ID: 1108317704

View in Genome Browser
Species Human (GRCh38)
Location 13:49253924-49253946
Sequence TGGCATAATGGTTAAGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 1, 2: 3, 3: 51, 4: 321}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108317699_1108317704 10 Left 1108317699 13:49253891-49253913 CCCTCACTGTACTTTTCCAGAAC 0: 1
1: 0
2: 3
3: 22
4: 231
Right 1108317704 13:49253924-49253946 TGGCATAATGGTTAAGACAATGG 0: 1
1: 1
2: 3
3: 51
4: 321
1108317698_1108317704 24 Left 1108317698 13:49253877-49253899 CCTTATGCTAAAGGCCCTCACTG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1108317704 13:49253924-49253946 TGGCATAATGGTTAAGACAATGG 0: 1
1: 1
2: 3
3: 51
4: 321
1108317700_1108317704 9 Left 1108317700 13:49253892-49253914 CCTCACTGTACTTTTCCAGAACA 0: 1
1: 1
2: 0
3: 22
4: 207
Right 1108317704 13:49253924-49253946 TGGCATAATGGTTAAGACAATGG 0: 1
1: 1
2: 3
3: 51
4: 321
1108317702_1108317704 -6 Left 1108317702 13:49253907-49253929 CCAGAACAGAAGCAATGTGGCAT 0: 1
1: 0
2: 2
3: 12
4: 142
Right 1108317704 13:49253924-49253946 TGGCATAATGGTTAAGACAATGG 0: 1
1: 1
2: 3
3: 51
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108317704 Original CRISPR TGGCATAATGGTTAAGACAA TGG Intronic
901113079 1:6815074-6815096 TGACTTAAAGGTTAAAACAAGGG - Intronic
902622817 1:17660279-17660301 TGGCATAATGGGTAAGGGATGGG + Intronic
903139900 1:21333151-21333173 TGACCTAGTGGTTAAGACCAAGG - Intronic
903729631 1:25482702-25482724 TGGCCTAATGGTGAAGAGAATGG + Intronic
903984341 1:27214630-27214652 TAGCATAATGATTAACACCATGG + Intergenic
904550099 1:31309161-31309183 TAGCATAGTAGTTAAGAGAATGG + Intronic
905222320 1:36456974-36456996 TGGTATAATGGTTAAGAATATGG + Intronic
905744901 1:40406946-40406968 TGGCACAAAGGTGAAGATAAAGG + Intronic
906355415 1:45102293-45102315 AGGCATAAAGGATAAGAAAATGG - Intronic
906419789 1:45655711-45655733 TGGAATAAGGGTGAAGGCAACGG + Intronic
906808581 1:48803569-48803591 TGGTATAATGGTTTAAACAAAGG + Intronic
907167416 1:52426155-52426177 TGGCATAATGGTTGAGAACTTGG + Intronic
907203347 1:52746940-52746962 AGGCCTTATGGGTAAGACAAAGG + Intronic
907614135 1:55906820-55906842 TGGCCTAATGGTGGAGACCAGGG + Intergenic
907628833 1:56059965-56059987 TGGCATGATGGTTAAGAGCATGG - Intergenic
907637263 1:56148056-56148078 TGGCATAATGGTGAAAAGCATGG + Intergenic
908918786 1:69165141-69165163 TGGCATAATGGATAAAACATGGG - Intergenic
909395231 1:75164365-75164387 TAGCATAGTGGTTAAGATTATGG - Intergenic
909485105 1:76163989-76164011 TGGCATAATGCTTAAGATGTTGG + Intronic
909554961 1:76943304-76943326 TAGCATAATGGTAAAGACTGTGG - Intronic
909665928 1:78133461-78133483 TGGCAGAAGGGTTTAGAGAATGG + Intronic
909988160 1:82188009-82188031 TAGCATAATGGTTAACAAAATGG + Intergenic
910356279 1:86359851-86359873 TTGCATGATGGTTAACACACTGG - Intronic
911380049 1:97103021-97103043 TGGTATAATGGTTGAGAGCATGG + Intronic
911742070 1:101397210-101397232 TTGGAAAATGGTTAAGCCAAGGG + Intergenic
915568484 1:156730384-156730406 TCGCAGAATGGTTAAGAACAAGG + Intronic
916477891 1:165187067-165187089 GAGAAGAATGGTTAAGACAATGG - Intergenic
918096321 1:181337781-181337803 ATGCACAATAGTTAAGACAATGG - Intergenic
918251665 1:182708480-182708502 TGATATAATGGCTCAGACAAGGG + Intergenic
918277092 1:182963661-182963683 TAGCATAGTGGTTAAGAGCAGGG - Intergenic
918349940 1:183644185-183644207 AGGCATAATGATTAAGAACATGG + Intronic
918370345 1:183854694-183854716 TAGTATAATGGTTAAGAACATGG + Intronic
918380996 1:183955104-183955126 TAGGATAATGGTTAAGAGGAAGG + Intronic
918451479 1:184663756-184663778 AGGCCTAATGGTTAAGAGCATGG + Intergenic
918828639 1:189361680-189361702 TGACAGGATGGTTAAGAGAAGGG + Intergenic
918883770 1:190163471-190163493 TGGCATAATTTTGAGGACAATGG + Intronic
919761801 1:201102768-201102790 TGGCATAGTGGTTGAGACCATGG - Intronic
920652154 1:207845895-207845917 TGGTACAATGGTTAAGAGTATGG + Intergenic
921261059 1:213385439-213385461 TGGCATGATGGCTAGGAGAATGG - Intergenic
921273185 1:213490846-213490868 TCGCAGAATGGTTCAGATAATGG + Intergenic
921553888 1:216573238-216573260 TTGCATAATATTTAAGATAAAGG - Intronic
921949143 1:220910973-220910995 TGGCATAATGTTAAGGAGAAGGG + Intergenic
923512628 1:234665546-234665568 TGGCACAGTGGTTAAAAGAATGG - Intergenic
924677759 1:246197660-246197682 TGGCATACTGGTACAGACACTGG + Intronic
924957338 1:248942410-248942432 TGGAATAATTCTTAAGCCAAAGG + Intergenic
1065344228 10:24733615-24733637 TCACATATTGGTTAGGACAAAGG + Intergenic
1066126934 10:32350914-32350936 TGGGACTATGTTTAAGACAATGG - Intronic
1066584846 10:36921275-36921297 TGGCATAATGATTAAGATCATGG - Intergenic
1068292614 10:55023265-55023287 TTCCATAATGGTTAAAATAATGG + Intronic
1068919669 10:62469907-62469929 TTACATAATGGTTAAGAGACAGG - Intronic
1069939837 10:71947753-71947775 TTGCATAGTGGTTAAGAATATGG - Intergenic
1070118462 10:73552065-73552087 TGGTGTAATGGTTAAGAGACTGG + Intronic
1072904113 10:99434950-99434972 TAGCATAATGGTTAAAAGCATGG + Intergenic
1073219491 10:101858256-101858278 TGGCATAGTGGTTAAGAGCACGG + Intronic
1073548331 10:104372914-104372936 GGGCATAATGGTTAGGAGCATGG + Intronic
1074111907 10:110428811-110428833 TGGAAGAATGGTTAAGACTCAGG + Intergenic
1074250656 10:111742897-111742919 TAGCCTAATGGTTAAGACCACGG + Intergenic
1074861413 10:117513011-117513033 GGGCTGAAAGGTTAAGACAAAGG - Intergenic
1076193095 10:128496584-128496606 TGCCATCATGGCTAAGAAAAAGG - Intergenic
1076963242 10:133784254-133784276 TGGAATAATTTTTAAGCCAAAGG + Intergenic
1082693385 11:56331750-56331772 GTGCATAATGCTTAAGACAATGG + Intergenic
1085280440 11:75326573-75326595 AGGCAGAGTGGTTAAGACCAAGG - Intronic
1086036666 11:82424282-82424304 AGGCAAAATGGTTAATGCAAAGG + Intergenic
1086500219 11:87445277-87445299 AGGCATCATGATTAAGACACTGG + Intergenic
1086880198 11:92144775-92144797 TAGCATAAAATTTAAGACAAAGG - Intergenic
1087621228 11:100545026-100545048 TAGCATAATAGTTAAGAGCATGG - Intergenic
1088648144 11:111934087-111934109 TTGCATAATGGTTAAGAACCTGG + Intronic
1088837036 11:113586527-113586549 TGGCATATTGGGTCAGACCATGG + Intergenic
1091539883 12:1450047-1450069 TAGCATAAAGTTTGAGACAAAGG - Intronic
1091918132 12:4283701-4283723 TGGCAAAATGGTGGAGGCAAAGG - Intronic
1092778872 12:11967093-11967115 GGGCATACTGGATAAGACCATGG - Intergenic
1092959977 12:13587248-13587270 TGGTATATTGTTAAAGACAAGGG - Intronic
1094771658 12:33669778-33669800 TGGCATAGTAGTTAAGAGAATGG - Intergenic
1096205781 12:49720392-49720414 TAGCATAATGATTAAGAGCATGG + Intronic
1096555010 12:52398358-52398380 TGGCAGAATGGTGAACTCAAAGG + Intronic
1098783373 12:74717504-74717526 TAGCAGAATGGTTATGACAAAGG + Intergenic
1099535740 12:83842174-83842196 TGGCATAATGATTACAACAATGG + Intergenic
1099800896 12:87455221-87455243 TAGCAGAATGGATAAGACAGTGG + Intergenic
1100786185 12:98080957-98080979 AGTCATAAGGGTTTAGACAAAGG + Intergenic
1101185547 12:102273862-102273884 TTGCATAGTGGTTAAGAGTATGG + Intergenic
1101697850 12:107143330-107143352 TGGCACAATGGTTAAGTGCAAGG - Intergenic
1101978610 12:109385207-109385229 TAGCATAATGATTAAGACGTTGG - Intronic
1103253037 12:119517320-119517342 TGGCAGAATGGCAAAGAGAATGG - Intronic
1104044239 12:125150516-125150538 GGGCATAGTGGTTAAGACCATGG + Intergenic
1105074506 12:133263950-133263972 TGGAATAATTCTTAAGCCAAAGG + Intergenic
1106058136 13:26258237-26258259 AAGCATAATGGTTAAGAGCATGG - Intronic
1106858371 13:33877246-33877268 CAGCATAATGGCTAAGACAGTGG - Intronic
1107500496 13:40969310-40969332 TAGCATAATGGTTAAGAGTTTGG + Intronic
1107915240 13:45143334-45143356 TGGCATACTGGTTATGAGTATGG + Intronic
1108317704 13:49253924-49253946 TGGCATAATGGTTAAGACAATGG + Intronic
1110124114 13:71920692-71920714 TGGCATAGTGATTAAGAGCAAGG + Intergenic
1111715341 13:91873244-91873266 TTGCATAGTGATTAAGAGAATGG + Intronic
1112482694 13:99791746-99791768 TGGGAGCACGGTTAAGACAATGG - Intronic
1112734801 13:102403899-102403921 TCCCATAAAGGTTAAGACATTGG + Intergenic
1113989667 13:114351096-114351118 TGGAATAATTGTTAAGCCAAAGG + Intergenic
1115157863 14:30360872-30360894 TAGCATAGTGGTTAAGACCATGG + Intergenic
1115499480 14:34036511-34036533 TAGCATAATGGTTAGGAGCAGGG - Intronic
1116732013 14:48635444-48635466 TGTCAAAATGGTTAGGACTAAGG + Intergenic
1116764172 14:49050612-49050634 AGCCATAATGGAGAAGACAATGG - Intergenic
1118492564 14:66275627-66275649 TGGCATAAGGGTCAAGAGCAGGG + Intergenic
1119887901 14:78159351-78159373 TAGCATCATGTTTAAGAGAAGGG - Intergenic
1119899795 14:78249845-78249867 TGGCATAGTGGATAAGAGTATGG + Intronic
1121651602 14:95562937-95562959 TTGCACAATGGTTAGGAGAATGG + Intergenic
1121659152 14:95621844-95621866 TGGCATGATGGTTAAGAACTCGG + Intergenic
1122189183 14:100026459-100026481 TGGGCTGATGGTTAAGACACAGG - Intronic
1122365101 14:101190339-101190361 TGACAGAATGGATAAGAGAATGG + Intergenic
1123877989 15:24643458-24643480 TGGCTTAATGGATAAAAAAAAGG + Intergenic
1125450887 15:39805936-39805958 TGCCATTGTGGTTAAGAGAATGG - Intronic
1126234748 15:46370543-46370565 AAGCATAATGGTTAAGAACAAGG - Intergenic
1126528073 15:49680001-49680023 TGGTATAGTGGTTAAGAGGAAGG + Intergenic
1128851681 15:70964239-70964261 TAGCATAGTGGTTAAGAGCATGG + Intronic
1129179536 15:73865192-73865214 TGGCCTACTGGTTAAGAGCATGG - Intergenic
1129807297 15:78473759-78473781 AGGCATAATGGTTAAGACAATGG - Intronic
1130145591 15:81271610-81271632 TGGCGTCATGGTTAAGAACAAGG - Intronic
1130181581 15:81634790-81634812 TAGCAAAATGGTTAAGAGCATGG + Intergenic
1132332712 15:101023940-101023962 TTGCATAACTGTTAAGAAAAAGG - Intronic
1133057453 16:3152907-3152929 TGGCCTAATGGATAAGGCATTGG + Intergenic
1133896343 16:9932893-9932915 TGGCATCACGGTTAAGAGCATGG - Intronic
1137231590 16:46571987-46572009 TGCCATCATGGTTGAGACGAGGG + Intergenic
1138073374 16:54016198-54016220 TAGCATAATGGTGAAGAGGAGGG - Intronic
1139291703 16:65864354-65864376 TGCAAAAATGGTTAAAACAAAGG - Intergenic
1140761863 16:78116620-78116642 TGGCGTAATATTTAAAACAATGG + Intronic
1141012548 16:80416382-80416404 TGGGATGATGGTTTAGACAAGGG - Intergenic
1142949734 17:3468608-3468630 TAGCATAATGATTAAGAGCATGG + Intronic
1144279322 17:13709023-13709045 TGGCATATAGGCTAAGAAAAAGG + Intergenic
1146020864 17:29277612-29277634 TGGCAGACTGGTTAAGAAAAAGG - Intronic
1146578417 17:34014341-34014363 TGGCATAATGGTTAGAGCACAGG - Intronic
1147505390 17:41011585-41011607 TGGCACAGTGATTAAGACCATGG - Intronic
1147510138 17:41061095-41061117 TGGCATTATGAAAAAGACAAGGG + Intergenic
1149460150 17:56822338-56822360 TGGTATAATGGTTATGACTGTGG + Intronic
1149489838 17:57076527-57076549 TTGCATAATGTTTAAGAAACTGG - Intergenic
1151589459 17:75033913-75033935 TGGCCTAATGGATAAGGCACTGG + Intronic
1151589575 17:75034474-75034496 TGGCCTAATGGATAAGGCACTGG - Intronic
1151776029 17:76203364-76203386 TGTCATGTTGGTTAAGACGATGG - Intronic
1152006742 17:77687053-77687075 TGGCATAATAGAGATGACAATGG + Intergenic
1152952389 17:83246482-83246504 TGGAATAATTCTTAAGCCAAAGG + Intergenic
1153403900 18:4713434-4713456 TGGAAGAATGGTTCAGACAGAGG - Intergenic
1153481634 18:5553432-5553454 TAGCATCATGGTTAAGAGCATGG - Intronic
1154203085 18:12313192-12313214 TGGAATAATTGTAGAGACAATGG - Intronic
1156819117 18:41350232-41350254 TGGTGTAATGGTTAAGAGCAAGG + Intergenic
1158244929 18:55421631-55421653 TTGTATAATGATTAAGAAAAAGG - Intronic
1159091043 18:63849601-63849623 TAGCATAATAGTTAAGCCCATGG - Intergenic
1159361979 18:67417285-67417307 TGCCATAATTGCTAAGACCAGGG - Intergenic
1160108218 18:75999694-75999716 TGGCAAAGTTGTTAAGAAAAGGG - Intergenic
1160305092 18:77725379-77725401 TGGCTTAATGGTAAATATAAGGG + Intergenic
1160571746 18:79822243-79822265 TGGCAGAATGGTCCAGACCAGGG + Intergenic
1160653764 19:248998-249020 TGGAATAATTCTTAAGCCAAAGG - Intergenic
1164187670 19:22885161-22885183 TGGGATAATGACTAAGAAAAAGG + Intergenic
1168192522 19:54750008-54750030 TTGCCTAATGGATAAGATAAAGG - Intronic
1168194604 19:54764838-54764860 TTGCCTAATGGATAAGACAAAGG - Intronic
1168196852 19:54781285-54781307 TTGCCTAATGGATAAGATAAAGG - Intronic
1168202651 19:54827723-54827745 TTGCCTAATGGATAAGATAAAGG - Intronic
1168205218 19:54845543-54845565 TTGCCTAATGGATAAGATAAAGG - Intronic
1168728376 19:58604703-58604725 TGGAATAATTTTTAAGCCAAAGG + Intergenic
928417242 2:31105990-31106012 TGGAAGATTGGTTAAGAGAAAGG - Intronic
928653071 2:33422307-33422329 AGGCATCAGGGATAAGACAATGG - Intergenic
930145496 2:47998771-47998793 TGGCATAACGGTTAAGAACATGG - Intergenic
930206339 2:48590031-48590053 TGGCAAAGTGGTTAAGGCTAGGG - Intronic
930228439 2:48818733-48818755 TGGCATCATGGGAAATACAAAGG + Intergenic
930287495 2:49449329-49449351 TGGGATAAGGTTTGAGACAAAGG - Intergenic
930678284 2:54228521-54228543 TGGCATACTGGTTAAGAGTATGG - Intronic
930715695 2:54592318-54592340 TTGCTTAATGGTTAAAAAAAAGG - Intronic
931100239 2:58991327-58991349 TGGCATAATTGTTACCAGAAAGG + Intergenic
936570181 2:113606311-113606333 TGGAATAATTCTTAAGCCAAAGG - Intergenic
937159972 2:119751232-119751254 TGGCACACTGGTTAAAACAGTGG - Intergenic
937940744 2:127283891-127283913 TGGCAAAAAGGTTAAGAAATAGG - Intronic
938511686 2:131954315-131954337 TGGCAGAATGGTTAAAAGTATGG - Intergenic
940036954 2:149320996-149321018 GTGCATAATGCTTAAGACAATGG - Intergenic
943241207 2:185386305-185386327 AGGCATAATGATTAAGAAATTGG - Intergenic
943652316 2:190470534-190470556 TGGCATCATGATTAAAATAAAGG + Intronic
947282833 2:228474814-228474836 TAAAATAATGTTTAAGACAATGG + Intergenic
949088634 2:242180345-242180367 TGGAATAATTTTTAAGCCAAAGG + Intergenic
1169015618 20:2290411-2290433 AGGCATAGTAGTTAAGACCAGGG + Intergenic
1169816920 20:9666886-9666908 TGGCATCATGGTTAAGAATGTGG - Intronic
1172741555 20:37172265-37172287 TAGCAGAATGGTTAAGACTATGG + Intronic
1173277780 20:41599395-41599417 TGGAAAAATGGTTTAGAAAATGG + Intronic
1173668319 20:44778757-44778779 TGGCCTAATGGTTAAAAGCATGG + Intronic
1174136903 20:48386035-48386057 TGGCCTAGTGGTTAAGAACATGG + Intergenic
1174279198 20:49426409-49426431 TGGCATAGTGGTTAAGAGTCAGG + Intronic
1174392739 20:50228003-50228025 TGGCCCAGTGGTTAAGGCAAGGG + Intergenic
1176687936 21:9870215-9870237 TGACACAATAGTTATGACAAAGG - Intergenic
1177517299 21:22171659-22171681 AGGCCTAAAGGTTAAGACAGGGG + Intergenic
1177581200 21:23023418-23023440 TGGCTTACTGGTTAAAACATAGG - Intergenic
1178016956 21:28357961-28357983 TTGCGTAATGGTTAAGAGCACGG + Intergenic
1178528355 21:33352149-33352171 TGACAGAATGGTTAAGAGTAGGG - Intronic
1180263799 21:46696307-46696329 TGGAATAATTCTTAAGCCAAAGG + Intergenic
1182660055 22:31918828-31918850 TGGCCTAATGGTTGTGACAGAGG + Intergenic
1185430030 22:50804667-50804689 TGGAATAATTCTTAAGCCAAAGG + Intergenic
949262476 3:2118315-2118337 TGGAATCCTGGTTAAGACAGAGG + Intronic
949346457 3:3081354-3081376 TTGCATAATGGTTACGAGCATGG - Intronic
949550277 3:5106861-5106883 TGGCATAAACACTAAGACAAGGG - Intergenic
954598351 3:51846822-51846844 TAGCATAATGGAGATGACAAAGG - Intergenic
955927327 3:64020935-64020957 TGTAATAGTGGTTAAGAAAATGG - Intronic
956142880 3:66163423-66163445 TGGGAGAAAGGTTATGACAAAGG - Intronic
956154354 3:66279339-66279361 TAGCATAGTGGTTCAGACCAGGG + Intronic
956649035 3:71486077-71486099 TGTCCTCATGGTTAAGACAAAGG + Intronic
956951079 3:74283167-74283189 TACCATAGTGGTTAAGACTATGG + Intronic
957217123 3:77335112-77335134 TGGAAAAATTGTAAAGACAAAGG + Intronic
957366652 3:79233298-79233320 TGGCATAATGTTAATGACAAAGG + Intronic
958767929 3:98393241-98393263 TGACTTAGTGGTTAAGACCATGG - Intergenic
959310002 3:104723608-104723630 TGGCCTACTGGTTAAGAGCAAGG - Intergenic
959566441 3:107837296-107837318 CAGCATAGTGGTTAAGACCAAGG + Intergenic
959970958 3:112409333-112409355 TGGCTTAATGATTAAGCCTAAGG + Intergenic
959989743 3:112617914-112617936 TGCCAAAATTGTTAAGACAGTGG + Intronic
960131727 3:114063905-114063927 TGCTATAATGCTTAAGAAAATGG + Intronic
960517903 3:118622637-118622659 TGGCATTGTGGTTAAGAGCATGG - Intergenic
961406610 3:126684129-126684151 TGGCTGAATGGTTAAAACCAGGG + Intergenic
961800514 3:129444995-129445017 TAGCATAATGGTTAAAACATGGG + Intronic
961911516 3:130321893-130321915 TTGCATATGGTTTAAGACAAAGG - Intergenic
962637631 3:137347108-137347130 TGGCATTGTGGTTAAGACCTGGG + Intergenic
963041681 3:141074896-141074918 TGGCAGAAGGGTGAAGGCAAAGG + Intronic
963664439 3:148165081-148165103 TACCATAATGGTTAAGATTATGG + Intergenic
963924424 3:150936488-150936510 TGGCATTCTGGGTAAGACAAGGG - Intronic
964513535 3:157479651-157479673 TAGCATAGTGGTTAAGAACATGG + Intronic
965589240 3:170347153-170347175 TGGAATAATTGTTGAGTCAAAGG + Intergenic
969069425 4:4523137-4523159 TGCCATGATGGTTAAGAGCATGG - Intronic
969247156 4:5942746-5942768 TAGCATGTTGGTTAAGATAATGG - Intronic
970989778 4:22199394-22199416 TAGTATAATGGTTAAGATTATGG + Intergenic
971380695 4:26094695-26094717 TTGCATAATGGTGAAGTCAGAGG + Intergenic
971683952 4:29740412-29740434 TGGCATTATTGTGAAGACAAAGG - Intergenic
972273374 4:37534352-37534374 TGGCTTTAAGGTTAAGAAAACGG - Intronic
972370254 4:38416604-38416626 TGCCATAGTGGTTACCACAAGGG + Intergenic
972712433 4:41610777-41610799 TAGGGTAATGGTTAAGAGAATGG - Intronic
972894705 4:43605994-43606016 TTGCACAATGGTTAAACCAATGG - Intergenic
973671687 4:53225807-53225829 TGGCTTAGTGGTTTAGAGAAAGG - Intronic
974355451 4:60807051-60807073 TTGCATAATGGTCAAGTCAGTGG + Intergenic
974452324 4:62081960-62081982 AGGCATAAAGGGTAAGACAAGGG - Intergenic
974874346 4:67685012-67685034 TGGCATAATAGTTAAGAGTATGG - Intronic
975115064 4:70671030-70671052 TAGCATAATAGTTAAGAGAAAGG + Intronic
975241185 4:72061407-72061429 TGACATAGTGGTTAAGAGAATGG + Intronic
975655149 4:76633837-76633859 TAGCATATTGGTTGAGACTAGGG - Intronic
975913197 4:79293612-79293634 TAGCATAGTGGTTAAGAACATGG - Intronic
975940625 4:79640601-79640623 TGGCATAGTGGTTAAAAGGATGG - Intergenic
977055595 4:92186688-92186710 AGGCATACTGCTTTAGACAATGG - Intergenic
977871906 4:102101389-102101411 TAGCATAATGATCAAAACAAGGG - Intergenic
978776818 4:112513976-112513998 TGGCAAAATGGGGAAGAAAAAGG + Exonic
978969246 4:114782797-114782819 TTGCATAATGGATAAGGCAAAGG - Intergenic
979318086 4:119290405-119290427 TGGCATCATGGTTAAGAGCACGG + Intronic
979980264 4:127246621-127246643 TAGCATAATGATTAAGATATTGG - Intergenic
980689073 4:136268523-136268545 TAGCATAATGATTAAGGAAAAGG - Intergenic
981059108 4:140401020-140401042 TGGCATAGTGGTTAACAGCATGG + Intronic
982055272 4:151542779-151542801 TGGCACCATGGTTAAGAGCATGG + Intronic
982082593 4:151805386-151805408 TGGCATAACGGTTATGATTATGG + Intergenic
982661162 4:158208926-158208948 TGGCATAATGTAAAAGGCAATGG + Intronic
983274258 4:165598371-165598393 TAGCATAAAGGTTAAGAGCATGG + Intergenic
984837045 4:184031972-184031994 TGGGATATTGGTAAGGACAAAGG + Intergenic
985466464 4:190201552-190201574 TGGAATAATTTTTAAGCCAAAGG + Intergenic
985544224 5:501075-501097 TGGCCTGATGGTTACGACAGGGG + Intronic
986654624 5:9999165-9999187 AGCCATAATGGATATGACAAGGG - Intergenic
987763532 5:22195453-22195475 AGGCATAATGGTTATAAGAATGG - Intronic
988943040 5:36165278-36165300 TGGTATGATGGTTAAGACCGTGG - Intronic
989062290 5:37421194-37421216 GGGCATAATGGTTAAGCACATGG - Intronic
989156051 5:38346012-38346034 TGGCATAATGGTAAAAATCAAGG - Intronic
989707711 5:44357661-44357683 TAGCATAATGGTTAAGAGCAAGG - Intronic
990479475 5:56195380-56195402 TGGCATAATGATAAACATAAGGG - Intronic
991109938 5:62888245-62888267 TTGCACAATGGTGAAGAGAATGG - Intergenic
991158892 5:63471586-63471608 TGGCATATTGAGCAAGACAAAGG - Intergenic
991354827 5:65757310-65757332 TAGCATAGTGGTTAAGAGTATGG + Intronic
991631949 5:68665296-68665318 TAACATAATAGTTAAAACAAAGG + Intergenic
991898254 5:71428544-71428566 AGGCATAATGGTTAAAAGAATGG - Intergenic
993551196 5:89276022-89276044 TGGCATAGTAGTTAAGAACATGG - Intergenic
994998752 5:107100476-107100498 TGGCATTATGGTAAAAACACAGG + Intergenic
995022107 5:107378681-107378703 TGGCAGAATGGTGAAGTAAAGGG + Exonic
995477855 5:112565744-112565766 TGGAATAATGGTTAAGAGTATGG + Intergenic
996438340 5:123460573-123460595 TGGCATAATTGTTAAGATACAGG + Intergenic
997505622 5:134414290-134414312 TGGCATAATGGTTAACAACAGGG + Intergenic
998693046 5:144608933-144608955 TAGCACAATGGTTAAGAGCATGG + Intergenic
999912898 5:156224770-156224792 AGGCCTAATGCTTGAGACAAAGG - Intronic
1001163222 5:169339832-169339854 TGGTATAGTGGTTAAGAACATGG - Intergenic
1001574417 5:172752773-172752795 TGGCAGAGTGGTTAAGAGCAAGG - Intergenic
1001579232 5:172787639-172787661 TGCCATTATGGTTAAAATAAAGG + Intergenic
1002653027 5:180717622-180717644 TGCCATAATAATTAAGACAGTGG + Intergenic
1002746414 5:181477883-181477905 TGGAATAATTTTTAAGCCAAAGG + Intergenic
1002944067 6:1744270-1744292 TGGCATGCTGGTTGGGACAATGG + Intronic
1004650493 6:17602674-17602696 GTGCATAATGCTTAAGACAATGG - Exonic
1005160362 6:22853388-22853410 TGGCATAGTGGTTAAGAGCTTGG - Intergenic
1005445306 6:25916431-25916453 TAGCATAGTGGTTAAGAATATGG + Intronic
1008043391 6:46826853-46826875 TGGCACAATGGATAACACATGGG + Intronic
1008169240 6:48181836-48181858 TGGCAAAAACGTTAAGACACTGG + Intergenic
1009954314 6:70434256-70434278 TGGCATAAAGGATAAGAGGATGG + Intronic
1010029050 6:71254027-71254049 TGGCATAATGATTAAGAAAATGG - Intergenic
1011748685 6:90433802-90433824 TGCAAAAATGGTTAAAACAAAGG - Intergenic
1012047108 6:94291165-94291187 TAGAATGATGGTTAAGAGAAGGG + Intergenic
1013671860 6:112412352-112412374 TTGCAGAATGGTCAAGACATGGG + Intergenic
1015376822 6:132519283-132519305 TGCCAAAATGATTAACACAAAGG - Intergenic
1015569114 6:134603974-134603996 GTGCATAATGCTTAAGACAATGG + Intergenic
1016102631 6:140121430-140121452 TGGGATAATGGGTAAAATAAGGG - Intergenic
1016153805 6:140779248-140779270 TGGCATAAGGATAAAGATAAAGG + Intergenic
1016888428 6:148981378-148981400 TGGCATAGTGGTTAAGAACAAGG - Intronic
1017294922 6:152782557-152782579 TGGGAAAATGGTTAAGACCATGG - Intergenic
1019235297 6:170607199-170607221 TGGAATAATTCTTAAGCCAAAGG + Intergenic
1020153411 7:5701686-5701708 TAGCTCAGTGGTTAAGACAAGGG - Intronic
1021649772 7:22822038-22822060 CGCTATAATGGTTAAGACTATGG + Intronic
1022291115 7:29004574-29004596 TGGCCTGATGGTTAAGAGCACGG + Intronic
1023469436 7:40498584-40498606 TAACATAATGGTTAAGACCATGG + Intronic
1024365587 7:48516829-48516851 GGGCATAATGGTTATGAGCATGG - Exonic
1024746220 7:52409420-52409442 TGGCATAGTTGTTCATACAAAGG + Intergenic
1025117563 7:56271199-56271221 TGGCCCAATGGTTAAAACCATGG - Intergenic
1025925474 7:65956294-65956316 TGGCCTAATGGTTAAAACTGTGG + Intronic
1026368513 7:69674335-69674357 TGGCATAGTGGTTAAGACCAGGG + Intronic
1026463874 7:70637178-70637200 AAGCATAATGGTTAAGAACATGG - Intronic
1027955439 7:84873303-84873325 TGGCATAATGGCTAAGAGCATGG + Intergenic
1029240381 7:99157198-99157220 TGGCATCATGGAAAAGAAAAAGG - Intergenic
1031333529 7:120496975-120496997 TGGCTTAATGATTATGATAATGG + Intronic
1031594808 7:123637729-123637751 TAGCAAAATGATTAAGACCATGG - Exonic
1032613769 7:133443917-133443939 TGGCATAATGGCCAAAATAAAGG - Intronic
1033197542 7:139340707-139340729 TGGCCTAATGGATAAGGCATTGG + Intronic
1033459729 7:141535128-141535150 TGGCATAATGGTTATCACCAGGG + Intergenic
1035021257 7:155802168-155802190 TGGCAAAATGGTGAATACAAAGG + Exonic
1035496795 7:159334974-159334996 TGGAATAATTCTTAAGCCAAAGG + Intergenic
1035513294 8:208791-208813 TGGAATAATTCTTAAGCCAAAGG - Intergenic
1035651678 8:1270552-1270574 TGGCAAAGAGGTTAAGACAGTGG - Intergenic
1035825514 8:2640469-2640491 TGGCATGGTGGTAAAAACAAAGG + Intergenic
1037872092 8:22507873-22507895 TGGCATGGTGGTGAAGAGAATGG - Intronic
1038347678 8:26747267-26747289 AGGCATATTGGTTAAGAAATTGG + Intergenic
1039240924 8:35555944-35555966 TAGCCTAATGGTTAAGAACATGG + Intronic
1040425918 8:47286223-47286245 ACGCATAATGGTTAAGAACATGG + Intronic
1041163643 8:55070415-55070437 TGGCATAATGGGCAAGAACAGGG + Intergenic
1042281346 8:67059810-67059832 TGGCCTAATGGTTAAGAATGTGG + Intronic
1043482524 8:80667728-80667750 TGGCACAGTGATTAAGAGAATGG + Intronic
1044016459 8:87052935-87052957 AGGCATAATAGTGAAGTCAAGGG + Intronic
1044875168 8:96658312-96658334 TGGCTTAATGGTTAAGAACATGG + Intronic
1045834805 8:106507412-106507434 TAGCACAAGGGTTAAGACTATGG - Intronic
1045952689 8:107869206-107869228 TGGCACAGTGATTAAGAGAATGG - Intergenic
1046092204 8:109516635-109516657 TAGCATAATGGTTAAGTGCATGG - Intronic
1046867828 8:119170738-119170760 TGCCAAAATGAGTAAGACAAAGG + Intronic
1047009472 8:120655586-120655608 GAGCATAATGATTAAGACATGGG - Intronic
1047951332 8:129938538-129938560 TGCCATTCTGGATAAGACAAAGG - Intronic
1048101031 8:131351559-131351581 TGGCATCAAGGATAAGAGAAAGG - Intergenic
1049038159 8:140092817-140092839 CAGCATAAGGGTTAAGAGAATGG + Intronic
1050145864 9:2566771-2566793 TGGCATAGTGGTTAAGAGCAAGG - Intergenic
1050269954 9:3932634-3932656 TTGTATCATGGTTAAGAGAAGGG + Intronic
1050332324 9:4557826-4557848 TGGAATAGTGGTTAAGAATATGG + Intronic
1050372758 9:4938803-4938825 TGGCATAATGCTTGACACATGGG - Intergenic
1050778701 9:9302637-9302659 TGGGAGAATGTTTAAGGCAAAGG - Intronic
1051701124 9:19825228-19825250 TGAGACAATGGTTAAAACAATGG - Intergenic
1052050608 9:23843813-23843835 TAGCATAATGGATAAAGCAAAGG - Intergenic
1052463252 9:28794757-28794779 TGGTATGATAGTTAAGGCAAGGG + Intergenic
1053316402 9:37055482-37055504 TGGCAAAATGGTTAAGCATATGG + Intergenic
1053337158 9:37286181-37286203 TAGCATATTGGTTAAGAGCATGG + Intronic
1054848677 9:69823416-69823438 TAGCATAATGGTTAAAACTCGGG + Intronic
1055089899 9:72352923-72352945 TGGCATAGTGATTAAGATGAGGG - Exonic
1055274901 9:74603929-74603951 TAGCATAATAGTTAGGACGATGG - Intronic
1058392627 9:104513163-104513185 TAACATAATGGTTAAGTGAAAGG - Intergenic
1058731208 9:107851563-107851585 TGGTATAGTGGTTAAGAGAGTGG + Intergenic
1059541397 9:115133884-115133906 TGGCTTAGTGGTTAAGACTTAGG - Intergenic
1059722594 9:116975688-116975710 TGGCACAAAGGTTAAGAGCACGG + Intronic
1060277389 9:122192428-122192450 TGGCATGATGGTTAAGAGCTTGG - Intronic
1062066693 9:134531957-134531979 TGTCAAAATGGTGAGGACAACGG + Intergenic
1187535618 X:20139321-20139343 TTGCATAGTGGTTAAGAGCATGG - Intronic
1187780532 X:22817748-22817770 TGGCATCATGGTTTTGTCAAGGG - Intergenic
1188637154 X:32448378-32448400 AGGCATAGTGGTTAAGAACATGG - Intronic
1189220597 X:39368589-39368611 CAGCATACAGGTTAAGACAATGG - Intergenic
1189549048 X:42074232-42074254 TGACAGAATGGTTTAGAAAAGGG + Intergenic
1191879629 X:65832138-65832160 TGGTATAGTGGTTAAGAGCATGG + Intergenic
1192202289 X:69074025-69074047 ATGCATAGTGGTTAAGACACAGG + Intergenic
1192861801 X:75081439-75081461 TGGCAAAATGGAGAAGACAGAGG + Intronic
1194628957 X:96259426-96259448 TGGCCTAATGGGTAAGGCAGTGG - Intergenic
1194680837 X:96850521-96850543 TCACATAATGGTTATGAGAATGG - Intronic
1195461445 X:105130191-105130213 TGGAATAGTGGTTAAGAACATGG - Intronic
1195600228 X:106738644-106738666 TGGCACAGTGGTTAAGAAGAGGG + Intronic
1195635732 X:107113739-107113761 TAGCATAATGATTAAGAACATGG - Intronic
1195751941 X:108168797-108168819 TAGCATCATGGTTAAGAGTATGG - Intronic
1196491717 X:116275249-116275271 TGGTATAATGGTTAAAACACAGG - Intergenic
1196728110 X:118915228-118915250 TGGTATAGTGGTTAAGATCATGG + Intergenic
1196759544 X:119189261-119189283 TGGCAGAATGCTTAAAGCAAGGG + Intergenic
1197274340 X:124460794-124460816 TGGCATAGTGGTTAAGAGAATGG - Intronic
1197302080 X:124793546-124793568 TAGTGTAATGGTTAAGACCATGG + Intronic
1197654671 X:129104031-129104053 GAGCATAATGGTTAAGAGCATGG + Intergenic
1198106134 X:133463046-133463068 TGGCAGAATGGAAAAGATAAAGG - Intergenic
1198478630 X:137019766-137019788 TGGTATAGTGATTAAGACCATGG - Intergenic
1198577036 X:138021847-138021869 TTGCATGATGGTTAAGAGCATGG + Intergenic
1198638405 X:138726285-138726307 TGGCAGAGTGGTTAAGAGCATGG + Intronic
1198874220 X:141205503-141205525 TGACATTCTGGTAAAGACAATGG + Intergenic
1199399651 X:147382882-147382904 TGGCATAGTAGTTTAGAGAATGG - Intergenic
1199977148 X:152900778-152900800 TAGCCTAGTGGTTAAGAGAATGG + Intergenic
1201926148 Y:19290167-19290189 AGGCATAGTGGTGAGGACAAAGG - Intergenic