ID: 1108317701

View in Genome Browser
Species Human (GRCh38)
Location 13:49253904-49253926
Sequence TTTCCAGAACAGAAGCAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108317699_1108317701 -10 Left 1108317699 13:49253891-49253913 CCCTCACTGTACTTTTCCAGAAC 0: 1
1: 0
2: 3
3: 22
4: 231
Right 1108317701 13:49253904-49253926 TTTCCAGAACAGAAGCAATGTGG 0: 1
1: 0
2: 5
3: 29
4: 298
1108317698_1108317701 4 Left 1108317698 13:49253877-49253899 CCTTATGCTAAAGGCCCTCACTG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1108317701 13:49253904-49253926 TTTCCAGAACAGAAGCAATGTGG 0: 1
1: 0
2: 5
3: 29
4: 298
1108317696_1108317701 22 Left 1108317696 13:49253859-49253881 CCATTGTGTCTTCTGGTACCTTA 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1108317701 13:49253904-49253926 TTTCCAGAACAGAAGCAATGTGG 0: 1
1: 0
2: 5
3: 29
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108317701 Original CRISPR TTTCCAGAACAGAAGCAATG TGG Intronic
900812690 1:4819839-4819861 TTTACAGAACAAGAGCAATGAGG + Intergenic
900903508 1:5534051-5534073 TTTACAGAACAAGAACAATGAGG + Intergenic
901104943 1:6747889-6747911 TTTACAGAACAAGAGCAATGAGG - Intergenic
903774317 1:25782965-25782987 TTCCCAGAACGGAAGCAACCTGG - Intronic
904637366 1:31893286-31893308 TTGAGAGAACAGTAGCAATGAGG + Intergenic
905800615 1:40839983-40840005 TTTGCAGAAGAGGAGCAAAGGGG - Exonic
905853229 1:41289773-41289795 TTTCAAAAACAGAAGCAACAGGG + Intergenic
906804379 1:48766220-48766242 TTTCCAAAAAAGAAGAAATGAGG + Intronic
907155331 1:52328260-52328282 TGTCCAGAAAAGAGGCAATTAGG + Intronic
907883537 1:58573076-58573098 TTTTCAGAACAGAAGCATGAGGG + Intergenic
907910767 1:58824297-58824319 TTTCCTGAACAGAAGAAACTGGG + Intergenic
908679099 1:66639770-66639792 ATTACAGAAGAAAAGCAATGGGG + Exonic
908772403 1:67609008-67609030 TTTCCAGAAAGGAAGTAAGGAGG - Intergenic
909203678 1:72725727-72725749 TCACCACAGCAGAAGCAATGTGG - Intergenic
909537624 1:76755976-76755998 TCTCCAGAACAGAGTCCATGCGG + Intergenic
910517659 1:88081284-88081306 TGTCCAGCTCAGATGCAATGAGG + Intergenic
911160633 1:94679652-94679674 TTTCCTGAACATAAACAGTGTGG + Intergenic
911305433 1:96226144-96226166 TTCCCAGAACACAGGCAATCAGG + Intergenic
911672661 1:100624442-100624464 TTTCCAGATAAGAAGCCATTTGG - Intergenic
911757132 1:101571548-101571570 TTTCCAGAACAGGAACAATGAGG - Intergenic
912503517 1:110138424-110138446 TTTCCAGATCAGAACCTATAGGG + Intergenic
913142803 1:115958110-115958132 TTTACAGATAAGAAGCTATGGGG - Intergenic
917448142 1:175124001-175124023 CTTCCAGAATGGAGGCAATGGGG + Intronic
918322830 1:183381193-183381215 TGTCCAGAACAGGAGTCATGGGG - Intronic
918774838 1:188613631-188613653 TTTACAGAACTCAAGCAATATGG - Intergenic
918999183 1:191806744-191806766 ATTACACAACAGAAGCAATCAGG + Intergenic
920656712 1:207881752-207881774 TTTCCAAAACAAAAACAATTAGG - Intergenic
921082361 1:211752460-211752482 TTTACAGAACAAGAACAATGAGG - Intronic
921747507 1:218754332-218754354 TTTCAAGAAAAGATTCAATGGGG - Intergenic
921827161 1:219685717-219685739 TTTCCAGAACAAAAGTGAAGTGG - Intronic
922461612 1:225817765-225817787 TTTCCAGAACAAAGGCCATGAGG - Intronic
923001422 1:230009318-230009340 TTTCCAGAGCAGCAGAAATCAGG - Intergenic
923735126 1:236599572-236599594 ATGGCAGAACACAAGCAATGAGG + Exonic
923877632 1:238066691-238066713 TCACCAGGACAGAAGCAATGAGG - Intergenic
924719825 1:246612080-246612102 TTTCCAGAGCTGGAGCAAAGGGG + Intronic
1063472323 10:6298049-6298071 TTACCAGAACAGAAAGAAGGGGG + Intergenic
1063654263 10:7971738-7971760 TTTCCAGGACACCAGCAGTGCGG - Intronic
1064691515 10:17923393-17923415 TTTCCAGCAGAGAAGAAGTGTGG + Intergenic
1065104464 10:22368302-22368324 GTTACTGAACAGAAGCAATGAGG + Intronic
1066378634 10:34882499-34882521 TTTCCAGGCCAGATGCAGTGTGG - Intergenic
1067215844 10:44302092-44302114 TTTCCAGAAATGAAGAGATGGGG - Intergenic
1067847121 10:49733282-49733304 TTTCCCCAAGGGAAGCAATGTGG + Intergenic
1068170304 10:53384175-53384197 TTTACAGAACAGAAAAAGTGTGG - Intergenic
1069412131 10:68164439-68164461 TTTCCAGCACATGAGCATTGGGG + Intronic
1070451035 10:76557380-76557402 TTTCCCAAAGAGAGGCAATGTGG - Intronic
1070458133 10:76638158-76638180 TTTCTGGAACAGAAGAAATATGG + Intergenic
1071464608 10:85927896-85927918 AGTCCAGAAAAGAGGCAATGAGG + Intronic
1074076707 10:110133564-110133586 TTTTCAGAAAAGAAGGAGTGCGG - Exonic
1074305441 10:112273370-112273392 CTTACAGATCAGTAGCAATGTGG - Intergenic
1074482307 10:113835435-113835457 TTTTCAGAACTAAAGCACTGAGG - Intronic
1074848028 10:117416026-117416048 TTTACAGCCCAGAAGCACTGTGG + Intergenic
1075225733 10:120627546-120627568 TTTACAGAACAAGAACAATGAGG - Intergenic
1075294565 10:121262885-121262907 TTACCGGAACAGAAGGAGTGGGG + Intergenic
1080491959 11:32774623-32774645 TTTGGAGAAAAGAAACAATGTGG + Intronic
1081271746 11:41093679-41093701 TTTCCAGAATGGAAGCAATGGGG - Intronic
1085926031 11:81022241-81022263 ATTCCATACCAGAAGCAATAAGG + Intergenic
1086811305 11:91313788-91313810 TTTCAAAAACAGAAGAAATGTGG + Intergenic
1087381882 11:97415229-97415251 TTTGCAGTGCAGAAGCTATGTGG + Intergenic
1087639311 11:100738908-100738930 ATTCAAGCACAGAAGCAATCAGG + Intronic
1087984783 11:104664496-104664518 TTTCCTTAACAGAAGCATAGTGG + Intergenic
1088113167 11:106285320-106285342 TTCTCAGAACAGAATCTATGTGG - Intergenic
1089014903 11:115157758-115157780 TTCCCAGGACAGAAGCACAGAGG - Intergenic
1089152682 11:116376164-116376186 TTTCCAGAACAGGATTCATGAGG - Intergenic
1089436359 11:118472113-118472135 TTTCCAGTTCAGAATTAATGAGG - Exonic
1089792673 11:120955968-120955990 TTACCAGTGCAGAAGCATTGAGG + Intronic
1091832413 12:3559296-3559318 ATTCCAGAACAGAGGCATGGAGG - Intronic
1092741892 12:11638194-11638216 TTTCCTGGTCAGAAGCAATGTGG + Intergenic
1095198652 12:39355995-39356017 TTTGCAGAACATAAGCAAACGGG - Intronic
1096098718 12:48956335-48956357 TTTCCAGGCCAGGAGGAATGTGG - Intronic
1096996377 12:55840769-55840791 CTTCCAGGACTGGAGCAATGTGG - Exonic
1097258401 12:57697966-57697988 TTACCAGGACAGGAGCAATAGGG - Intronic
1097705231 12:62861617-62861639 ATTCCAGAACAGAAGCCATATGG + Intronic
1098098263 12:66984137-66984159 TTTCAAGAGCATAAGCAAAGAGG + Intergenic
1098674747 12:73274755-73274777 TTTACAGAACAAGAACAATGAGG + Intergenic
1100564942 12:95786641-95786663 TCCCGAGAACTGAAGCAATGAGG + Intronic
1100981899 12:100168588-100168610 TGGCCATAACCGAAGCAATGAGG - Intergenic
1108317701 13:49253904-49253926 TTTCCAGAACAGAAGCAATGTGG + Intronic
1108796872 13:54042948-54042970 TTTCCAGAACAGAATATAAGTGG - Intergenic
1109102641 13:58205529-58205551 GTTATAGAACAGAAGCAAGGGGG - Intergenic
1109483160 13:62983718-62983740 TTTCATTAACAGAAGAAATGTGG - Intergenic
1109561949 13:64061187-64061209 TCTCCAGAACAGAACCAATAAGG + Intergenic
1110795710 13:79635187-79635209 CTCACAGAATAGAAGCAATGAGG + Intergenic
1112918749 13:104583624-104583646 TTTTCAGAAGAAAAGTAATGTGG + Intergenic
1112921206 13:104614903-104614925 TTTCTAGAACTGAATCAATAGGG + Intergenic
1115451336 14:33551432-33551454 TAGCCATAACAGAAGCACTGTGG + Intronic
1116357424 14:43946796-43946818 TTTCAAGGATAGAAGAAATGAGG + Intergenic
1118408277 14:65449434-65449456 TTGCCAAAACAGAAAGAATGCGG + Intronic
1119129068 14:72155053-72155075 TTTCCAGAAAGCCAGCAATGAGG - Intronic
1119213783 14:72852409-72852431 TTACCAGAACAGACTCAGTGTGG - Intronic
1122215750 14:100202945-100202967 GGTGCAGAACAGAGGCAATGGGG - Intergenic
1123711622 15:22992057-22992079 TTTACAGAACAAGAACAATGAGG + Intronic
1125062756 15:35443967-35443989 TTTCAAGAAGAGAAGTAATCAGG + Intronic
1125278496 15:38019275-38019297 TTTCTAAAACTGAAGCAATCTGG + Intergenic
1126830749 15:52601967-52601989 TTTCCAGAATTGAAGACATGAGG - Intronic
1130803729 15:87295598-87295620 TATCCAGAATAGAACCAATTTGG - Intergenic
1133895989 16:9929359-9929381 TTTACTAAACAGAAGAAATGAGG - Intronic
1134228272 16:12408889-12408911 TTTCCACAATAGAAGTAGTGGGG - Intronic
1135736888 16:24939120-24939142 TTTCCAGCACCAAAGCAGTGTGG + Intronic
1138582030 16:57947933-57947955 TTTCACTAACAGAAGCAAAGTGG + Intronic
1141282733 16:82643848-82643870 TTTCCAGAACTGAGGCAAGAGGG - Intronic
1142038335 16:87876488-87876510 TTTCCAGTGAAGAGGCAATGAGG - Intergenic
1143285526 17:5786192-5786214 TTTCCAGCACAGAAACAGCGTGG - Intronic
1144462414 17:15468787-15468809 TTTTGAGAACCGCAGCAATGAGG - Intronic
1144590208 17:16517326-16517348 TTTCCAGATCAGAAACTCTGGGG + Intergenic
1145071227 17:19809929-19809951 TTTCAAGAAAAGAAATAATGAGG + Intronic
1145987308 17:29055698-29055720 TTTCCAGAAAGGATGGAATGAGG - Intronic
1146083650 17:29806764-29806786 TTTAGAGAACAGAAGAGATGTGG - Intronic
1146558375 17:33847115-33847137 TTTCCAGAGAAGATGCAAAGAGG - Intronic
1148403509 17:47388503-47388525 ATGGCAGAACAGAAGCAATCTGG - Intronic
1152016707 17:77755810-77755832 TTTCCAGGAGAGGAGCTATGAGG + Intergenic
1153816494 18:8794761-8794783 TTTACAGAACAAGAACAATGAGG - Intronic
1154091513 18:11368165-11368187 TTTACAGAACAAGAACAATGAGG + Intergenic
1156877487 18:42032482-42032504 TTTGAAGAAGAGAAGCAATCAGG + Intronic
1158852516 18:61509486-61509508 TTTCAAGAACAGCAACAGTGGGG + Intronic
1158903985 18:61993259-61993281 TTTGCAGAACAGTAGCAATGAGG + Intergenic
1160307182 18:77750836-77750858 TATACAGTGCAGAAGCAATGTGG + Intergenic
1161483308 19:4521613-4521635 ATTCCAGAACAGGAGCAGGGAGG + Intergenic
1161841330 19:6682498-6682520 TTTCTAGAACTGAAGCATGGAGG - Intronic
1162618503 19:11821058-11821080 TTTCCAGAACAGATGAATGGAGG - Intronic
1163053686 19:14703253-14703275 TTTCGAGAACAGCAGCATGGGGG + Intronic
1163422090 19:17219441-17219463 TTCCCAGCACAGGAGCATTGTGG + Intronic
1164113667 19:22195143-22195165 TTTCCACAAAAGGAGAAATGAGG + Intronic
1164844159 19:31417785-31417807 TTTGCTCAACAGAAGGAATGTGG - Intergenic
1164964552 19:32471087-32471109 TTTCAAAAACAGAAGAAATCAGG - Intronic
1165017939 19:32897446-32897468 TTTACAAAACAACAGCAATGAGG + Intronic
1165747800 19:38240647-38240669 TTACCAGCACAGAAGCCAGGAGG + Intergenic
1166268380 19:41699139-41699161 CTAGCAGAACAGAAGCAATTTGG + Intronic
1166417608 19:42607410-42607432 TTAGCAGAACAGAAGCAAAATGG - Intronic
1168701352 19:58441369-58441391 TGTCCAGAACGGAAGCAAGAAGG + Intergenic
925644763 2:6024459-6024481 CTACCAGAGCAGAATCAATGAGG - Intergenic
927007780 2:18867938-18867960 TTTTCAGAAAAGAAAAAATGTGG + Intergenic
927297012 2:21466368-21466390 TTTATAGAACAGGAGCACTGAGG - Intergenic
927382443 2:22494706-22494728 GTTCCAGAACAAAAGCACTGGGG - Intergenic
927689053 2:25194589-25194611 AATCCAGAACAGTTGCAATGTGG - Intergenic
933889194 2:86750843-86750865 TTTCAACAGCAGAAGCAAAGTGG - Intronic
935060385 2:99601921-99601943 TTCCCAGAACAGCAGCAAAATGG - Intronic
935678026 2:105612770-105612792 TTTCCAGAAGAGAATCAAGCTGG - Intergenic
935793844 2:106620186-106620208 TTTCCAGAACAGAAAGCATCAGG - Intergenic
935935595 2:108179215-108179237 TTTACTGAACATTAGCAATGTGG - Intergenic
936050482 2:109218965-109218987 ATCCCAGAACAGAAACAGTGAGG - Intronic
937731788 2:125241332-125241354 TTTCAAGTAGAGAAGCAACGTGG + Intergenic
937998437 2:127713075-127713097 TTTAAGGAACAGAAGAAATGTGG - Intronic
938713247 2:133993518-133993540 GTTACAGAACAGAAGCACAGGGG + Intergenic
939214666 2:139220394-139220416 CTTCCAGAAGAGAAGTAATAAGG + Intergenic
939697241 2:145342021-145342043 TTTCAATAACAGAAGCAATCTGG + Intergenic
940898816 2:159107673-159107695 TTTCCAGAGGATGAGCAATGGGG - Intronic
941403198 2:165057100-165057122 TTTCCAAAACAAAAACAATTTGG + Intergenic
941465881 2:165826457-165826479 TTTCCAGCACTGAAGCTGTGGGG - Intergenic
941759670 2:169227986-169228008 TGTTCAGAAGAGAGGCAATGTGG - Intronic
941802468 2:169675554-169675576 TTTCGAGGACAGTACCAATGGGG + Intronic
942182517 2:173394036-173394058 TTCCCAGAAAAGAAGGAAGGCGG + Intergenic
942523221 2:176826370-176826392 TTTACAGATGAGAAGGAATGGGG + Intergenic
943022890 2:182596809-182596831 TTTAAAAAATAGAAGCAATGAGG + Intergenic
944445256 2:199782493-199782515 TTCCCAGTAGAGAAGCTATGTGG - Intronic
944762064 2:202826457-202826479 TTTACAGTACAGATACAATGAGG + Intronic
944891390 2:204120650-204120672 TCTCCAGAAGAGAAGCAAGAAGG - Intergenic
945641135 2:212431448-212431470 TATCCAGAGTAGAAGCAGTGGGG - Intronic
945855554 2:215065538-215065560 TTGCCAGAAGAAAAGCAAAGAGG + Intronic
946066791 2:216994782-216994804 TTTCCAGAAGAGAGGCAATACGG - Intergenic
947356308 2:229299669-229299691 CTTCTAGAACAACAGCAATGGGG - Intergenic
1170006573 20:11676278-11676300 TTTGCCAAACAGAAGCTATGGGG + Intergenic
1170396628 20:15932561-15932583 TTTCCAAACCAAAAGCAATTTGG + Intronic
1171097364 20:22344415-22344437 TTTCCAAAACAGAAGCTGGGCGG - Intergenic
1172469332 20:35179864-35179886 TATCTTGAACAAAAGCAATGGGG - Intergenic
1172843491 20:37915835-37915857 GTTCCAGAACAGAGGCTCTGAGG - Intronic
1173169682 20:40713821-40713843 TTTCAGAAACAGAAGCACTGGGG - Intergenic
1174804022 20:53591732-53591754 TTTTCAGACAAAAAGCAATGAGG + Intronic
1175985710 20:62763304-62763326 TTTTCAGAGCAGAAGCCCTGGGG - Intergenic
1177364602 21:20117624-20117646 TTTCCTGAGCAGAATCAAGGGGG - Intergenic
1179080179 21:38163471-38163493 TTTCCTGAAGAGTAACAATGAGG + Intronic
1182342975 22:29639337-29639359 TTTCCATTACAGAACCAAAGGGG - Intronic
1183534999 22:38396080-38396102 TTTTCAGACAAAAAGCAATGAGG + Intronic
1185338225 22:50280241-50280263 TCTGCAGAACAGAAGGAAGGTGG - Intronic
952257488 3:31708004-31708026 TTTACAGAAGAGAAACAAAGGGG + Intronic
952927697 3:38333605-38333627 CTTGCAGAACAGAAGTAGTGAGG - Intergenic
954739333 3:52734934-52734956 TCTCCAGAACAGAAACCAAGAGG + Intronic
955225645 3:57058156-57058178 TTTCCATAAAATAAGCCATGTGG + Intronic
955235707 3:57137233-57137255 TGTCTAACACAGAAGCAATGAGG - Intronic
955611884 3:60766265-60766287 TTTTCAGAAAGGCAGCAATGAGG - Intronic
956200280 3:66698428-66698450 TTTACAGAACAGGAGACATGGGG + Intergenic
956768692 3:72506354-72506376 TTTCCAGATCAGAGTCGATGTGG - Intergenic
958730821 3:97958527-97958549 TTACCAGAACAGTAGTAATCAGG - Intronic
958973715 3:100641540-100641562 TTTACAGAACAAGAACAATGAGG + Intronic
959067574 3:101674047-101674069 TTTGCAGAACATAAACAATGGGG + Intronic
959712873 3:109402236-109402258 TTTCCAGAAATGAAGCATTTGGG + Intergenic
962549468 3:136474986-136475008 TATCCTGTACAGAAGCAAGGAGG - Intronic
964437400 3:156668848-156668870 TTTCCTAAACAGAAGCACTCTGG + Intergenic
964712029 3:159681268-159681290 TTTCCAGAAGAGGAGAAATGGGG + Intronic
966249676 3:177849906-177849928 TTTCGGGAACAGAGGCAAGGTGG + Intergenic
966498943 3:180615379-180615401 TTTCCAAAACAGAGGAAATAGGG + Intronic
966510186 3:180753361-180753383 TTTCCAGAACACAAAGAGTGGGG + Intronic
966693961 3:182770220-182770242 TTTCAAAAATAGAAGAAATGGGG - Intergenic
967010101 3:185424650-185424672 TTTCCAAAACAACAGCAATCTGG - Intronic
967067567 3:185933597-185933619 TTTCCATAACAGGATTAATGAGG - Intronic
968529757 4:1085282-1085304 TATTCAGAACAGATGCAATACGG + Intronic
971468047 4:26986693-26986715 GCTCCAGAACAGAACCAAAGAGG - Intronic
973665776 4:53157610-53157632 TTTCCAGAACAAAAAAAATGAGG - Intronic
975715605 4:77202911-77202933 TTACCAGAAAAAAAGCCATGGGG - Intronic
977684134 4:99828473-99828495 TTTAAAGAACAGAACAAATGAGG + Intronic
977718245 4:100208552-100208574 CTTCCAGAAATGAAGCAATTTGG - Intergenic
978300494 4:107264498-107264520 TTGTCACAACAGAAACAATGTGG - Intronic
979266871 4:118713828-118713850 TATTGAGAGCAGAAGCAATGTGG - Exonic
979584907 4:122404188-122404210 TTTCCTGAGCAGAATCCATGGGG - Intronic
979953649 4:126926954-126926976 TTTCCTGAAGAGAAGCCAAGGGG + Intergenic
981408786 4:144403297-144403319 TTTTCTTCACAGAAGCAATGTGG + Intergenic
982710779 4:158756724-158756746 TTTCCAGAACTGAAGGATAGAGG - Intergenic
982869336 4:160556766-160556788 TTTCCAGAACAGCAAAATTGGGG + Intergenic
983861750 4:172716026-172716048 TTTCCACAACTGTAGCAATTTGG + Intronic
984097951 4:175454586-175454608 TTTCAAGAAGATAGGCAATGTGG - Intergenic
984150072 4:176118692-176118714 TTTCCAGGACAGTAGCACAGTGG + Intronic
984493347 4:180464865-180464887 TTTCCACAATAGATGCAATAAGG - Intergenic
986591526 5:9375693-9375715 TTCCCAGAACAGAAGCAACCAGG + Intronic
986671532 5:10146951-10146973 TTTCCAGACCAGCAGCCATGGGG + Intergenic
988276284 5:29084989-29085011 TTTGCAGAACATAGACAATGAGG + Intergenic
989164312 5:38419726-38419748 TTTACAGATAAGAACCAATGGGG + Intronic
990288190 5:54321763-54321785 TTCAGAGAACAGAAGCAATTTGG + Intergenic
991698443 5:69295539-69295561 TTTACAGAACAAGAGCAACGAGG - Intronic
992424492 5:76642482-76642504 TTTCCAAAACAGAGGGCATGAGG + Intronic
992479725 5:77138474-77138496 TTTCCAGAACAGAAGTAAGCAGG + Intergenic
992726613 5:79613623-79613645 TTTCCAGAACAGACATAATTAGG - Intronic
992857207 5:80874417-80874439 ATGCCAAAACAGAAGCAAAGTGG + Intronic
994003595 5:94811061-94811083 TTTCCAGAACAGAGGGATTGGGG - Intronic
994164185 5:96591594-96591616 TTTACAGAACAAGAACAATGAGG + Intronic
994653616 5:102561642-102561664 TTTCCAGAGCTGGAGGAATGAGG - Intergenic
996343245 5:122461365-122461387 TTCCCAGAACTGAAGTACTGAGG - Intronic
997411718 5:133695956-133695978 ATCTCAGAACAGAAGGAATGAGG - Intergenic
997882552 5:137603328-137603350 TTTCCAGAGTAGAAGCATTTAGG - Intergenic
999642533 5:153686338-153686360 TCTGCAGAACAGAAGTAAAGGGG - Intronic
1000583069 5:163057367-163057389 ATGCAAGAGCAGAAGCAATGGGG - Intergenic
1001128373 5:169041719-169041741 TTTGAAGAACAGAAGCAATCTGG + Intronic
1001377272 5:171273091-171273113 TTTCCAGGACAGAATCAATATGG + Intronic
1001641739 5:173249114-173249136 CTTCCTGAACAGCAGCAATCAGG - Intergenic
1002386499 5:178871102-178871124 TTTTGAGCACAGAAGCAATATGG - Intronic
1004577371 6:16910103-16910125 TTCCTAGAGCTGAAGCAATGTGG - Intergenic
1004726708 6:18318010-18318032 TTTACAGAACAAGAACAATGAGG + Intergenic
1005651066 6:27885410-27885432 TTTACAGAACAAGAACAATGAGG + Intergenic
1006096776 6:31661045-31661067 TTCCCAGAAAAGAAAAAATGAGG + Intergenic
1006127855 6:31851642-31851664 ATTACAGAACAAGAGCAATGAGG - Intergenic
1007128197 6:39445361-39445383 TTTCCAGAGAAGAAGCTATTAGG - Intronic
1007530319 6:42536244-42536266 TGTAGAGAACAGAAGCCATGAGG + Intergenic
1008807795 6:55453086-55453108 TCTACAGAGAAGAAGCAATGTGG + Intronic
1008870322 6:56265263-56265285 TGTCCAGAACAGATGCCAAGTGG + Intronic
1009012086 6:57854705-57854727 TTTCCAGAACACAAGTAGGGGGG + Intergenic
1010323071 6:74535990-74536012 TTTCCAGAACATATTCAATGTGG + Intergenic
1010788509 6:80034365-80034387 TTGCCAGAACAGAGACAGTGGGG + Intronic
1011042969 6:83051387-83051409 GTTCCTGAACAGAAAAAATGGGG + Intronic
1011880554 6:92018851-92018873 TTTTGAAAATAGAAGCAATGTGG - Intergenic
1012209767 6:96505541-96505563 TTTCCAGAAGGGCAACAATGTGG + Intergenic
1012355416 6:98308129-98308151 TATCAAGAAAAGAAGCAATTTGG - Intergenic
1013169747 6:107625847-107625869 TTTGCATGACAGAAGAAATGAGG + Intronic
1013970097 6:116007067-116007089 TTTCAAGCAAAGAAGCAATATGG + Intronic
1014587544 6:123218608-123218630 TCTCCAGGACAGAAGCAACAAGG - Intronic
1015069197 6:129069185-129069207 TTTCCATAACAGAATTCATGTGG - Intronic
1015355995 6:132277607-132277629 TCTCCATATAAGAAGCAATGAGG - Intergenic
1015484170 6:133749482-133749504 TCACCATAACAGAAGCAGTGAGG + Intergenic
1017272273 6:152521601-152521623 TTCCCTGATCAGCAGCAATGGGG + Intronic
1018716896 6:166540023-166540045 CTTCATGAAAAGAAGCAATGAGG - Intronic
1020069532 7:5217232-5217254 TTTCCTGAAGAGGAGCACTGTGG + Intronic
1020628950 7:10617328-10617350 TTACCAGAACAGGGGCTATGGGG + Intergenic
1021569706 7:22052454-22052476 TTTCACAAACAGTAGCAATGTGG + Intergenic
1021823341 7:24519775-24519797 TCTCGAGAACAGCAACAATGGGG + Intergenic
1021858941 7:24886404-24886426 TTGCCAGAATAAAATCAATGGGG + Intronic
1022148612 7:27574759-27574781 TTACCAAAACACAAGCAATCTGG + Intronic
1022190749 7:28014808-28014830 TTTCTAGAACAGAAGTAAACAGG + Intronic
1022208800 7:28188243-28188265 TTTCCAGATCTGGACCAATGTGG + Intergenic
1022748175 7:33194135-33194157 TTTTCTGACCAGAAGGAATGTGG + Intronic
1022995789 7:35754163-35754185 TTTACAGGACAGCAGCAGTGGGG + Intergenic
1027933801 7:84576182-84576204 TTTCTAGGACAGGAGCAATTTGG - Intergenic
1028710679 7:93904265-93904287 TTTTCAGCCCAGAAGCAAGGGGG + Intronic
1028904193 7:96134879-96134901 TTTCCAGGAATCAAGCAATGTGG + Intronic
1029329411 7:99839545-99839567 TTCCCACAACAATAGCAATGTGG + Intronic
1030228007 7:107173700-107173722 TTTGCATACCAAAAGCAATGGGG + Intronic
1030268272 7:107643122-107643144 TTTACAGAACACAAACAGTGAGG - Intergenic
1030928988 7:115498635-115498657 TGACCAGAATAGAAGCAATGGGG + Intergenic
1030976924 7:116137966-116137988 TTTCCAAACCAGAAGAAATGCGG + Intronic
1031091451 7:117360133-117360155 ATTCCAGAACAAAATCCATGAGG - Intergenic
1031713488 7:125078085-125078107 TTTCCAGCACAGGTGCACTGTGG + Intergenic
1032022829 7:128419514-128419536 TTGCCAGAGCAGGAGCAATGGGG + Intergenic
1032652671 7:133895592-133895614 TTTCCAGAGCACAATCATTGTGG + Exonic
1034441762 7:151089239-151089261 TTCGCAGGACAGAAGCAATATGG - Intronic
1034799465 7:154044937-154044959 TTGCCAGAACATATGCAATTTGG - Intronic
1034861461 7:154598689-154598711 GTTCCAGAACATAAACAAGGAGG - Intronic
1036606090 8:10307006-10307028 TTAGCAGAAGAGGAGCAATGAGG + Intronic
1036606335 8:10308838-10308860 TTAGCAGAAGAGAAGCAATGAGG - Intronic
1037064150 8:14555371-14555393 TTACCAGAACAGCACCAAAGGGG - Intronic
1037163522 8:15799683-15799705 TTTCTAGAAGAGAAAGAATGAGG - Intergenic
1037487119 8:19358109-19358131 TTTCTAAAACAGCAGCAATAGGG + Intronic
1037544441 8:19904821-19904843 TTTACAGAACAAGAGCAATGAGG + Intronic
1037693914 8:21207463-21207485 TTTCAAAAACAGAAACAAAGGGG - Intergenic
1038045809 8:23764718-23764740 GCTCCAGAAGAGAGGCAATGAGG - Intergenic
1038654125 8:29433053-29433075 TTTCCAAAAAAGATCCAATGAGG - Intergenic
1040828635 8:51652038-51652060 TTTACAATATAGAAGCAATGTGG + Intronic
1040998118 8:53422104-53422126 TTCCCAAAACAGAAGCACTAGGG - Intergenic
1042580645 8:70274902-70274924 TGTCCACAACAGAAACACTGAGG + Intronic
1044146794 8:88725699-88725721 TTTCCATGACATTAGCAATGTGG - Intergenic
1044780532 8:95739183-95739205 TTTCAATAACAGAATCAATCGGG - Intergenic
1047566073 8:126046008-126046030 TTTCCAGATGAGAAGGAATAGGG - Intergenic
1050574971 9:6985336-6985358 TTTCAAGAGCAAAGGCAATGAGG - Intronic
1053030116 9:34768333-34768355 TTTCCAGAAAAGAAGGACTCTGG - Intergenic
1053132665 9:35626580-35626602 TTTCGTGAAAAGAATCAATGTGG + Intronic
1054756339 9:68962062-68962084 TTTTTAGAAAAGAAGCAAAGTGG + Intronic
1056105677 9:83344027-83344049 TTTCCAGAAAAATAGCAAGGTGG + Intronic
1056713413 9:89009693-89009715 TTTCCAGGGCAGAGGCAATGCGG - Intergenic
1058311133 9:103504266-103504288 TTTCCAGCTTGGAAGCAATGGGG + Intergenic
1060964398 9:127704660-127704682 TTTACAGAACGGGAACAATGGGG - Intronic
1061824653 9:133250561-133250583 CTTTCTGGACAGAAGCAATGTGG - Intronic
1061826372 9:133260803-133260825 TTTCCAGAACATAAGGTAGGAGG - Intronic
1185992945 X:4912396-4912418 TCTCCAGAACAGCAGCATGGGGG - Intergenic
1186027504 X:5328888-5328910 TTTACAGAACAAAAGCAATGAGG - Intergenic
1186285883 X:8043711-8043733 TTTTCAGAGCAGATGTAATGGGG + Intergenic
1187259274 X:17670174-17670196 TTTCCAGAACAAAAGCCACTGGG - Intronic
1188519859 X:31026288-31026310 TGTCTAGAACAGAAGACATGTGG - Intergenic
1189027113 X:37407266-37407288 TTTACAAAACAATAGCAATGAGG + Intronic
1189257843 X:39654251-39654273 TCACCAGAAAATAAGCAATGGGG + Intergenic
1189381745 X:40507056-40507078 TTTCCAGAACAGCAACAATGTGG - Intergenic
1190258534 X:48783207-48783229 TCTCCAGAAATGAAGAAATGGGG + Intergenic
1190487758 X:50945386-50945408 TATCCAAAACTGAAGCAATTTGG - Intergenic
1190529268 X:51358806-51358828 TTTACAGAACAATAACAATGAGG + Intergenic
1192640169 X:72854573-72854595 TTTGCAGACCAGAAGCAAGTAGG + Intergenic
1192641542 X:72866232-72866254 TTTGCAGACCAGAAGCAAGTAGG - Intergenic
1194399032 X:93420427-93420449 TTTCCAGGACAGAACCAAATTGG - Intergenic
1194789731 X:98132305-98132327 TCTGAAGAAAAGAAGCAATGGGG + Intergenic
1195507473 X:105674433-105674455 TTTCACCAAAAGAAGCAATGGGG - Intronic
1195526923 X:105901890-105901912 TTTCCAAAACAGAAATAATCAGG - Intronic
1198044299 X:132885075-132885097 TATCCACAACAGAAAAAATGTGG + Intronic
1199507116 X:148576073-148576095 TTACCAAAACAGAAGCAGGGAGG - Intronic
1199534261 X:148884483-148884505 TTTCCAGAAGAGAAGCCAGAAGG - Intronic
1200344424 X:155434822-155434844 TTTTCAAAAGAAAAGCAATGAGG + Intergenic
1200387601 X:155908670-155908692 TTTCCAAAATAGAAGAAAAGGGG - Intronic
1200710562 Y:6481222-6481244 GTTCCACAACAGAATCAAAGTGG - Intergenic
1201023373 Y:9680765-9680787 GTTCCACAACAGAATCAAAGTGG + Intergenic
1201768877 Y:17598477-17598499 TTTCCTCAACTGAAGCAAAGGGG - Intergenic
1201832677 Y:18307508-18307530 TTTCCTCAACTGAAGCAAAGGGG + Intergenic