ID: 1108307319

View in Genome Browser
Species Human (GRCh38)
Location 13:49151160-49151182
Sequence TGTCTAATGCTGAGAGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 1, 2: 17, 3: 32, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108307314_1108307319 26 Left 1108307314 13:49151111-49151133 CCATTTAAATACAATGAAATTTC 0: 1
1: 0
2: 3
3: 52
4: 732
Right 1108307319 13:49151160-49151182 TGTCTAATGCTGAGAGTGGGGGG 0: 1
1: 1
2: 17
3: 32
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108307319 Original CRISPR TGTCTAATGCTGAGAGTGGG GGG Intronic
902516394 1:16991968-16991990 TGCCTAGTCCTCAGAGTGGGTGG + Intronic
902863280 1:19260896-19260918 TGTCTAAAGCTGAGACAGCGTGG - Intergenic
904568683 1:31444346-31444368 TGTCTACTTCAGGGAGTGGGTGG - Intergenic
906594281 1:47060618-47060640 TGTCTAATACTGACAGTGGAGGG - Intergenic
908721681 1:67132606-67132628 TGCCTGAGGCTGAGAGTCGGAGG - Intronic
909905509 1:81189893-81189915 TGTCTAGGAGTGAGAGTGGGTGG - Intergenic
911625529 1:100119728-100119750 TGTCACATGGTGAGGGTGGGAGG - Intronic
912152101 1:106872350-106872372 TGTCTAATATTGTCAGTGGGGGG - Intergenic
915767294 1:158375608-158375630 TATTTAATGCTGAGAGTCAGGGG - Intergenic
916468538 1:165097211-165097233 TGTCCATTGCTGAAAGTAGGGGG - Intergenic
917273741 1:173306884-173306906 AGTCTAAAGGTGAGAGTTGGAGG - Intergenic
917441513 1:175072996-175073018 TGTCTCAGGCTGGGGGTGGGGGG + Intronic
920095190 1:203482178-203482200 TTTCTCATGCTGTGAATGGGAGG + Intronic
920310522 1:205045618-205045640 TCTCTAAGCCTGAGTGTGGGTGG + Intronic
920676359 1:208041152-208041174 TTTCTAATGCTCAGATTGGCAGG + Intronic
924941406 1:248814596-248814618 TGTCTCCTGCTGAGCCTGGGGGG + Exonic
1065254147 10:23848291-23848313 TGTCTAATATTGACAGTGGGGGG + Intronic
1065306384 10:24373174-24373196 TGTGACATGCTTAGAGTGGGTGG - Intronic
1065847315 10:29756674-29756696 TGCCTGAAGCTGAGAGTGGGAGG + Intergenic
1065988449 10:30981454-30981476 AGTCTAATTCTGAGATGGGGAGG - Intronic
1066587453 10:36951957-36951979 TGACTATTTCTGAGATTGGGAGG + Intergenic
1068711240 10:60136429-60136451 TGTCTAATGCAGAGAGTGGCCGG - Intronic
1071865829 10:89730458-89730480 TGTGTGAAGCTGTGAGTGGGTGG + Intronic
1075045012 10:119139795-119139817 TGTCAATTCCTGAGACTGGGAGG + Intergenic
1076375187 10:129979003-129979025 TGTCAAGTGCTGGGAGTGGGAGG - Intergenic
1076419281 10:130317950-130317972 TGTCTAATGTTGACAGTGGGGGG + Intergenic
1076662885 10:132067261-132067283 TCTCCAAGGCTGAGGGTGGGGGG + Intergenic
1078651857 11:13202667-13202689 TGTATAATGCTGAGGTTTGGGGG - Intergenic
1080214947 11:29829617-29829639 TGTCTAATATTGACAGTGAGGGG - Intergenic
1080336727 11:31206243-31206265 AGCCCATTGCTGAGAGTGGGAGG + Intronic
1082618874 11:55396843-55396865 TGTCTAATGTTGACAGTAGTGGG + Intergenic
1085431742 11:76457199-76457221 TATCTAAATCTGAGAATGGGTGG + Intronic
1085526623 11:77167768-77167790 TGTCTACTGCTGGGGGTGTGTGG - Intronic
1085827392 11:79862463-79862485 TGTTAAATGCTGTCAGTGGGGGG - Intergenic
1088124085 11:106402953-106402975 TGCGTAGGGCTGAGAGTGGGAGG - Intergenic
1090578575 11:128135347-128135369 TGTTTTATGTTGAGAGTGTGTGG + Intergenic
1091200323 11:133774962-133774984 TGTCTAATGTTTAGATTGAGAGG + Intergenic
1092398354 12:8148573-8148595 TGTCTAATATTGACAGTGGAGGG - Intronic
1092971890 12:13704165-13704187 AGTCTGATGCTGAGACCGGGAGG + Intronic
1093135196 12:15440926-15440948 TGTCTACTGCTGTCAGTTGGGGG - Intronic
1093946319 12:25113853-25113875 TGCCTGGGGCTGAGAGTGGGTGG - Intronic
1094042376 12:26131673-26131695 TTTCTAAGGCTGGGATTGGGAGG + Intronic
1094251266 12:28364554-28364576 TCCCTAACGCTGAGGGTGGGAGG + Intronic
1097418978 12:59350272-59350294 TGTCTGATATTGACAGTGGGGGG + Intergenic
1098180113 12:67838218-67838240 GGTCTAATGCTGAAGGTGGAGGG + Intergenic
1098643007 12:72861111-72861133 AGTCTAATGGAAAGAGTGGGGGG + Intergenic
1099767416 12:87005835-87005857 TATCTAATGCTTTCAGTGGGGGG + Intergenic
1100431966 12:94539002-94539024 TGTGAAAAGCTGAGTGTGGGAGG - Intergenic
1100907556 12:99319252-99319274 TGTCTAATGTTGACAGTGGGGGG + Intronic
1101636701 12:106549486-106549508 TGTCTAATGTTGACAGTGGGAGG + Intronic
1101850603 12:108399108-108399130 TGTGAAATGCTGAGAGGGGTGGG + Intergenic
1102632441 12:114293117-114293139 TGTCTAATTCTCACAGTGGTTGG - Intergenic
1103544369 12:121689366-121689388 TGTTTCATTCTGAGACTGGGTGG + Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1106686133 13:32061208-32061230 TGTTAAATGCTGAGTATGGGAGG + Intronic
1107083648 13:36402561-36402583 TGTCCAATGCTGAAAGTCAGGGG + Intergenic
1108307319 13:49151160-49151182 TGTCTAATGCTGAGAGTGGGGGG + Intronic
1108855958 13:54792569-54792591 AGTCTCATCCTGAGAGTGGATGG - Intergenic
1112301310 13:98233172-98233194 TGTCTAATGTTAAGAGGGAGTGG + Intronic
1115091687 14:29584480-29584502 AATCTAATGATGAGAGTGTGGGG - Intronic
1115661403 14:35498281-35498303 TTTCCAATGCTGAAAGTTGGGGG - Intergenic
1117952790 14:61099630-61099652 TGGGTAATTCTGAAAGTGGGTGG - Intergenic
1118040014 14:61906211-61906233 TGTCTACTGGTGAATGTGGGAGG + Intergenic
1118410238 14:65470481-65470503 TGTCTCAGGCTGAAAGGGGGCGG - Intronic
1120713831 14:87819321-87819343 TGTTTCCTGCTGAGAGTGAGGGG + Intergenic
1122062479 14:99145759-99145781 TGGCTAATGCTGATGGTGTGTGG - Intergenic
1127469171 15:59275287-59275309 TCTCTAATGCTAAGAGGAGGTGG - Intronic
1129564397 15:76606595-76606617 TGTCTAATGTTGACAGTGGGGGG + Intronic
1130756036 15:86764435-86764457 TGTCTAATGCTCTGTGTGGGTGG + Intronic
1131214811 15:90528715-90528737 TGTTTAATCTTGATAGTGGGGGG + Intergenic
1132762056 16:1513616-1513638 AGGCTGATGCTGGGAGTGGGTGG + Intronic
1135429727 16:22373496-22373518 TGCCTAAAGCTAAGTGTGGGAGG - Intronic
1135782609 16:25317843-25317865 TGTCTGAAGTTGAGAGTTGGGGG + Intergenic
1141948965 16:87328481-87328503 TGTCCACTGCTGAGTGTGAGTGG - Exonic
1203143079 16_KI270728v1_random:1781633-1781655 TGTCTATTGGAGAGAGTAGGTGG + Intergenic
1203143184 16_KI270728v1_random:1782328-1782350 TGTCTATTGTAGAGTGTGGGTGG + Intergenic
1203143191 16_KI270728v1_random:1782376-1782398 TGTCTATTGCAGAGTGTAGGTGG + Intergenic
1203143221 16_KI270728v1_random:1782616-1782638 TGTCTATTGCAGAGTGTAGGTGG + Intergenic
1145774584 17:27519115-27519137 TGGGTAATGGTGACAGTGGGAGG + Intronic
1146610513 17:34300897-34300919 TGTCTTCTGCAGAGAGTGGGTGG - Intergenic
1146647787 17:34586658-34586680 TGTGTATGGCAGAGAGTGGGTGG - Intronic
1147216695 17:38903793-38903815 TGTCTAGTACTGAGAATGTGTGG + Intronic
1147902256 17:43796068-43796090 TGTCTAATGTTGACAGTGGGGGG + Intergenic
1147978287 17:44260215-44260237 TGTCCTATGCTCAGAGTTGGGGG - Intronic
1150187408 17:63198572-63198594 TGTCTCAGACTGGGAGTGGGAGG + Intronic
1152902126 17:82948367-82948389 GGTCTAATCCTGGGAGTGGAAGG - Intronic
1153887285 18:9478147-9478169 TGACTAATGCAGAAATTGGGGGG + Intronic
1155706499 18:28822120-28822142 TGTCCAATGCTAAGCATGGGGGG + Intergenic
1155720404 18:29004120-29004142 TTTCTAAAGCTGAGAGTCTGAGG - Intergenic
1156427074 18:37025285-37025307 TGTCTAATGTTGACAGTGGGGGG - Intronic
1158202977 18:54960316-54960338 TTTCTCATGATGAGACTGGGGGG + Intergenic
1158686225 18:59616975-59616997 TGGCAAAGGCTGAGAGTCGGTGG - Intronic
1166273534 19:41734310-41734332 TGTCAAATCCTGAGAGTAGAGGG - Intronic
1166278602 19:41774154-41774176 TGTCAAATCCTGAGAGTAGAGGG - Intergenic
1166352165 19:42204448-42204470 TGTCACATGGTGAGAGTTGGGGG - Intronic
1166398012 19:42456712-42456734 TGTCAAATCCTGAGAGTAGAGGG + Intergenic
1166429300 19:42710670-42710692 TGTCAAATCCTGAAAGTAGGGGG + Intronic
1166654912 19:44603936-44603958 TGTCTTCTGCAGAGAGAGGGGGG + Intergenic
1168577673 19:57526922-57526944 TCTATAATGCTGAGAGGAGGGGG + Intergenic
925056096 2:858468-858490 TGTTTAATGCTTTGAGTGTGAGG + Intergenic
927455460 2:23245321-23245343 TGTCTAAAGCTGAGAGGGTCTGG - Intergenic
927478894 2:23434873-23434895 TGTCAAAGCCTGAGAGGGGGTGG + Intronic
928802374 2:35110431-35110453 TGTCTAATGTTGACAGTGGGGGG + Intergenic
930251679 2:49041766-49041788 TGTCTGATGCTGAGAAAGGAAGG - Intronic
931925726 2:67070431-67070453 GGTCTAATGATGAGGGAGGGTGG + Intergenic
935853025 2:107243665-107243687 TGGCCAATGCTGATAGTGTGGGG + Intergenic
936149426 2:110006267-110006289 TGTCTAATACTGTCAGTGGAGGG + Intergenic
936195253 2:110365103-110365125 TGTCTAATACTGTCAGTGGAGGG - Intergenic
936690753 2:114885242-114885264 TGTCACATGGTGAGAATGGGGGG + Intronic
936856487 2:116964440-116964462 TGTCCAAAAGTGAGAGTGGGAGG - Intergenic
938261453 2:129898373-129898395 TGTCCATTACTGAGAGTGGGAGG - Intergenic
939459068 2:142476083-142476105 TGTCACATGATGAGAGTAGGAGG + Intergenic
939705578 2:145448397-145448419 TGACTAATGCTGATAGTTAGAGG + Intergenic
940354001 2:152718626-152718648 TGTCGTTTGCTGAGAGCGGGTGG + Exonic
940972978 2:159913689-159913711 TGGCTAATGCTGAACCTGGGGGG + Intergenic
941524840 2:166594591-166594613 TGTCCAGTGCTGAAAGCGGGGGG - Intergenic
943837082 2:192527038-192527060 TGTCTAATATTGACAGTGAGGGG - Intergenic
946077517 2:217086881-217086903 TGTCCAATTCTAAGATTGGGAGG - Intergenic
946745487 2:222841237-222841259 TGTCAAATCCTGAGCCTGGGAGG + Intergenic
1170615433 20:17945368-17945390 TGTGGAATGCTGAGATTGGTGGG - Intronic
1171311978 20:24151941-24151963 TGTGTAATGGTGAGAGTGAGGGG - Intergenic
1171432819 20:25095435-25095457 TATCCAATGTTGAAAGTGGGGGG - Intergenic
1171567837 20:26210160-26210182 TGTGTCATGCTGATAGTTGGAGG - Intergenic
1172596896 20:36155910-36155932 CTCCTAATGCTGAGGGTGGGGGG - Intronic
1173776981 20:45716889-45716911 TGTCTAATATTGTCAGTGGGGGG - Intergenic
1175151063 20:56934803-56934825 TGTCTAATGCTAAGATGGTGAGG + Intergenic
1177093637 21:16802253-16802275 TGTCAAAAGCTGAGAGTCGTCGG - Intergenic
1177311763 21:19405533-19405555 TGTGTAGTGGTGAGAGTGGAGGG + Intergenic
1178423149 21:32458082-32458104 TGTCTTGTGCTGAGATTGAGAGG + Intronic
1178714348 21:34949746-34949768 TGGCTAACGATGAGAGTAGGAGG - Intronic
1178787181 21:35664447-35664469 TGACTAATGGTAAGAGTAGGTGG + Intronic
1178828265 21:36033627-36033649 TGTCTAGTTCTGAGTTTGGGTGG - Intergenic
1183758820 22:39796943-39796965 TGTCTAATCCTGAGAGCAGGAGG + Intronic
1184617951 22:45650777-45650799 TGTTTGATGGTGACAGTGGGTGG + Intergenic
949681202 3:6516467-6516489 TCTCTGATGCTGGGAGTGGGAGG + Intergenic
949846363 3:8374448-8374470 TGTCTAATATTGACAGTGGGGGG - Intergenic
951614860 3:24531132-24531154 TGGGTAATGCTGAGTGAGGGAGG + Intergenic
951949277 3:28181469-28181491 GATCTAATGTTGACAGTGGGTGG + Intergenic
952256975 3:31704156-31704178 TGGCTAATGCTGAGATTAGCAGG + Intronic
956638557 3:71391676-71391698 TGCCCAATGCTGAGAGTTAGTGG - Intronic
957111038 3:75958055-75958077 TGTGTCATGCTGATAGTTGGAGG + Intronic
958789683 3:98637027-98637049 TGTCTAAGGCTGAGAGTAGGGGG - Intergenic
960689764 3:120333443-120333465 TCTCTACTTCTAAGAGTGGGTGG + Intronic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
964842885 3:161013603-161013625 TGTCTAATGTTGACAGTGGGGGG + Intronic
964846033 3:161045184-161045206 TGTCTAATGTTGACAGTGGGGGG - Intronic
966290319 3:178348742-178348764 TGTCTAAGGCTGAGAGAAGACGG - Intergenic
966635036 3:182123628-182123650 TGACTAATGGTGGGAGTTGGGGG - Intergenic
966712110 3:182981051-182981073 GGTCTGATACTGAGATTGGGGGG - Intronic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
969622245 4:8284430-8284452 TGACTGATGCTCTGAGTGGGTGG + Intronic
971673016 4:29588803-29588825 TTTCTATTGCTGAGAGTTGGTGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972829472 4:42798140-42798162 TGACTATTGCTGAGAGTGGAAGG - Intergenic
973298418 4:48553564-48553586 GATCTAATGCTGAGAGTTAGAGG - Intronic
974337097 4:60563115-60563137 TGTAAAAGGCTGAGAGTGTGAGG + Intergenic
974603194 4:64115480-64115502 TTTCTTATGCTGAGAATGAGGGG - Intergenic
974633370 4:64525890-64525912 TGTTTATTGCTGAAAGTTGGGGG + Intergenic
974660921 4:64887773-64887795 TATCTAAAGCTGAGATAGGGTGG - Intergenic
974741296 4:66011764-66011786 TGTCTAATACTGACATTGGGTGG + Intergenic
975470276 4:74758147-74758169 GGTCTAATGCAGGCAGTGGGAGG + Intronic
976390346 4:84499115-84499137 AGTCAAAGGCTGAGAGTGAGAGG - Intergenic
976450802 4:85188805-85188827 TATCCAATGCTGAAAGTTGGGGG + Intergenic
976728250 4:88237127-88237149 TGTTCAATGATGAAAGTGGGGGG + Intergenic
977613769 4:99064512-99064534 TGTCTAATCCTTTGAGTGCGAGG + Intergenic
978409973 4:108415977-108415999 GGTCTAATCCTGAAAGTGGATGG + Intergenic
978821720 4:112974338-112974360 TGTCTAATGTAAAGAGTGAGAGG + Intronic
978895758 4:113885449-113885471 TCTCTGGTGCTGGGAGTGGGGGG + Intergenic
979317069 4:119277679-119277701 TGTCTAATGTTGACAGTGGGGGG + Intronic
980622272 4:135323155-135323177 TGTGTAATGCTGAGGTTTGGGGG - Intergenic
981199918 4:141968258-141968280 TGTCTAAATTTGACAGTGGGGGG - Intergenic
983467158 4:168108747-168108769 TGTCTAAAGCTCAGATTGCGTGG - Intronic
986236068 5:5911936-5911958 TTTCTAAATCCGAGAGTGGGGGG - Intergenic
987923631 5:24314121-24314143 TGTCTAATACTGACAGTGACAGG + Intergenic
988627763 5:32896452-32896474 TGTCTAATATTGACAGTGAGGGG + Intergenic
989267027 5:39486670-39486692 TGTTTTAGGTTGAGAGTGGGTGG - Intergenic
989305676 5:39952583-39952605 TTTCTAATATTGACAGTGGGTGG - Intergenic
989577430 5:43001156-43001178 TGTCTTATGCAGAGATTGGAGGG + Intergenic
989581216 5:43034782-43034804 TGTCTTATGCAGAGATTGGAGGG + Intergenic
991717937 5:69469368-69469390 TGTCACATGGTGAGAGTGAGTGG - Intergenic
992273418 5:75089435-75089457 TGACTAGTTCTGAGAGTGGTGGG - Intronic
994963811 5:106640108-106640130 TGTCTAATGCAAAGATTGTGAGG + Intergenic
995271750 5:110227851-110227873 ATCCTAATGCTGAGAGTAGGAGG - Intergenic
997671386 5:135677031-135677053 TGTCTAATGCTAATAGTAGAGGG + Intergenic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
998896466 5:146805334-146805356 TCTCTAATGCCAAGAGTTGGGGG - Intronic
1000772130 5:165367971-165367993 TGTCCACTGCTCAGAGTGTGGGG - Intergenic
1001425073 5:171617602-171617624 TTACAAAGGCTGAGAGTGGGTGG - Intergenic
1002009179 5:176263506-176263528 TGTCTCATGGTGAGAGAAGGAGG + Intronic
1002217542 5:177648777-177648799 TGTCTCATGGTGAGAGAAGGAGG - Intergenic
1003225518 6:4202093-4202115 TGTTTAATGTTGACAGTGGGGGG + Intergenic
1004913108 6:20306112-20306134 TGTGTGATGCTGAGAGTGAGGGG - Intergenic
1008882094 6:56390884-56390906 TGTCCAATGCTAAAAGTAGGTGG - Intronic
1009591066 6:65671846-65671868 TGTCTAATGTTCAGATTTGGAGG + Intronic
1009770862 6:68141415-68141437 TGTCCAGTGCTGAAAGTGGGAGG + Intergenic
1010264104 6:73848627-73848649 TGTCTAATGCTGAAAGTTGGGGG + Intergenic
1011389588 6:86837414-86837436 TGTCTACTACTGACAGTGTGTGG + Intergenic
1012075270 6:94674779-94674801 TGTCTAATATTGACAGTGGGGGG - Intergenic
1012326885 6:97930405-97930427 TGTTTATTTCTGAGAGTGAGTGG - Intergenic
1013025303 6:106265415-106265437 TGTGTAATATTGACAGTGGGGGG - Intronic
1013476228 6:110509717-110509739 TGAGTAATACTGAGAGTTGGGGG - Intergenic
1015622557 6:135146870-135146892 TGTTTAATGCTGAGAATGGGAGG + Intergenic
1016929223 6:149386458-149386480 TGCCTAGTGCTGAGTGAGGGTGG - Intronic
1018925137 6:168200657-168200679 AGTCTAAGGCAGACAGTGGGAGG + Intergenic
1020640150 7:10744470-10744492 TGTCTAATATTGACAATGGGTGG - Intergenic
1021296245 7:18910026-18910048 TGTCCAATGCTGAGAGAGTGGGG + Intronic
1023084018 7:36551970-36551992 TGTGTAATGCTGAGGTTTGGGGG + Intronic
1023291874 7:38677117-38677139 CTTCAAATGCTGAGATTGGGGGG + Intergenic
1026428721 7:70322912-70322934 TGTAAAGTGCTGAGAGTGGAAGG - Intronic
1029907924 7:104111031-104111053 TTTCAAATGCTGACAGTGAGAGG - Intergenic
1030593510 7:111508926-111508948 TTTCTAATATTGAGAGTGGCAGG - Intronic
1031711268 7:125048869-125048891 TGTCTAATATTGACAGTGGGGGG - Intergenic
1032903790 7:136340700-136340722 TAGCTAATGTTCAGAGTGGGTGG - Intergenic
1033054594 7:138038617-138038639 TGGCTAATATTGACAGTGGGGGG - Intronic
1034954586 7:155326761-155326783 TTTCTTATGCTTACAGTGGGGGG + Intergenic
1037893257 8:22635344-22635366 TCTCTAGTGCTGAGAGTGCCTGG + Intronic
1041429313 8:57761125-57761147 TGTCTAATATTGTTAGTGGGAGG - Intergenic
1043463634 8:80485767-80485789 TGTCATTTGCTGAGGGTGGGTGG - Exonic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1044541772 8:93416447-93416469 TGTCTCCTGCTGAGAGAGAGAGG - Intergenic
1044792408 8:95861579-95861601 TCTTTAATGCTGAGAGGAGGTGG + Intergenic
1045207712 8:100059704-100059726 TGTCCAATGCTGAAAGTCAGAGG - Intronic
1046425247 8:114039196-114039218 TGTCCAATGCTGAGAGTGATGGG - Intergenic
1046735767 8:117775430-117775452 TGTCTAATACTGTCAGTGGAGGG - Intergenic
1047964030 8:130032426-130032448 TGTGGGAGGCTGAGAGTGGGCGG - Intergenic
1049913717 9:295825-295847 TGTAGAATGATGAGGGTGGGAGG - Intronic
1050049716 9:1586997-1587019 TGTCTAATGTTGACAGTGGGGGG + Intergenic
1051992322 9:23166410-23166432 TGTCTAATCCTGAAAGTGAGAGG - Intergenic
1052313834 9:27096229-27096251 TGTCACATGGTGAGAGAGGGAGG - Intergenic
1055207373 9:73749244-73749266 TGTTTAATGCTGTCAGTAGGGGG + Intergenic
1057750334 9:97787688-97787710 TGTGGAATGATGAGAATGGGTGG - Intergenic
1058212432 9:102186060-102186082 TGTCTCATACTGTGAGTAGGAGG + Intergenic
1058441698 9:105014400-105014422 TGTTTAATGCTGTCAGTGGCAGG + Intergenic
1058744516 9:107976775-107976797 GGTCTAATGCTGTGTGTGGAAGG + Intergenic
1060958394 9:127661244-127661266 TGTCTTATTCTGAGAGGGTGGGG + Intronic
1061942478 9:133891241-133891263 TCCCTCCTGCTGAGAGTGGGAGG - Intronic
1185549484 X:971868-971890 TGTCTATTGCAAAGTGTGGGTGG - Intergenic
1185966525 X:4611795-4611817 TGTCTAATGCTGAAATTGCAAGG + Intergenic
1188806728 X:34600011-34600033 TGTCTAATGCTGTCAGTGGAGGG + Intergenic
1190559784 X:51675657-51675679 TGGCTAATGATGATTGTGGGTGG + Intergenic
1190564507 X:51717664-51717686 TGGCTAATGATGATTGTGGGTGG - Intergenic
1191014472 X:55793758-55793780 TGTATAATGCAGGGGGTGGGAGG - Intergenic
1191659369 X:63634462-63634484 TATCTATTCCTCAGAGTGGGTGG - Intergenic
1192720603 X:73693221-73693243 TGTGTAATATTGACAGTGGGGGG - Intergenic
1192940472 X:75906334-75906356 TGTTTAGTGCTGAAAGTGAGAGG + Intergenic
1193211640 X:78812953-78812975 TGTCCAATGGTAAGAGTGGGGGG - Intergenic
1193489148 X:82126745-82126767 TGTCACATGGTGAGAGTAGGAGG + Intergenic
1195723328 X:107888694-107888716 TGTCTAATGTTGACAATGCGGGG + Intronic
1195737059 X:108022909-108022931 TGTCACATGGTGAGAGAGGGAGG - Intergenic
1196914953 X:120523947-120523969 TGTTTAATGCTGTGAATGGCAGG - Intergenic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic
1197401629 X:125998976-125998998 TGAATAAGGCTGAGAGTGAGAGG + Intergenic
1197898791 X:131345685-131345707 TGACTCATACTGAGAGTGTGGGG + Intronic
1198322236 X:135529570-135529592 TGTCTAATTCTGAGGCTGGGTGG + Intronic
1198785203 X:140280505-140280527 TGTCCAATGCTGAAAGTGAGGGG + Intergenic
1199281017 X:145999293-145999315 TGGCTAATGCTGACAGTTTGTGG - Intergenic
1200101235 X:153689882-153689904 GGTCTAAGGCAGAGGGTGGGTGG - Intronic
1201358876 Y:13124797-13124819 TATCTAATGATGAGAGTGAGGGG + Intergenic
1202594643 Y:26523832-26523854 TGTCCAATGCTGAGATTGAGTGG - Intergenic