ID: 1108317703

View in Genome Browser
Species Human (GRCh38)
Location 13:49253912-49253934
Sequence ACAGAAGCAATGTGGCATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108317696_1108317703 30 Left 1108317696 13:49253859-49253881 CCATTGTGTCTTCTGGTACCTTA 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1108317703 13:49253912-49253934 ACAGAAGCAATGTGGCATAATGG 0: 1
1: 0
2: 2
3: 31
4: 295
1108317699_1108317703 -2 Left 1108317699 13:49253891-49253913 CCCTCACTGTACTTTTCCAGAAC 0: 1
1: 0
2: 3
3: 22
4: 231
Right 1108317703 13:49253912-49253934 ACAGAAGCAATGTGGCATAATGG 0: 1
1: 0
2: 2
3: 31
4: 295
1108317698_1108317703 12 Left 1108317698 13:49253877-49253899 CCTTATGCTAAAGGCCCTCACTG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1108317703 13:49253912-49253934 ACAGAAGCAATGTGGCATAATGG 0: 1
1: 0
2: 2
3: 31
4: 295
1108317700_1108317703 -3 Left 1108317700 13:49253892-49253914 CCTCACTGTACTTTTCCAGAACA 0: 1
1: 1
2: 0
3: 22
4: 207
Right 1108317703 13:49253912-49253934 ACAGAAGCAATGTGGCATAATGG 0: 1
1: 0
2: 2
3: 31
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108317703 Original CRISPR ACAGAAGCAATGTGGCATAA TGG Intronic
901095221 1:6673348-6673370 CCAAAAGCTAGGTGGCATAATGG + Intronic
902136931 1:14315204-14315226 ACAGAAGAAATGTTCCTTAAGGG + Intergenic
902949307 1:19869380-19869402 ACAGTGGCAATGAGGCATAGAGG - Intergenic
903076629 1:20773918-20773940 ACAGATGCAATATGGTATAGTGG + Intronic
903406939 1:23105197-23105219 ACAGTAGCAATGGGGTAAAAGGG + Intronic
904712346 1:32439817-32439839 CCAGAAGCAATTTGGCATGCAGG - Intergenic
904789023 1:33004210-33004232 AAAAATGCAATGTGGTATAAAGG + Intergenic
904823532 1:33259881-33259903 ACAGAAGCCATGTGACACAATGG - Intronic
906754028 1:48291883-48291905 AAAGAAGCAATGGGGGAAAATGG - Intergenic
906888283 1:49676863-49676885 TAAGAAGCAATGTTACATAATGG - Intronic
907355370 1:53868284-53868306 TGAGAGGCAATGTGGAATAATGG + Intronic
907424010 1:54367355-54367377 ACAGAGACAATGGGGCATCAGGG - Intronic
907738363 1:57138771-57138793 GGAGATGCAATTTGGCATAAAGG - Intronic
908119113 1:60968960-60968982 TCAGAAGACATGTGACATAAGGG + Intronic
908405790 1:63812954-63812976 TCAGAAGCAATGGGGCATGATGG - Intronic
908484526 1:64577480-64577502 AGAGAAGCAATGTTGAGTAAAGG + Intronic
908918788 1:69165153-69165175 AAAAGAGCAATTTGGCATAATGG - Intergenic
909203675 1:72725719-72725741 GCAGAAGCAATGTGGCTTTAGGG - Intergenic
909287246 1:73836024-73836046 CCAGGAGCAATGTGGGATTAAGG + Intergenic
909780105 1:79534125-79534147 ACTAAAGCAATGTGGCATAGAGG + Intergenic
909821729 1:80071980-80072002 ACAGAAGCCATGTGTGATATAGG + Intergenic
909872585 1:80761587-80761609 AGAGAAGCAAGATGGCATAGGGG - Intergenic
910314539 1:85867358-85867380 ACAGAAGCACTGTGGTTTATGGG + Intronic
910766160 1:90784476-90784498 AAAGAAGCAGTGTGGGATAGTGG + Intergenic
911552668 1:99303247-99303269 ACAGGAGGAATGAGACATAATGG + Intronic
914321370 1:146565091-146565113 ACATGAGCAATGTAGCATATGGG + Intergenic
915056430 1:153135276-153135298 ACAAAACCTATGTGGCATATAGG + Intergenic
916432554 1:164745132-164745154 GGAGAGGCAATGTGGCATAGCGG - Intronic
916870241 1:168906099-168906121 ATAGAAACTATGTAGCATAAAGG + Intergenic
916984880 1:170180413-170180435 ACATAAACAATGAGGGATAATGG + Intergenic
917630716 1:176888754-176888776 GGAGAAGCAATGTGGCACACAGG + Intronic
919874073 1:201848653-201848675 CCAGAAGCTATGTGATATAATGG + Intronic
920118797 1:203639935-203639957 TCAGAGGCAATGTGGTATAAAGG + Intronic
921837352 1:219791960-219791982 ACAGAGGGAATGTGGCATGCTGG + Intronic
922448140 1:225714924-225714946 ACAGAAGGAAATTGGCATCATGG - Intergenic
923234912 1:232022995-232023017 AAACAAACAATGTAGCATAAGGG - Intronic
923990728 1:239434213-239434235 ACAGAAGTTATCAGGCATAAGGG - Intronic
924143449 1:241049713-241049735 AAAGATGGAATTTGGCATAATGG + Intronic
924832541 1:247613516-247613538 ACAAAAGCAATGTGACATGGGGG + Intergenic
1062888256 10:1035949-1035971 ACACAAGCAATGTAGCCTTATGG + Intergenic
1063860619 10:10303795-10303817 CCAGAATCATTGTGGCATCAGGG + Intergenic
1066528557 10:36309919-36309941 AAAAAAGCAATGTGGGAAAAGGG + Intergenic
1067370063 10:45674308-45674330 CTGGAAGCAATGTGGAATAATGG - Intergenic
1067742382 10:48905433-48905455 ACAGAAGCAAGGTGGTACACAGG - Intronic
1068480450 10:57582881-57582903 AAAGAAACAGTGTGACATAAGGG - Intergenic
1068764296 10:60746068-60746090 TCAGAAACAATGTAGCAAAATGG + Intergenic
1068895501 10:62195487-62195509 ACAGAAGGAAAGTGGGAAAAGGG + Exonic
1074263701 10:111879943-111879965 ACAGATTCCAGGTGGCATAATGG - Intergenic
1075529250 10:123213705-123213727 AACAAAGCAATGTGGCAAAATGG - Intergenic
1075582843 10:123635040-123635062 TCAAAAGCAAGGTGGCAGAAAGG - Intergenic
1078270162 11:9787792-9787814 ACAGAAGCAGTGTGGCTTTGGGG - Intronic
1079860554 11:25664947-25664969 AGAGAAGCCATGTGGCACAGAGG - Intergenic
1080588808 11:33703810-33703832 ACTGAAGAAATGTGACATGAGGG + Intronic
1081038615 11:38181830-38181852 ACAGAGGCAATTTGGCTCAAAGG - Intergenic
1082724654 11:56720292-56720314 CCAGAAGTAATGTGGAATAATGG + Intergenic
1084348135 11:68571706-68571728 TCTGAAGCATGGTGGCATAAGGG + Intronic
1084442943 11:69186235-69186257 ACAGAAGCGATGTGAAATTAAGG - Intergenic
1085851604 11:80126634-80126656 AAAGAAGCAGTGTGGTAGAAAGG - Intergenic
1086614242 11:88795778-88795800 ACATTAGCAATATGGCAAAATGG - Intronic
1088233297 11:107696216-107696238 ACAGAGGCAATAGGGCATAGTGG - Intergenic
1088985939 11:114908397-114908419 AGAGAAGCAATGAGTAATAAGGG + Intergenic
1089342740 11:117770429-117770451 ACAGAAGCAACTCGGCATTATGG + Intronic
1090315728 11:125786295-125786317 ATAGAGGTAGTGTGGCATAATGG - Intergenic
1093790502 12:23244575-23244597 AAAGAAGCAATGTAGCACACTGG - Intergenic
1094229786 12:28089964-28089986 AGAAAGGCAGTGTGGCATAAGGG - Intergenic
1097397415 12:59092508-59092530 CCAAAAGCAATGTGGCATTGAGG + Intergenic
1097648754 12:62268585-62268607 ACAACAGAAATGGGGCATAAAGG - Intronic
1097952865 12:65452026-65452048 TAAGATGCAATGTAGCATAAAGG + Intronic
1098355297 12:69607019-69607041 CCAGAAGCAATGTAGCATAGCGG - Intergenic
1099906716 12:88779793-88779815 ACAGAAGCAATGAGAGAAAAAGG + Intergenic
1101316243 12:103631895-103631917 ACAGAAGCAATGTGGTGTCAAGG + Intronic
1101359324 12:104011150-104011172 ACTGGAGAAATGTGGCAGAAAGG + Intronic
1103253038 12:119517332-119517354 TGAGAAGCAGTGTGGCAGAATGG - Intronic
1105412158 13:20179404-20179426 TCAGAAGAGATGTGGCTTAAGGG + Intergenic
1106543289 13:30709495-30709517 AGAGAAGAAAATTGGCATAAAGG - Intergenic
1106883279 13:34155266-34155288 AGGGAAGCAATGTGGTATAAAGG + Intergenic
1107571640 13:41666368-41666390 ACAGAAGCAATGAGAGAAAAGGG - Intronic
1107580151 13:41774933-41774955 AGAGTGGCAATGTGGCATCATGG - Intronic
1108317703 13:49253912-49253934 ACAGAAGCAATGTGGCATAATGG + Intronic
1108983910 13:56558167-56558189 AAAGAAGCATTCTGGGATAATGG + Intergenic
1110840546 13:80137096-80137118 ACAGAAGCAATGTGATCAAATGG - Intergenic
1111622790 13:90746100-90746122 ACAAAAGCAATAAGACATAAAGG - Intergenic
1112729647 13:102346470-102346492 TGAGAAGCAATGTGACATAGTGG - Intronic
1112894838 13:104286149-104286171 GGAGAAGCAAAGTGGAATAAAGG + Intergenic
1114915523 14:27259593-27259615 ACAGAAGCAAAGTGAAACAAAGG - Intergenic
1115269809 14:31539367-31539389 ACAGAAGCTGTGTGGCACAGAGG - Intronic
1115773528 14:36690502-36690524 CAAGAAGCAATATGACATAATGG - Intronic
1117203284 14:53414328-53414350 ACTGATGCAGTGTGGCATAGTGG - Intergenic
1117390832 14:55260909-55260931 ACAGGAGCAATGGGGCATTAAGG + Intergenic
1118671973 14:68138328-68138350 ACAAAAGCAATGTAACAAAACGG - Intronic
1119054986 14:71410079-71410101 AAAGAAGCAGTTTGGCACAAAGG - Intronic
1119145992 14:72314663-72314685 AGAAGAGCAATGTGGCAGAATGG - Intronic
1119294659 14:73523105-73523127 ATAGAAGCAATGGGGGAGAAAGG + Exonic
1119566341 14:75632319-75632341 TCATAAGCAATGTTGCCTAAAGG - Intronic
1121830718 14:97049733-97049755 GGAGAAGCAATGTAGGATAATGG + Intergenic
1123473552 15:20571573-20571595 ACAGAAGAAATGGGGCAGAGAGG - Intergenic
1123644457 15:22428780-22428802 ACAGAAGAAATGGGGCAGAGAGG + Intergenic
1123665773 15:22608688-22608710 ACAGAAGAAATGGGGCAGAGAGG + Intergenic
1123733850 15:23166584-23166606 ACAGAAGAAATGGGGCAGAGAGG - Intergenic
1123751987 15:23363965-23363987 ACAGAAGAAATGGGGCAGAGAGG - Intronic
1124401736 15:29354391-29354413 ACAGAACCAATGGGGTATACAGG - Intronic
1124455929 15:29842875-29842897 ACGCAAGCAAAGTTGCATAATGG + Intronic
1124482916 15:30092329-30092351 ACAGAAGAAATGGGGCAGAGAGG - Intronic
1124489369 15:30144400-30144422 ACAGAAGAAATGGGGCAGAGAGG - Intronic
1124520660 15:30404889-30404911 ACAGAAGAAATGGGGCAGAGAGG + Intronic
1124537997 15:30561330-30561352 ACAGAAGAAATGGGGCAGAGAGG - Intronic
1124544457 15:30613391-30613413 ACAGAAGAAATGGGGCAGAGAGG - Intronic
1124754160 15:32393927-32393949 ACAGAAGAAATGGGGCAGAGAGG + Intronic
1124760652 15:32446255-32446277 ACAGAAGAAATGGGGCAGAGAGG + Intronic
1124777979 15:32602807-32602829 ACAGAAGAAATGGGGCAGAGAGG - Intronic
1125406086 15:39353743-39353765 AAAGAAGCAATGTGGTCTATTGG - Intergenic
1126917937 15:53486736-53486758 ACATCATCAATGTAGCATAAAGG - Intergenic
1127722096 15:61712920-61712942 AGGGAGGCAATGTAGCATAATGG - Intergenic
1128158228 15:65405422-65405444 ACAGAAGCACTGTGACATGCTGG + Intronic
1128893434 15:71351425-71351447 ACAGAAGCAATGTTGGTTAAGGG - Intronic
1129594903 15:76955212-76955234 GCAGAAGGAAGGTGGCATCAAGG - Intergenic
1129937431 15:79462559-79462581 AAAGAAGCAGTGTAGCATCAGGG + Intronic
1133884045 16:9809587-9809609 TGAGAAGCAATATAGCATAATGG + Intronic
1134346893 16:13399564-13399586 CCAGGAGCAATGTGGCAGCATGG - Intergenic
1135240500 16:20803051-20803073 ACCAAAGCAGTGTGACATAAAGG + Intronic
1135711741 16:24723099-24723121 ACAGGATGAGTGTGGCATAATGG - Intergenic
1136277661 16:29188418-29188440 ACAGAAGCAATGGGGCAGACCGG - Intergenic
1138046749 16:53732873-53732895 AAAGAAGGAATCTGGCATCAGGG + Intronic
1139012706 16:62652391-62652413 ACCAAAGCAATCTGGCTTAATGG - Intergenic
1139062098 16:63264315-63264337 AAAGAAGCAATGTGGCCCCACGG - Intergenic
1140391178 16:74588339-74588361 AGAGAAGCAATGTGGTAACATGG + Intronic
1142082036 16:88154460-88154482 ACAGAAGCAATGGGGCAGACCGG - Intergenic
1143321056 17:6069505-6069527 ACAGAAGCAATGTCACACACTGG - Intronic
1144551064 17:16241158-16241180 ACAAAAGAAATTTGGGATAATGG + Intronic
1144823097 17:18089113-18089135 ACAGAAGGAATGAGTCATAGAGG - Intronic
1146958576 17:36952788-36952810 ACTTAAGCACTGTGGCATCAGGG - Intronic
1148878923 17:50710340-50710362 ATAGAAACAATGTGGCATAGTGG + Intergenic
1149305116 17:55339936-55339958 CCAGTAGCAATGTGGCAGAGGGG + Intergenic
1149680639 17:58504730-58504752 CCAGAAGGAATGTGGCAGGAGGG - Intronic
1152510494 17:80783777-80783799 ACAGAAGCAAGCTAGCAAAAAGG - Intronic
1155015359 18:21833152-21833174 TGAGGAGCAATGTGGCATAGTGG - Intronic
1155042213 18:22074284-22074306 ACAGAAGTAGTGTAGAATAAAGG + Intergenic
1156332608 18:36138230-36138252 ACAGAAGCATTGTGAAAAAAAGG - Intronic
1156523099 18:37738569-37738591 TCAGAGGCAATGTGGTATAAAGG - Intergenic
1156617324 18:38802679-38802701 ATAGAAGCAAAATGGCAGAACGG + Intergenic
1157367900 18:47083199-47083221 ACATCAGCAATGTGTCACAAGGG - Intronic
1157809604 18:50685225-50685247 ACAGAAGCAAAGTGGAAGAAAGG + Intronic
1159882794 18:73875370-73875392 ACAGAATTAATGAGGCAAAATGG + Intergenic
1160293614 18:77617713-77617735 AAAGCAGCAATTTGGGATAATGG + Intergenic
1162378175 19:10317128-10317150 ACAGGAGCAATGAGGCAGGAGGG + Exonic
1163024473 19:14502372-14502394 ATAGACGCAATATGTCATAATGG + Intergenic
1164737366 19:30551748-30551770 ACAGAAGAAATGGGGCCAAATGG - Intronic
1165189256 19:34048722-34048744 ATAGAAGAAATGAGGCTTAATGG - Intergenic
926200253 2:10790514-10790536 CCAGAAGCAGTGTGACATTAGGG + Intronic
928606725 2:32949876-32949898 ACAGAAGGGTTTTGGCATAATGG + Intronic
928960007 2:36914697-36914719 ACAGAAGCAACATGGTAAAATGG + Intronic
929050473 2:37832235-37832257 TGAAAGGCAATGTGGCATAATGG + Intergenic
930145497 2:47998783-47998805 AGGGAAGCACTTTGGCATAACGG - Intergenic
930554711 2:52881065-52881087 ATAGAAGCAATGTGATCTAAAGG + Intergenic
931378797 2:61732839-61732861 ACTGGAACAATGTGACATAATGG - Intergenic
932310200 2:70733699-70733721 TCAGAGGCAATGAGGCAGAAGGG + Intronic
935578990 2:104739412-104739434 ACAAAAGAAATGAGGAATAAAGG + Intergenic
937500217 2:122470365-122470387 GCAGAAGAGATGTGGCAGAAGGG - Intergenic
938655316 2:133425506-133425528 ACAGATGCCCTGTGGCAAAAGGG + Intronic
938874790 2:135521204-135521226 GGAGAGGCAATGTTGCATAATGG - Intronic
939988976 2:148859603-148859625 ACAGAAGAAATGTAGAAAAAAGG - Intergenic
941128299 2:161614083-161614105 AAGGATGCAATGTGGGATAAAGG - Intronic
942621399 2:177847770-177847792 GCACAAGCAATATGGCATTAGGG - Intronic
942646903 2:178121982-178122004 ATGGAGGCATTGTGGCATAATGG + Intronic
943958671 2:194229848-194229870 ACAGAAGCAAAGGGGCATTGGGG + Intergenic
944985145 2:205167711-205167733 GTAGAAGCAACGTAGCATAAAGG + Intronic
945426887 2:209716981-209717003 ATAGAAGAAAGGTGTCATAAGGG + Intronic
947162244 2:227226323-227226345 ACAGAAGCACAGTGGGAGAAGGG + Intronic
1169354953 20:4898270-4898292 AAAGAAGCTATGTGGACTAAAGG - Intronic
1171050101 20:21849806-21849828 ACAGAAAGCATGTGGCATGAGGG + Intergenic
1172469331 20:35179856-35179878 ACAAAAGCAATGGGGTAGAAAGG - Intergenic
1175460902 20:59151246-59151268 ACAGAAGCCATGTGGCTTGCTGG - Intergenic
1177211679 21:18078953-18078975 AAAGAAGCCATGTAGCATAGTGG - Intronic
1177930160 21:27271597-27271619 TGAGAATCACTGTGGCATAAAGG - Intergenic
1179092789 21:38282969-38282991 AAAGAAGAAATATGGAATAAAGG + Intronic
1179565097 21:42242661-42242683 ACAGAATGAATGTGCCCTAATGG - Intronic
1181666767 22:24403991-24404013 ACAGGAGCAATGGCGAATAAAGG - Intronic
1182185362 22:28396051-28396073 AGGGGAGCAATGTGGAATAATGG - Intronic
1184582016 22:45424334-45424356 AGAGAGGCATTGTGGCATCAGGG + Intronic
1184916631 22:47573958-47573980 TCAGAAGGAGTGTGGCATCAAGG - Intergenic
949164945 3:928430-928452 CTAGAAGCACTGTGGTATAATGG + Intergenic
949735715 3:7169482-7169504 ACAGAAGGGATGTGGGATAGTGG + Intronic
950037443 3:9897175-9897197 AGAAAGGCAATGTGGTATAATGG + Intergenic
950763596 3:15256805-15256827 ACAGAGGCAGTGTGGCATCTGGG + Intronic
953668817 3:44945496-44945518 AAAGAATTAATGTGGCCTAATGG - Intronic
955160511 3:56460976-56460998 AAAAAAGCAAGATGGCATAAAGG + Intronic
955494286 3:59515360-59515382 TAAGAAGCAATGTGGCATCGTGG + Intergenic
956108501 3:65846805-65846827 ACAGAGGCAATGTGGTATAATGG - Intronic
956306620 3:67833336-67833358 ACAGTAGAAATATGGTATAAAGG + Intergenic
956780220 3:72597640-72597662 ACAGAAGCCCTGGGGCATGAAGG + Intergenic
959402823 3:105923437-105923459 TCAGAAGCTATGTTGCATACTGG + Intergenic
959752382 3:109853985-109854007 ACAAAATGAATGTGGCACAATGG + Intergenic
959928867 3:111956425-111956447 ACATCAGTAATGTGGCCTAAGGG - Intronic
960430006 3:117557656-117557678 ATAGAGGCAATGTTGCATGATGG + Intergenic
960464678 3:117982808-117982830 ATAGAAGCAGTGTAGCATAGTGG + Intergenic
962452010 3:135527716-135527738 TGAGTAGCAATGTGGCATAGTGG + Intergenic
962953452 3:140242743-140242765 ACAGAGGCAATGGGGCCTGACGG + Intronic
963377690 3:144491105-144491127 ACAACAGCAATATAGCATAATGG - Intergenic
963738053 3:149043696-149043718 ACAGAAGAAATATAGCCTAACGG + Intronic
964734411 3:159901568-159901590 AAAGAAGCAGTGTGGCATGGTGG - Intergenic
966171059 3:177080882-177080904 ACATAAGCAATGAAGTATAAAGG - Intronic
968317226 3:197735441-197735463 AGAGCAGGAATGTGGCTTAAGGG - Intronic
969797724 4:9539154-9539176 ACAGAAGCAGAGTAGCATGATGG - Intergenic
970932504 4:21529022-21529044 ACAGAAGCAATATGGAGGAAGGG - Intronic
970942932 4:21656649-21656671 AACAAAGCTATGTGGCATAAAGG - Intronic
970955644 4:21807856-21807878 ACAGAAGCAATATTGAAGAAAGG - Intronic
971485974 4:27160637-27160659 ACAGAATAAATGTGGAATAAAGG - Intergenic
971965512 4:33550465-33550487 ACAGAGGCAATATGGAATATGGG - Intergenic
972163609 4:36255717-36255739 ACAGAAGCCATGTGGAGTGAAGG - Intergenic
972336724 4:38113526-38113548 GCAGGAGTCATGTGGCATAAAGG - Intronic
972452903 4:39221365-39221387 CCAAAAGCACTGTGGCATAGTGG - Intronic
974927131 4:68313354-68313376 ACAGTAGCAATGTAGAATATGGG + Exonic
975883013 4:78933176-78933198 ACAGAACCAACCTGGTATAAAGG - Intronic
975963850 4:79945110-79945132 ATATAAGAAATGTGGCAGAAAGG - Intronic
976329865 4:83818093-83818115 TGAGAAGCAATATTGCATAACGG - Intergenic
976687191 4:87827090-87827112 GGAGAAGCACTGTGGCATATCGG + Intronic
977714204 4:100162969-100162991 GCAGAAGCAAAGTGGCATTTGGG - Intergenic
978842782 4:113234076-113234098 ATAGAAGCACTCTAGCATAAAGG - Intronic
979657676 4:123215601-123215623 TAAGAGGCATTGTGGCATAAGGG - Intronic
979830156 4:125289703-125289725 ACATAATCAATGGAGCATAATGG - Intergenic
980817588 4:137968122-137968144 ACAGAGCCAATGTGCCATCATGG + Intergenic
981278941 4:142935310-142935332 ACAAAAGCACTGTGAGATAACGG - Intergenic
981408788 4:144403305-144403327 ACAGAAGCAATGTGGGTTAAAGG + Intergenic
982247988 4:153373955-153373977 AGAGAAGCAATATGGCTTCATGG + Intronic
986380674 5:7182499-7182521 TGAGAAGCAATGTGGAATAATGG - Intergenic
986611773 5:9575581-9575603 ACATAAGCACTGTGGGAGAATGG - Intergenic
988809773 5:34772973-34772995 TCAGCAGCAATGTAGCAAAATGG - Intronic
988920350 5:35935680-35935702 TCAGAAGCAAGTTGGAATAATGG - Intronic
989074845 5:37553317-37553339 AGAGAAGGAATGTGGTATAACGG - Intronic
989511087 5:42288451-42288473 GCAGCAGCAATGTGGAAGAATGG + Intergenic
989534151 5:42544496-42544518 ACAGAAGCAATGTTGCTACATGG - Intronic
992409823 5:76494300-76494322 ATAAAAGAAATGTGGCAAAAGGG + Intronic
993199195 5:84790758-84790780 ACAGAAGAAATGGAGGATAATGG - Intergenic
993811905 5:92490425-92490447 AAAGCAGAAATGTGACATAATGG - Intergenic
993856656 5:93084573-93084595 ATAGAAGGAATGTGAGATAATGG - Intergenic
995840428 5:116438627-116438649 TCAGTAGCAATGTGGAATGAGGG + Intergenic
996360408 5:122638963-122638985 ACAGAAGCAGTGGCACATAAGGG - Intergenic
997799292 5:136843755-136843777 ACAGAAGAAATCAGGCACAATGG + Intergenic
998270215 5:140699795-140699817 AGTGAAGCACTGTGGCATACCGG - Intronic
1000131037 5:158299915-158299937 TGATAAGCAATGTGGCATAGAGG - Intergenic
1004371864 6:15059773-15059795 CAAGAAGCAGTGTAGCATAAAGG - Intergenic
1006353598 6:33540190-33540212 ACAGTAAAAATATGGCATAAAGG + Intergenic
1006727331 6:36209271-36209293 ACAGAGTTAGTGTGGCATAATGG + Intronic
1007060435 6:38935244-38935266 ACAGAAGCAGTGTGGGAACAGGG + Intronic
1007540387 6:42637477-42637499 AAAGAAGCACTATGGTATAACGG - Intronic
1008052717 6:46916175-46916197 AAAGAGGCAATATGCCATAAAGG - Intronic
1008373174 6:50759861-50759883 ACAGAAGGAATGTGACTTTAGGG + Intronic
1008423296 6:51328159-51328181 ATTTAAGAAATGTGGCATAAAGG + Intergenic
1010385822 6:75278490-75278512 ACGGTAGCAATGTGGAAGAAGGG - Intronic
1011354563 6:86460875-86460897 ACAGAAGCAAAGTGGAATGGAGG + Intergenic
1012035061 6:94125519-94125541 ATATAAGCAATGTGGAATAAAGG + Intergenic
1012682869 6:102204883-102204905 ATGGAAGCAATGTGGCATCCAGG - Intergenic
1013216318 6:108030717-108030739 AAAGAAACAATTTGCCATAAAGG - Intergenic
1013978962 6:116107415-116107437 ATAAAAGCAAAGTGGTATAATGG - Intronic
1014737935 6:125116793-125116815 TTGGAGGCAATGTGGCATAATGG + Intergenic
1015361246 6:132341739-132341761 AAATAAGCAAAGTTGCATAAGGG - Intronic
1015918638 6:138244548-138244570 ACAGAAGCAGAGTGGGAAAAAGG - Intronic
1016888429 6:148981390-148981412 AAAGAAGCAGTTTGGCATAGTGG - Intronic
1017936441 6:159009816-159009838 ACAGAAGCAAAGGGGAATGAAGG - Intergenic
1020209855 7:6150676-6150698 AAAGAAAAAATGTGGCATACAGG + Intronic
1021914147 7:25414793-25414815 ACAGAAGCAGTGTTGAATAGTGG - Intergenic
1022491224 7:30820323-30820345 AAAGAAAAAATGTGGCAAAAGGG - Intronic
1022574092 7:31481082-31481104 ACAGAAGGAATGGGGCAAACAGG - Intergenic
1022778769 7:33556611-33556633 TCAGAGGCCAGGTGGCATAATGG + Intronic
1023828236 7:44024163-44024185 CCAGAAACAATGTGGCATGATGG + Intergenic
1024422044 7:49179711-49179733 ACAAAAGCAATGTTGCCTGAGGG - Intergenic
1024682379 7:51706147-51706169 TCAGAAGCAATGAGGGAAAAGGG - Intergenic
1028194156 7:87886038-87886060 ACAGAAGAAATGAGTCAGAAAGG + Intronic
1029756538 7:102577609-102577631 CCAGAAACAATGTGGCATGATGG + Intronic
1029774480 7:102676678-102676700 CCAGAAACAATGTGGCATGATGG + Intergenic
1031255290 7:119439673-119439695 ATAGAAGTTATGTGGCTTAAGGG - Intergenic
1031374364 7:121006120-121006142 ACAGAGGCAATATAGCAGAAAGG - Intronic
1032292878 7:130605469-130605491 GCAGAAGAAATGTGGCAGAAAGG + Intronic
1033651794 7:143349589-143349611 ACAGAAGCATTAAGGCACAAAGG - Intronic
1034029959 7:147750585-147750607 CCTGAAGCAATCTGGCATCATGG - Intronic
1034030459 7:147757103-147757125 ACACAAGCAAGGGGACATAAGGG + Intronic
1034593953 7:152170226-152170248 ACAGAAGCCATTTGATATAATGG - Intronic
1035101778 7:156403571-156403593 AGAGAGGCAATGTTGTATAACGG - Intergenic
1036285966 8:7444429-7444451 ATAGGAACCATGTGGCATAAGGG + Intronic
1036335507 8:7867100-7867122 ATAGGAACCATGTGGCATAAGGG - Intronic
1037211642 8:16395693-16395715 AGAGAGGCAATATGGCATACAGG - Intronic
1038040429 8:23719724-23719746 AGAGAACAAATGTGGCAAAATGG + Intergenic
1038611862 8:29065972-29065994 ACAGAAGCAAGCTGTCATGATGG - Intergenic
1039177519 8:34826211-34826233 ACAGAAGCAAAGTGGCAGTAGGG + Intergenic
1039352822 8:36781274-36781296 ACAGAGGCATTGTGCTATAAGGG + Intergenic
1039696231 8:39915207-39915229 AGAGAGGCAGTGTGGAATAATGG - Intronic
1040835784 8:51730199-51730221 ACAGGAGCAAGATGGCATATGGG + Intronic
1040860634 8:51995247-51995269 ACAGAGGCAAGGTAGTATAATGG + Intergenic
1041841494 8:62277529-62277551 ACACAAGCTATGTTGTATAAAGG - Intronic
1042758795 8:72249028-72249050 AAAGTAGCAATGTGGCCAAAAGG + Intergenic
1043584064 8:81747240-81747262 AGAAAAGCAATTTGGTATAAAGG - Intronic
1044176628 8:89132803-89132825 AGAGAAGCAATATGACATAGGGG - Intergenic
1047345749 8:124026757-124026779 TGAGAAGCAGTGTGGGATAATGG + Intronic
1048190426 8:132283043-132283065 ACAGAGGGAATGAGGCAGAAAGG + Intronic
1048704139 8:137131449-137131471 AGAGAAGCAATGCAGCATCACGG + Intergenic
1048863915 8:138745101-138745123 ATAGAAGCATTGTGGCAACAGGG - Intronic
1050299052 9:4238207-4238229 ACCGAAACAATGTGGCTAAAAGG + Intronic
1051844553 9:21436885-21436907 ACAGAAGCAAAATGGTAGAAGGG - Intronic
1052495622 9:29219790-29219812 TTAAAAGCAATGTGGCATAATGG - Intergenic
1054878993 9:70125458-70125480 ACAGAAACCATGTGGCAGAATGG - Intronic
1055172583 9:73277240-73277262 ACAGAAAGCATGTGGCAGAAAGG + Intergenic
1055487496 9:76771480-76771502 ACTGCAGCAATGTGACATGAAGG + Intronic
1056263529 9:84873437-84873459 ACAGCAGCAATGTGCCATGAAGG - Intronic
1058332575 9:103781905-103781927 TCAGAAGAGATGTGGCATAAGGG - Intergenic
1059279947 9:113124405-113124427 ACAGAGGCAGTGGGGCATCAAGG + Intergenic
1059571915 9:115446766-115446788 ACAGAAGGAATTTGTCATCACGG - Intergenic
1059805930 9:117800343-117800365 ACAGAAGGCATGAGGCATAGTGG + Intergenic
1059980520 9:119766679-119766701 TCAGAAGCAGTGTGGCATTGGGG - Intergenic
1062136350 9:134930379-134930401 AGAGAAGGAGTGTGGGATAAAGG - Intergenic
1186038972 X:5455619-5455641 ACAGGACCCATGTGGAATAAGGG - Intergenic
1186752855 X:12639867-12639889 ACAGAAGCCAAGTGGGACAATGG + Intronic
1187990736 X:24869450-24869472 AAAGAAGCCCTGTGGCAAAATGG - Intronic
1189619803 X:42824060-42824082 ACAGAAGCAATCTGATTTAATGG - Intergenic
1189988273 X:46573048-46573070 ACAGAATCAAAGTGGTAGAATGG - Intergenic
1190283145 X:48944523-48944545 ACAGAAGCCATAAGGCATATGGG - Intronic
1190481357 X:50880294-50880316 ACCGAAGCAATGCAGCATCAGGG + Intergenic
1191677386 X:63805799-63805821 ACAGAGGCAGTGTGGCATTCAGG + Intergenic
1194017952 X:88649222-88649244 ACATAAGCAATGTGAAATGAAGG + Intergenic
1194446952 X:94000148-94000170 ACAAAAAGAATGTTGCATAATGG - Intergenic
1194980555 X:100435846-100435868 ACAGAAGCAATTTGGCCTTTGGG - Intergenic
1195139884 X:101948779-101948801 ACAGTAGGAATGTGGCTTAGGGG - Intergenic
1195827506 X:109018370-109018392 ACAGACGCAAAGAGACATAATGG - Intergenic
1196761653 X:119206095-119206117 ACAGAAGAAATCTGCCTTAAAGG + Intergenic
1197409860 X:126103432-126103454 ACAGAAGCAATTTTGGAAAAGGG + Intergenic
1198734331 X:139769946-139769968 ACTGAAGAAATATGGAATAAAGG - Intronic
1199298307 X:146184152-146184174 AAAGATGCAAAGTGGCAGAATGG - Intergenic
1200848201 Y:7853669-7853691 ACTGAACCAATGTAACATAAAGG - Intergenic
1201850660 Y:18476401-18476423 ACAGAGGCAATGAGGCATCAAGG - Intergenic
1201882658 Y:18843976-18843998 ACAGAGGCAATGAGGCATCAAGG + Intergenic