ID: 1108317698

View in Genome Browser
Species Human (GRCh38)
Location 13:49253877-49253899
Sequence CAGTGAGGGCCTTTAGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108317698_1108317704 24 Left 1108317698 13:49253877-49253899 CCTTATGCTAAAGGCCCTCACTG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1108317704 13:49253924-49253946 TGGCATAATGGTTAAGACAATGG 0: 1
1: 1
2: 3
3: 51
4: 321
1108317698_1108317703 12 Left 1108317698 13:49253877-49253899 CCTTATGCTAAAGGCCCTCACTG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1108317703 13:49253912-49253934 ACAGAAGCAATGTGGCATAATGG 0: 1
1: 0
2: 2
3: 31
4: 295
1108317698_1108317701 4 Left 1108317698 13:49253877-49253899 CCTTATGCTAAAGGCCCTCACTG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1108317701 13:49253904-49253926 TTTCCAGAACAGAAGCAATGTGG 0: 1
1: 0
2: 5
3: 29
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108317698 Original CRISPR CAGTGAGGGCCTTTAGCATA AGG (reversed) Intronic
904551771 1:31324887-31324909 CAGGGATGGCCTAAAGCATAGGG + Intronic
907282480 1:53360139-53360161 CAGTGAGGGCCATGAGGGTAGGG + Intergenic
912383897 1:109261851-109261873 CAGTGATGGCCAGTGGCATACGG + Exonic
917413060 1:174780198-174780220 CAGTGAGGGCCTATTAAATATGG - Intronic
1067799283 10:49347932-49347954 CAGTGAGGGCCTGTGGCCAAAGG - Intergenic
1070046973 10:72847784-72847806 CAGTCAGGGCCTTAATCATCTGG + Intronic
1075711166 10:124531143-124531165 CAGGGAAGGCCTTGAGGATATGG - Intronic
1076091869 10:127693479-127693501 CAGGCAGGGCCTTTTGTATATGG + Intergenic
1077395773 11:2320438-2320460 CAGTGAAGTCCTATAGGATATGG - Intergenic
1078015765 11:7613034-7613056 CAGTGAGTGTATTTAGCCTAAGG + Intronic
1086252015 11:84827219-84827241 TAGTGAGAGACTTTAACATAAGG - Intronic
1086726591 11:90193042-90193064 CAGTGGGGGCATTTAGTTTAGGG + Intergenic
1088905507 11:114152609-114152631 GAGTGAGGACCTGAAGCATATGG + Intronic
1092559529 12:9596403-9596425 CACTGAGGGCCTTTTGGAAAAGG - Intronic
1093489515 12:19688831-19688853 CAGTGAGGGAGTTCACCATATGG - Intronic
1096111687 12:49032550-49032572 CAGGGAGGGCCGTTAGCAATAGG - Exonic
1098664379 12:73142548-73142570 CATTCATGGCCTTTACCATAGGG - Intergenic
1102538937 12:113604220-113604242 CACTCAAGGCCTTTAGCAAAGGG - Intergenic
1105810697 13:23992667-23992689 CAGGGAGGGGCTGTAGCACATGG - Intronic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1110633416 13:77736715-77736737 CAGGGAGGGCATGTAGGATAAGG - Intronic
1113131075 13:107037395-107037417 CAGCAAGGGCCATTAGCATGAGG - Intergenic
1113871408 13:113562087-113562109 CTGTGAGGGCCTCTGGCAAAGGG + Intergenic
1115484996 14:33901767-33901789 CAGGGAAGGCCTATAGCCTAGGG + Intergenic
1115490408 14:33952761-33952783 CAGTGATGGCCTTTACCCCAAGG - Intronic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1124029984 15:26001707-26001729 GAGATAGGGCCTTTATCATAAGG - Intergenic
1129321026 15:74775114-74775136 CAGTGAGGGACAATAGCAGAGGG + Intergenic
1131054738 15:89368609-89368631 CCCTGAGCGCCATTAGCATACGG + Intergenic
1131741958 15:95402565-95402587 CAGTGAGGTCCTGTAGAAAAAGG - Intergenic
1138088471 16:54155082-54155104 CAGTGAGGGCCCTGAGGATATGG + Intergenic
1140291437 16:73662511-73662533 AAGTGAGGGCTTTTGACATAAGG - Intergenic
1140788181 16:78363799-78363821 CAGTGAGGTCCTGTAGGATGAGG + Intronic
1141757229 16:85999314-85999336 CAGTGAGGGGCTTGAGCAGAGGG - Intergenic
1150238640 17:63613900-63613922 CAGCCAGGGCCTCTAGCAGAGGG - Intergenic
1157511156 18:48275867-48275889 CAGTGAGGGCATTAAGCAACAGG + Intronic
1157719936 18:49915942-49915964 CTGTGAGGCCCTTTTTCATATGG - Intronic
1159027388 18:63196671-63196693 CCGTGCGGCCCTTTATCATACGG + Intronic
1159974347 18:74692195-74692217 CAGTCAAGGCCATTAGCATGGGG + Intronic
1160795395 19:942936-942958 CAGTGAGGTCCTGCAGCGTACGG + Intronic
1165121086 19:33558911-33558933 CAGGGAGGGCGTTTGGGATAGGG + Intergenic
1166390840 19:42407955-42407977 CGGTGAGGGCCTGTTGCAGATGG - Exonic
1167568497 19:50272035-50272057 CACTGAGGCCCTGTAGCACATGG - Intronic
925059122 2:877729-877751 CAGTGAGGGGCTTTCACAGATGG + Intergenic
925344049 2:3157360-3157382 CAGTGGGGTCCTTTAGTTTAGGG + Intergenic
927753825 2:25692932-25692954 CAGTGAGTGTGTTTAGCATGTGG + Intergenic
928223436 2:29424965-29424987 CAGTGAATGCCTTTAGAATAGGG - Intronic
931057005 2:58483500-58483522 CAGTGAGGGCCTGGAGGATAGGG - Intergenic
932918759 2:75885593-75885615 AAGTGAGGGCCTTTTAAATAGGG + Intergenic
940422828 2:153499453-153499475 CAGTGACGGCCTGAAGCATGGGG - Intergenic
1169105224 20:2988801-2988823 CAGTGAGTTCCTTGAGAATAGGG - Intronic
1170518356 20:17155612-17155634 CCGTGAGTGGCTTTTGCATATGG - Intergenic
1170541832 20:17396881-17396903 CAGTGAAGGCCTCTAGGAAATGG + Intronic
1170941301 20:20850141-20850163 CAGACAGGGCCTTTAGACTACGG - Intergenic
1175190074 20:57205794-57205816 CAGTGCTGGCCTGTAGCATCTGG - Intronic
1177809947 21:25915082-25915104 CACAGAGGGCCTTCAGCATCTGG - Intronic
1178533113 21:33391740-33391762 CTGTGGGGGCCCTTAGTATATGG - Intergenic
1182018940 22:27064681-27064703 CCATGAGGATCTTTAGCATAAGG - Intergenic
950366226 3:12486172-12486194 CAGTGAGTGCCTCTGGCATCTGG + Intronic
953738882 3:45519524-45519546 CAGTGACGGTTTTTAGAATATGG - Intronic
956081755 3:65564734-65564756 CAGCTAGGGTCTTTAGCAGAGGG + Intronic
960886894 3:122405110-122405132 CAGTCAGGGTCTTTAACATGAGG - Intronic
961792710 3:129387776-129387798 CAGTGGGTGCCTTTTGGATAGGG + Intergenic
962539820 3:136369201-136369223 CAGAGAGGGCCTTCAGCCTTTGG - Exonic
963663864 3:148157626-148157648 CAGTGACTGCCTTTGGTATATGG + Intergenic
964768460 3:160200569-160200591 GAATGAGGGCATTTAGCATTGGG + Intergenic
965009817 3:163073379-163073401 CAGTGATGGCCTGAAGCATGGGG + Intergenic
965774001 3:172209683-172209705 CAGGGAGGGCCTGAAGCCTATGG - Intronic
965837366 3:172866903-172866925 CAATGAGGGGCTTTAGCACCCGG + Intergenic
970702740 4:18762144-18762166 CAGAGAAAGCCTTTAGAATATGG - Intergenic
974070235 4:57116426-57116448 CAGTGAGGGACTTTACCTCAAGG - Intergenic
976037807 4:80845257-80845279 CAGTGTGGGACTTGAGCAGATGG - Intronic
980419220 4:132539426-132539448 CAGTGAAGGCCTTCAGAATTTGG + Intergenic
981286034 4:143020170-143020192 CAGTGTGCAGCTTTAGCATAGGG + Intergenic
982623348 4:157732962-157732984 CAGTGGAGGCCTTTAGGATTTGG - Intergenic
984282589 4:177689915-177689937 CAATGAGCTACTTTAGCATATGG + Intergenic
986443126 5:7798500-7798522 CAGTGTGGGCCTTTTGCAAGTGG - Intronic
987926946 5:24353834-24353856 CAGGGGAGGACTTTAGCATAGGG - Intergenic
989268248 5:39502621-39502643 GATTTAGGGCCTTCAGCATAGGG - Intergenic
989516888 5:42354059-42354081 CAGTCAGGGCCTTCAGCTTCAGG - Intergenic
991957445 5:72009650-72009672 AATTGAGGGGCTTTAGCATAAGG + Intergenic
992023583 5:72649465-72649487 CAGTGAGGGGCTTTGGAAGAAGG - Intergenic
992654437 5:78894521-78894543 CAGTGAGATCCTTTAGAATCTGG - Intronic
1004399218 6:15273060-15273082 CAGTTAGGGGATTCAGCATATGG + Intronic
1005157379 6:22822151-22822173 CAGTGAGGGCCTGTAGGAATTGG - Intergenic
1005503800 6:26452375-26452397 CAGTGCGTGCCTGTAGCTTATGG - Exonic
1009633486 6:66232181-66232203 CAGTGAAGGACTTTGGCAGATGG + Intergenic
1010027711 6:71239165-71239187 CAGGGAGGCCGTATAGCATAAGG + Intergenic
1010813821 6:80331162-80331184 CAGTCATGGCCTTAAGCATCCGG + Intronic
1012324751 6:97903074-97903096 GAATGATGGCCTTGAGCATAAGG + Intergenic
1015851589 6:137579359-137579381 GAGTGTGAGCCTATAGCATATGG + Intergenic
1021021138 7:15599956-15599978 CAGTGAGGGCCTGAAGCCTGGGG - Intergenic
1022837493 7:34131624-34131646 AAGTGAAGGCCTCTAGCATCTGG - Intronic
1024409489 7:49023785-49023807 CTGTGATGACCTTGAGCATAAGG + Intergenic
1028473124 7:91225774-91225796 CAGTGAGTGTATTTTGCATATGG - Intergenic
1031900042 7:127398772-127398794 CTCTGAGTGCCTTTAGCACAGGG - Intronic
1034173853 7:149084989-149085011 CAGTGTCGGTCTTTTGCATATGG + Intronic
1034817387 7:154184146-154184168 CAGTGAGGACCCTCAGCATCAGG + Intronic
1035117083 7:156533649-156533671 CAGGGAGGGCCGTTCGCATGAGG - Intergenic
1038426117 8:27465016-27465038 CAGTCAAGGCCTTTTGCAAACGG - Intronic
1040711017 8:50188829-50188851 CAGTGCAGGCCTTTAGGATTTGG - Intronic
1040897954 8:52388708-52388730 CAGGGAGGGCCTTTCTCAAAAGG + Intronic
1044866018 8:96572030-96572052 CACTGATGGCCTTTAACAGAAGG - Intronic
1045146277 8:99347836-99347858 CAGTGTGGGCTTTTAGAAGATGG - Intronic
1045329112 8:101140308-101140330 CACTGGAGGCCTTTAGCACAAGG - Intergenic
1047920500 8:129629913-129629935 CTGTGAGGGCTTTTGGAATAAGG - Intergenic
1052232578 9:26172117-26172139 TAGTGAAGTCCTTTAGGATATGG - Intergenic
1053387537 9:37706358-37706380 AAGTGAGGGCCTATTGCATTAGG + Intronic
1053434053 9:38063549-38063571 CAAAGAGGGCCTTCAGCAGAAGG - Intronic
1055732143 9:79289146-79289168 CAGTGAGAGGCTTCTGCATAGGG + Intergenic
1058836122 9:108859845-108859867 CTGTAAGGTCCTTGAGCATAGGG - Intergenic
1060473342 9:123966903-123966925 CAGTGAGGGACTGCAGTATAGGG - Intergenic
1186598696 X:11012303-11012325 CAGTAAGTGCCTTTAGGATAGGG - Intergenic
1188980082 X:36719801-36719823 CAGTGAGGGGCTGGAGCACAGGG + Intergenic
1189082993 X:37994226-37994248 CAATGAGGGGCTGGAGCATAGGG + Intronic
1189105725 X:38233420-38233442 CAGTGAGGGCTTTAAGGTTATGG - Intronic
1190876191 X:54461947-54461969 CAGTGAGAGCCTTCAGCTTGAGG - Intronic
1197386781 X:125812307-125812329 CAGTGAAGGCCTCTAGGATTTGG - Intergenic