intronic
930517538 2:52427415-52427437 ATCATTTAAGATTTGGCTGCTGG + Intergenic
933358268 2:81243019-81243041 ATTATTATAGCTTTGCCTTCTGG + Intergenic
933839524 2:86275359-86275381 ATTCTTGATGCTCTGGCATCTGG + Intronic
935601608 2:104927846-104927868 ACTATATAAGCTCTGGCCTAGGG - Intergenic
936245400 2:110821865-110821887 ATTGTTTCAGCTTTGGCTTTTGG + Intronic
938080983 2:128370023-128370045 ATTAGCTAGGCTCTGGCCTCTGG - Intergenic
938583337 2:132667989-132668011 ATTTTTCAAGCTCTGACCTCTGG + Intronic
939537979 2:143456082-143456104 AGGATTTAAGCTGAGGCTTCTGG - Intronic
939816568 2:146904375-146904397 ATTCTTTTAACTCTGGTTTCAGG - Intergenic
940318919 2:152353784-152353806 TTTATTAAAGCACTGGCTTTAGG + Intronic
940569666 2:155415112-155415134 ATTAATTAAGCTCTTGTGTCTGG + Intergenic
942598172 2:177612314-177612336 AGAATGTAAGCTCTGGCTCCTGG + Intergenic
943266013 2:185733928-185733950 ATTATATAAGCTAGGGCTTTGGG + Intergenic
944051193 2:195471898-195471920 ATTGTTTCAGCTCTGGCCTTTGG + Intergenic
945756824 2:213856894-213856916 ATTATCTTAGCTATGTCTTCTGG - Intronic
946517782 2:220432047-220432069 GCTATTAAAGCTTTGGCTTCAGG + Intergenic
946799228 2:223392530-223392552 ATTATTTCAGCTTTGGCCTTTGG + Intergenic
1169531405 20:6489175-6489197 ATAAGTCAAGTTCTGGCTTCTGG - Intergenic
1169565202 20:6846525-6846547 ATGATTTAATCCCTGGCCTCTGG - Intergenic
1170362090 20:15557550-15557572 ATTTTTAAAGCTCTGGTTTGGGG - Intronic
1170403320 20:16010802-16010824 ATTATTTAGGATTTGGATTCTGG + Intronic
1171087908 20:22255327-22255349 ATTAATCAAGCTCTGGCCACTGG + Intergenic
1174711845 20:52715088-52715110 ATTGTTTAAACTCTGGATCCAGG + Intergenic
1180042855 21:45288675-45288697 GTTATTAAAGGTCTGGTTTCGGG + Intergenic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
951600640 3:24370931-24370953 ATTAATTAAGCTCTGTTTGCAGG + Intronic
952546302 3:34423394-34423416 TTTATTTAATTTCTTGCTTCAGG + Intergenic
956787401 3:72653909-72653931 ATTAGCTAAGCTCTGGAGTCAGG + Intergenic
957882219 3:86233457-86233479 ATTATTTAAGCAGAGGCTGCTGG + Intergenic
958951599 3:100423102-100423124 AGTATTTAAGCACTGCTTTCTGG + Intronic
959187900 3:103070195-103070217 ATTAGTTATTCTATGGCTTCTGG - Intergenic
960087859 3:113609668-113609690 AATGTTTGTGCTCTGGCTTCTGG + Intronic
961524257 3:127486589-127486611 ATCATTTAATCACAGGCTTCAGG + Intergenic
963026863 3:140928215-140928237 ATTTTTTTATCTCTGGCTTTAGG - Intergenic
963524503 3:146400111-146400133 TTTATTTACTCTCTGGATTCTGG - Intronic
965743568 3:171901896-171901918 TTTATTTGAGCTCTGGCTGGAGG - Intronic
966764665 3:183449681-183449703 ATTAGTTAAGGTCTGCCCTCAGG + Intergenic
966787429 3:183634450-183634472 ATTATTTGAGCTATTTCTTCTGG - Intergenic
970441442 4:16083749-16083771 ATTATTTATGACCCGGCTTCTGG + Intronic
970767470 4:19566966-19566988 AATATTTAAATTCTGGCTTAAGG + Intergenic
974580221 4:63789269-63789291 GTTATTTAAGCACTTTCTTCTGG + Intergenic
976382091 4:84411124-84411146 TTTATTTAAGATCTGAATTCAGG + Intergenic
977069829 4:92371229-92371251 ATTATTTTAGCTATGTCTTCTGG - Intronic
977962220 4:103098869-103098891 ATTATGTAAGAACTGGCTCCAGG + Intronic
979630451 4:122895879-122895901 ATTATTTAAACTCTGTATTTAGG - Exonic
979699141 4:123647968-123647990 ATCCTTTAATCTCTGGCTGCTGG + Intergenic
984479175 4:180276952-180276974 ATTATTTTAGCTAGGTCTTCTGG - Intergenic
1202769476 4_GL000008v2_random:188430-188452 ATTATTTAATATTTGGCTTTGGG + Intergenic
987049352 5:14136437-14136459 TTTATTTATACTCTGGCCTCAGG - Intergenic
987428918 5:17807485-17807507 ATTTTTCAAGCTCTGGCTCTTGG + Intergenic
987771125 5:22306650-22306672 ATTATTACAGCTCTGGGTTCTGG + Intronic
989524407 5:42436875-42436897 ATTATTTGAGCTTTGGCTCTGGG + Intronic
989908972 5:49599787-49599809 GTTGTATAAGCTCTGCCTTCAGG - Intergenic
992468241 5:77028654-77028676 ATTCTTGATGCTCTGGCATCTGG - Intergenic
992510602 5:77430099-77430121 ATTAATTAGGCTTTGGCTTAAGG - Intronic
993468705 5:88280232-88280254 ATTCTCTTAGCTCTGCCTTCTGG + Intergenic
993540660 5:89146760-89146782 ATTATTTCAGCTTTGGCCTATGG + Intergenic
997664197 5:135615570-135615592 AATATGTAAGTTCTGGTTTCAGG - Intergenic
998763847 5:145462615-145462637 TCTATTTATGTTCTGGCTTCAGG + Intergenic
999073600 5:148773886-148773908 ATAATTTGGGCTCTGGCTTTAGG - Intergenic
1003973463 6:11321258-11321280 ATTTGTTAAGCTGTAGCTTCAGG - Intronic
1006384639 6:33723506-33723528 ATGATTTAAGCCCTGGCTCCTGG + Intronic
1007991940 6:46265532-46265554 ATTAATTATGCTGTGACTTCAGG + Intronic
1008722740 6:54376852-54376874 ATTATTTAAGCTCTTCCTTCAGG - Intronic
1011571599 6:88743037-88743059 ATTATTTCAGATCTAGCTTTGGG - Intronic
1011907942 6:92395850-92395872 ATTATTCTAGCTGTGGCTTCTGG + Intergenic
1013742645 6:113305765-113305787 ATTCTTGATGCTCTGGCATCTGG - Intergenic
1014018876 6:116565555-116565577 AGTGTTAAAGCTCTGGCTTGGGG + Intergenic
1014086279 6:117348675-117348697 ATTATTTAAGCTTTTACTTTAGG - Intronic
1014382330 6:120757983-120758005 ATTATTTCAGGACTGGCTCCAGG + Intergenic
1014618347 6:123633062-123633084 ATTACATAACCTCAGGCTTCAGG - Intronic
1014641856 6:123921699-123921721 ATTAATTATGATATGGCTTCAGG + Intronic
1015186135 6:130418552-130418574 ATAATTTAAGCAATGACTTCAGG - Intronic
1015759091 6:136638244-136638266 ATGATTTAAGATCTGGGTTAAGG + Intronic
1016454983 6:144221446-144221468 ATTTTTAATGCTCTGGCATCTGG - Intergenic
1019561576 7:1661937-1661959 ATCATTTAATCTATGGCTTCGGG + Intergenic
1020461968 7:8436602-8436624 GATATTTCAGGTCTGGCTTCTGG + Intronic
1020951279 7:14681489-14681511 ATTGTTTAAGCCCTGGGTTGAGG + Intronic
1022894445 7:34735346-34735368 TTTATTTTAGCTGTGTCTTCTGG - Intronic
1023905337 7:44517758-44517780 ATTATTAGAGCTGTGGCTTAGGG + Intronic
1024709783 7:52002616-52002638 ATAATTTTAGCTCTGGCTCATGG + Intergenic
1031765799 7:125775425-125775447 ATTATTAAAGATGTGGCTCCTGG - Intergenic
1032236699 7:130130599-130130621 ATTGTTTAAGATCTGGCTGGTGG + Exonic
1033576963 7:142694780-142694802 ATTATTTCAGTCCTGGCTTTGGG - Intergenic
1033938625 7:146621996-146622018 ATAATTTCAGCTCTGGCCACTGG + Intronic
1037128258 8:15376214-15376236 ATTATTTTAGCTTTGGCGTTTGG + Intergenic
1038322672 8:26542640-26542662 ATGTTTTAAACTCTGGCTTCAGG + Intronic
1040534799 8:48299411-48299433 TTTATTTAAGTTCAGGGTTCTGG + Intergenic
1041143879 8:54850656-54850678 ATTATTTAAGTTCTCCCTTTGGG + Intergenic
1041953545 8:63532324-63532346 ATCATTTATGCTCTTGCTTCAGG + Intergenic
1043473224 8:80581573-80581595 ATTATTTTAGCTCGTGCATCTGG + Intergenic
1044108882 8:88247191-88247213 ATTATATAAACACTGTCTTCTGG - Intronic
1045478133 8:102570314-102570336 TATATTTCAGCTATGGCTTCTGG - Intergenic
1048348595 8:133597385-133597407 GTTATTTAAGGTGAGGCTTCTGG + Intergenic
1048636508 8:136301483-136301505 ATTTTTTATGCTCTGGCATCTGG - Intergenic
1048737983 8:137522838-137522860 AATATTTAAGCTTTGATTTCAGG + Intergenic
1051052175 9:12947769-12947791 ATCATTTAAGTTCTCCCTTCTGG - Intergenic
1052197995 9:25741773-25741795 ATTTATTTAGCTCTGCCTTCAGG + Intergenic
1052336656 9:27327022-27327044 AATATTTCACCTCTGGCTACAGG + Exonic
1052890453 9:33694662-33694684 ATTATTTCAGTCCTGGCTTTGGG - Intergenic
1055253008 9:74331006-74331028 GTTATTTGACATCTGGCTTCTGG - Intergenic
1055568289 9:77590924-77590946 ATTATTTATGCTCTGGCCTGTGG - Intronic
1055995869 9:82159317-82159339 ATAATTTAAGCTGTGGCAGCTGG + Intergenic
1058001781 9:99873164-99873186 TTTATATTAGCTCTGGCTTCAGG + Intergenic
1058736249 9:107896866-107896888 ATTCATCAAGCTCTGGCTTCAGG + Intergenic
1203736077 Un_GL000216v2:140807-140829 CTCATTTAAGCTCTGCCTACAGG - Intergenic
1203737800 Un_GL000216v2:153366-153388 GTTATATAAGCTCTGCCTACAGG - Intergenic
1203738835 Un_GL000216v2:161588-161610 CTTATTTAGGCTCTGCCTACAGG + Intergenic
1191965947 X:66758290-66758312 TATATTTAAGCTGTGTCTTCAGG - Intergenic
1194922737 X:99787248-99787270 ATTCTTTTAGCTGTGTCTTCTGG + Intergenic
1195613591 X:106895343-106895365 AAGATTTAAGTTCTGGCTGCAGG - Intronic
1196755490 X:119154071-119154093 TTTTTTTAAGCTCTGGGTTTTGG + Intergenic
1198642246 X:138769301-138769323 AATATGTAAGCTTTGGCATCAGG + Intronic
1201126132 Y:10916133-10916155 ATTGTCTAAGCTCTGCCTACAGG + Intergenic
1202623938 Y:56838433-56838455 GTTATATAAGCTCTGCCTACAGG + Intergenic
1202624734 Y:56845728-56845750 CTCATTTAAGCTCTGCCTACAGG + Intergenic