ID: 1108317471

View in Genome Browser
Species Human (GRCh38)
Location 13:49250890-49250912
Sequence CTGGCTCTACATGTTATTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108317462_1108317471 5 Left 1108317462 13:49250862-49250884 CCATATTTCTCACCCTCATCCCC 0: 1
1: 0
2: 3
3: 53
4: 667
Right 1108317471 13:49250890-49250912 CTGGCTCTACATGTTATTAACGG 0: 1
1: 0
2: 2
3: 10
4: 112
1108317464_1108317471 -7 Left 1108317464 13:49250874-49250896 CCCTCATCCCCCCACTCTGGCTC 0: 1
1: 0
2: 3
3: 44
4: 524
Right 1108317471 13:49250890-49250912 CTGGCTCTACATGTTATTAACGG 0: 1
1: 0
2: 2
3: 10
4: 112
1108317465_1108317471 -8 Left 1108317465 13:49250875-49250897 CCTCATCCCCCCACTCTGGCTCT 0: 1
1: 0
2: 6
3: 72
4: 646
Right 1108317471 13:49250890-49250912 CTGGCTCTACATGTTATTAACGG 0: 1
1: 0
2: 2
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108317471 Original CRISPR CTGGCTCTACATGTTATTAA CGG Intronic
903571246 1:24307194-24307216 CTGGTTCTACAGGTTGTTATAGG + Intergenic
903713272 1:25342372-25342394 TTGGCTCTAGATATTATCAAGGG - Intronic
906838999 1:49115929-49115951 CTGTATCTCCATGTTCTTAAAGG + Intronic
909174931 1:72345515-72345537 ATGGTGATACATGTTATTAAGGG + Intergenic
916723760 1:167504713-167504735 CTGCCTCTCCTTGTCATTAACGG + Intronic
917860954 1:179143606-179143628 CTGGCTCTATAGCTTAATAAAGG + Intronic
918432865 1:184480487-184480509 CTGGCTATACAAGTTGTGAAGGG - Intronic
919648609 1:200123008-200123030 CTGGTTTTACCTGTGATTAAGGG + Intronic
921216946 1:212945876-212945898 CTAGCTCTACTAGTTATTAATGG - Intergenic
921297185 1:213715204-213715226 GTGGCTATACATGTTATAAAAGG + Intergenic
923828164 1:237523265-237523287 CTGTCTCTTCATTTTCTTAATGG - Intronic
1066474740 10:35735619-35735641 CTGGATCTACATGTGAGTCAGGG + Intergenic
1068372339 10:56133045-56133067 GTGGCTCTATGTATTATTAAAGG + Intergenic
1068732004 10:60368682-60368704 CTGTGTCTAATTGTTATTAAAGG - Intronic
1069236985 10:66088423-66088445 ATTTATCTACATGTTATTAATGG + Intronic
1071351554 10:84751413-84751435 CTGGCTCTAGATGTTCTTTCAGG - Intergenic
1072484721 10:95844178-95844200 CTGGCTCAAAAAGTTATCAAAGG - Intronic
1073187660 10:101626360-101626382 TTGGCTTTACCAGTTATTAATGG - Intronic
1073391713 10:103183047-103183069 CTGACTTTCCATGTTTTTAAGGG - Intronic
1073611227 10:104945983-104946005 CTGGCTCCACCTCTTATTAATGG + Intronic
1073857929 10:107698762-107698784 CTTGCTCTACATCTTATCAGGGG + Intergenic
1081223963 11:40498207-40498229 CTAACTCTACATATTATTTAGGG - Intronic
1081491610 11:43573830-43573852 CAGGCTAAACATGTTTTTAAAGG - Intronic
1088212072 11:107467561-107467583 CTGGGTCTACAATTTACTAATGG - Intergenic
1092114113 12:5986374-5986396 CTGGCTCTGCTTCTTATTAGTGG - Intronic
1095794302 12:46200741-46200763 CTGTCTCTCCATTCTATTAATGG + Intronic
1098183782 12:67875879-67875901 CTTGCTCTACATGCTTTTCATGG + Intergenic
1108317471 13:49250890-49250912 CTGGCTCTACATGTTATTAACGG + Intronic
1108792605 13:53989956-53989978 CTGGCTTGATACGTTATTAAGGG - Intergenic
1109526985 13:63588693-63588715 CTGGCACTACAAGATATTACAGG + Intergenic
1110167284 13:72458739-72458761 CTGGTTCTACAAGTTTCTAATGG - Intergenic
1110323653 13:74188599-74188621 CTGGCTCTACCATTTATTTATGG + Intergenic
1114199984 14:20511082-20511104 CTGGCGCTTCATGTCATTACAGG - Exonic
1116278446 14:42868936-42868958 CTGGATCTCCATCTTATAAATGG - Intergenic
1116386968 14:44343184-44343206 ATGAGTTTACATGTTATTAAGGG + Intergenic
1118191204 14:63582244-63582266 CTGGTTCTACATTTTAAAAATGG + Intergenic
1118241703 14:64065952-64065974 CTGTCTCTACATTATACTAAAGG + Intronic
1127759439 15:62123366-62123388 TTGTCTCTCGATGTTATTAAGGG + Intergenic
1127841323 15:62834672-62834694 CTGGCTCTACAGGGGATCAACGG - Intronic
1129182065 15:73883879-73883901 CTGGCTCTACATCTTAATAACGG - Intronic
1129375199 15:75125953-75125975 CTGGCTCAACAACTTATTAGGGG - Intergenic
1131608282 15:93933166-93933188 CTGGCTCTTCATGTCTTCAAAGG - Intergenic
1139247864 16:65463834-65463856 CTGGCCCTGCATGTTATACATGG + Intergenic
1140688295 16:77454670-77454692 CTGGCTCTTAATGTTATTTATGG + Intergenic
1150235052 17:63586154-63586176 CTGGCCCAACATATTTTTAAGGG - Intronic
1151454089 17:74215675-74215697 CTGGCTCTGGGTGTTATTTAAGG + Intronic
1151768928 17:76146908-76146930 TTGACTCTACATGCCATTAAAGG - Intronic
1156613694 18:38757555-38757577 CTGGCTCTACTAGTTACAAAAGG - Intergenic
1163224277 19:15944922-15944944 CTGGCTGGAGATGTTATTTATGG + Intergenic
1167290147 19:48619990-48620012 CTGGCTCTGCTAGTTACTAATGG + Intronic
1167317513 19:48773785-48773807 CTGGCCCTTCCAGTTATTAATGG + Intergenic
1167450116 19:49562441-49562463 CTGGCTCTAAATCATTTTAAGGG - Intronic
925945843 2:8862730-8862752 TTGGCTCTCCATGTTTTTCATGG - Intronic
928654215 2:33432927-33432949 CTAGCTCTAGATTTTATTATCGG + Intergenic
931217419 2:60259514-60259536 CTGGCTCTTCAACATATTAAGGG + Intergenic
931508742 2:62963722-62963744 CTCACTCTATATGTTATTAAAGG - Intronic
933055912 2:77664748-77664770 TTGGCTCTATGTGTGATTAAAGG + Intergenic
934136572 2:89001468-89001490 CTGGGTCTCCATCTTATTAGTGG + Intergenic
936524455 2:113233358-113233380 CTGGCTCTACATTTTCTTTCTGG - Intronic
943914143 2:193606556-193606578 TTGGCTCTTCAGTTTATTAATGG + Intergenic
943993290 2:194725853-194725875 TTGGCTCAAAATGTTAATAATGG + Intergenic
1170274377 20:14567537-14567559 ATGGCTATACTTGTTATTTATGG + Intronic
1170765287 20:19284719-19284741 CTGGCTTTAGATGCTATTAGAGG + Intronic
1171048047 20:21829545-21829567 CTGGATCTAGATGTTATTCCCGG + Intergenic
1182905966 22:33936597-33936619 CTGCCTCCACATTTTATCAAAGG + Intergenic
949893679 3:8753147-8753169 CTGGATCTACATGCTGTTCACGG - Exonic
953196739 3:40741567-40741589 CTGCCTGTAAATGTTGTTAATGG - Intergenic
955089481 3:55735140-55735162 ATGGCTTCACATGTTATAAATGG + Intronic
955667143 3:61362522-61362544 CTGTCTTTGCATGTTCTTAATGG - Intergenic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
956771694 3:72532163-72532185 GTTTCTCTACATTTTATTAAAGG - Intergenic
962903528 3:139781057-139781079 CTGGCCCTACATGTAATCACTGG - Intergenic
964806331 3:160613532-160613554 CTTACTCTACATATTATTCAGGG + Intergenic
966191984 3:177279861-177279883 CTGGCTTTACAGGTGATGAATGG + Intergenic
971574896 4:28259907-28259929 CTGGTTTTATATTTTATTAAAGG + Intergenic
974501775 4:62713843-62713865 CTGAATCTACATGCTATTTATGG + Intergenic
975074201 4:70184452-70184474 CTGGCTCTATACGTTGTTCATGG + Intergenic
976096232 4:81511104-81511126 ATGACTGTACATGTTTTTAAGGG - Intronic
977909252 4:102513332-102513354 CTAGCTCTACAAGTTATTCTTGG + Intronic
979024804 4:115555699-115555721 CTGTCTCTACATGTCAGTGAAGG - Intergenic
980756130 4:137163953-137163975 CTGTGTCTACATGCTATTAATGG - Intergenic
988045867 5:25952179-25952201 CTTGCTCTATATTTTATTTAAGG - Intergenic
989804781 5:45589688-45589710 ATGGCAATACATGTTTTTAATGG + Intronic
990859271 5:60308551-60308573 CTGGCTCTACTTTTTACTGATGG - Intronic
995207783 5:109502338-109502360 CTTGTTCTACATATTTTTAAAGG + Intergenic
996867062 5:128136807-128136829 ATGGCTCAAAATGCTATTAAGGG + Intronic
1000867236 5:166528781-166528803 CTGGTTGTACATGTTTCTAAGGG + Intergenic
1003710197 6:8580989-8581011 CTGGCTCTATATTTTTTTAAAGG - Intergenic
1008159514 6:48060261-48060283 CTCACTCTCCATGTCATTAAAGG + Intronic
1011218121 6:85027144-85027166 CTAGTTCTACAAGTTATAAAAGG - Intergenic
1014508568 6:122291082-122291104 CTGGTTCTACAACTTATTAGTGG + Intergenic
1014962902 6:127708991-127709013 CTGTCTCTTCATTTTGTTAAAGG + Exonic
1016012099 6:139147787-139147809 CTGGCACTTCCTGTTCTTAATGG + Intronic
1018717219 6:166542810-166542832 CCTGCTCTTCATGTCATTAAAGG + Intronic
1019610946 7:1936363-1936385 CTGGATTTACTTGTGATTAATGG + Intronic
1023681813 7:42695114-42695136 CTGGCTCTACAGTTTGTTACAGG - Intergenic
1024937707 7:54728315-54728337 CTCCCTTTACATGTTATAAATGG - Intergenic
1028693106 7:93676264-93676286 CTAGCTCTAAATATTATAAAGGG - Intronic
1029535735 7:101156401-101156423 CTGGCTCTACTAGTTATGCAAGG - Intronic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1031166917 7:118239973-118239995 TTGGCACTACATGTGACTAAAGG + Exonic
1033825032 7:145178940-145178962 CTGGCCCCACATCTCATTAAAGG + Intergenic
1034582699 7:152059396-152059418 CTGGCTATAAATGTTCTTAATGG + Intronic
1035128781 7:156631414-156631436 CTATCTCTACATGTTTTTAAGGG + Intergenic
1036241539 8:7085853-7085875 CTTTCTCTACACGTTATTCAGGG + Intergenic
1042282083 8:67065285-67065307 TTGTCAGTACATGTTATTAATGG + Intronic
1044692020 8:94890507-94890529 CTGGCTAAACATGTTAAAAAAGG - Exonic
1046359246 8:113129381-113129403 CTGGCTCTACATCTTATCATTGG - Intronic
1051022583 9:12562402-12562424 CTGGCTCTCCATGTCATTAATGG + Intergenic
1055352277 9:75402175-75402197 TGGGCTCTACTTGTTATCAATGG - Intergenic
1055352573 9:75404266-75404288 CTGGCTCTAAAAGTTCTTTAAGG + Intergenic
1056101260 9:83302465-83302487 GTTTCTCTACATATTATTAAAGG + Intronic
1058554385 9:106151277-106151299 CTGGCTCTACCACTTATTAGTGG - Intergenic
1061354352 9:130092913-130092935 CTGGCCCTAAATATTTTTAATGG + Intronic
1188238456 X:27756391-27756413 CAGGCTGTATCTGTTATTAAAGG + Intergenic
1188783946 X:34321022-34321044 GTGGCTATAGATTTTATTAAGGG + Intergenic
1188911842 X:35858873-35858895 CTGACCGTACAAGTTATTAAAGG + Intergenic
1189040093 X:37533334-37533356 CTGTAACCACATGTTATTAAAGG + Intronic
1190433340 X:50399102-50399124 GTGTCTTTACATGTTATTATGGG + Intronic
1192324516 X:70121332-70121354 CTGGCCCTACAAATTATTACAGG - Intergenic
1195404128 X:104494276-104494298 AGGGCTCTACATGTTTGTAAGGG + Intergenic
1196924132 X:120615520-120615542 CTGGCTTTACATATTAGTATTGG - Intronic
1201303376 Y:12529527-12529549 CTTGCTTTCCATATTATTAAAGG - Intergenic
1202177065 Y:22107622-22107644 CAGGTTCTACATGTCATGAAGGG - Intergenic
1202214296 Y:22478762-22478784 CAGGTTCTACATGTCATGAAGGG + Intergenic