ID: 1108319031

View in Genome Browser
Species Human (GRCh38)
Location 13:49269159-49269181
Sequence AAGGTCTCTACAGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108319028_1108319031 5 Left 1108319028 13:49269131-49269153 CCCAAGAAAGAAGAGAAAGTCAT 0: 1
1: 0
2: 9
3: 85
4: 684
Right 1108319031 13:49269159-49269181 AAGGTCTCTACAGATGCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 144
1108319029_1108319031 4 Left 1108319029 13:49269132-49269154 CCAAGAAAGAAGAGAAAGTCATC 0: 1
1: 0
2: 3
3: 51
4: 488
Right 1108319031 13:49269159-49269181 AAGGTCTCTACAGATGCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108319031 Original CRISPR AAGGTCTCTACAGATGCTGC TGG Intronic
900766689 1:4510687-4510709 AAGGTCTCCACAGAACCAGCTGG + Intergenic
901337149 1:8460285-8460307 AAGGCATCTGGAGATGCTGCTGG + Intronic
908791020 1:67781598-67781620 AAGGTCTCTTCAGCAGCTGTAGG + Intronic
913191506 1:116417156-116417178 AAGGGCTCTACAAATGTAGCTGG + Intergenic
913346613 1:117816678-117816700 AAGCTGTCTGCAGCTGCTGCTGG + Intergenic
913992812 1:143630490-143630512 AAGTTCACTACAGATACTGAAGG - Intergenic
915692886 1:157707977-157707999 AATGTCTCTACAGACCCTGATGG - Intergenic
917650281 1:177069556-177069578 AAGCTTTCTATGGATGCTGCTGG + Intronic
918899000 1:190388241-190388263 TTTTTCTCTACAGATGCTGCAGG - Intronic
919346974 1:196394459-196394481 GAGTTCTATACAGATGGTGCTGG + Intronic
923859683 1:237880846-237880868 AAGTGCTCAACAGCTGCTGCTGG - Intronic
1063829396 10:9934675-9934697 AATATCTCTATAAATGCTGCTGG + Intergenic
1064192102 10:13215802-13215824 AAAGTCACTACAGATGTGGCCGG - Intergenic
1068577198 10:58697885-58697907 AAGGTCTCTACAGGGGGTGTGGG - Intronic
1070843435 10:79503723-79503745 AAGGGCTCCACAGCCGCTGCTGG + Intergenic
1073130602 10:101186556-101186578 AAGGTAGCTAAAGAAGCTGCTGG - Intergenic
1073233582 10:101993952-101993974 AAGGTTTTCACAGAGGCTGCAGG + Intronic
1073253151 10:102133937-102133959 AAGGACTCTCCAGATGTTGCGGG + Intronic
1073435112 10:103511417-103511439 CAGGTCCCCTCAGATGCTGCTGG - Intronic
1076608018 10:131701886-131701908 AAGGTCTGCACAGGGGCTGCAGG - Intergenic
1077919759 11:6633332-6633354 AAGGTATCTTCGGATGGTGCTGG + Intronic
1078841745 11:15082962-15082984 AAGGTCTCTCATGAGGCTGCAGG - Intergenic
1084790545 11:71472975-71472997 AGGGTCGCTTCAGAAGCTGCTGG + Intronic
1089103590 11:115983953-115983975 AAGGCCTCTTCAGTTGCTGCTGG + Intergenic
1091079788 11:132655539-132655561 CAGACATCTACAGATGCTGCGGG - Intronic
1095525803 12:43123661-43123683 AAGGACTCTAGAGAAGCTGTGGG + Intergenic
1101365082 12:104064013-104064035 AAGGTCGCTACAAAGCCTGCCGG - Intronic
1105624981 13:22103983-22104005 AAAGTCTCCACAACTGCTGCCGG - Intergenic
1105647319 13:22335940-22335962 ATGGTCTCAACAAATGATGCTGG - Intergenic
1105928752 13:25032834-25032856 AAGGTATCTGCAGAGGATGCAGG + Intergenic
1107656182 13:42593802-42593824 GATGTCTCTGCAGCTGCTGCTGG + Intronic
1108319031 13:49269159-49269181 AAGGTCTCTACAGATGCTGCTGG + Intronic
1109524940 13:63563654-63563676 TAGGTCACTACAAATGCAGCTGG - Intergenic
1109701826 13:66035762-66035784 AAGACCTCTACTTATGCTGCTGG - Intergenic
1109852261 13:68081139-68081161 AATGTCTCTAGATATACTGCTGG + Intergenic
1110132299 13:72022846-72022868 AAGCTGTCTACGGCTGCTGCTGG - Intergenic
1110636168 13:77768965-77768987 AAATTCTCAAAAGATGCTGCTGG - Intergenic
1112466589 13:99650589-99650611 AAGGTCAGCACAGAGGCTGCTGG + Intronic
1113459130 13:110469519-110469541 AAGCTATCTACAGATCTTGCAGG + Intronic
1117400294 14:55352849-55352871 GAGTTCACTGCAGATGCTGCAGG + Exonic
1118243520 14:64084841-64084863 AAGGTGTCGACAAAGGCTGCAGG + Intronic
1119155765 14:72409285-72409307 AAGCTCACTACCCATGCTGCTGG - Intronic
1119284353 14:73440159-73440181 ATGGTCTCAACTAATGCTGCTGG + Intronic
1120905448 14:89616937-89616959 CAGGTTTCAACAGATGCTGTGGG + Intronic
1122931520 14:104934925-104934947 AAGCTTGCTGCAGATGCTGCAGG + Exonic
1123691180 15:22839186-22839208 AAGGTGGCTTCAGCTGCTGCGGG + Intronic
1123883948 15:24704876-24704898 AAGGTCTATACAGAGGCCTCTGG + Intergenic
1125766624 15:42140817-42140839 AAGGTCTCAAGTGCTGCTGCAGG + Exonic
1126210077 15:46092173-46092195 AAGGTCACTATAGATGCAACTGG - Intergenic
1128232673 15:66046536-66046558 AGGTTCTCTGCAGCTGCTGCAGG + Intronic
1129624301 15:77180593-77180615 AAAGCCTCTACAGATGTTGCTGG - Exonic
1129691151 15:77714327-77714349 AAGATCTCTCCAGCTGCTGCAGG - Intronic
1130105363 15:80924790-80924812 AAGGGCTCAACAGATGCTCAGGG - Intronic
1130821513 15:87501220-87501242 AAGGCCTCTCCAGAAGCTGGGGG - Intergenic
1135109848 16:19682117-19682139 AATTTCTCTACAGCTGCTGCGGG + Intronic
1138666586 16:58574352-58574374 GTGGTCTCAACAAATGCTGCTGG + Intronic
1141110565 16:81267748-81267770 AAGGTTGCTGCAGCTGCTGCAGG - Intronic
1143521151 17:7445136-7445158 AGGGGCTCTGCTGATGCTGCTGG + Exonic
1143615298 17:8046002-8046024 AAGTTCTCTGCAGATACTTCTGG + Intronic
1144308828 17:13993800-13993822 AAGTTCCCAAGAGATGCTGCTGG + Intergenic
1146362447 17:32188266-32188288 AAGGTCTAAAAAGATGATGCTGG - Intronic
1146469606 17:33113348-33113370 AAGCTTTCTACAAATGCTACGGG + Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1149346301 17:55739766-55739788 AATGTCTCAGCAGATGCTCCTGG - Intergenic
1149407906 17:56373579-56373601 AAGGTCTCTGCCTCTGCTGCAGG + Intronic
1151438871 17:74115387-74115409 GAGGACTCTACATATGCTGCAGG - Intergenic
1152218503 17:79048246-79048268 CAGCTCTCTCCAGAGGCTGCGGG - Exonic
1152877506 17:82795471-82795493 AAGACCGCTACAGAGGCTGCTGG - Intronic
1157686537 18:49647103-49647125 ATGGGCTCTACAGACGGTGCAGG + Intergenic
1162868779 19:13569803-13569825 AAAGTCTCTCCAGATCATGCAGG - Intronic
1165388312 19:35524586-35524608 AGGGTCTTTGCAGAGGCTGCAGG + Intronic
925986194 2:9217123-9217145 ACGGGCTCTACAGAGGCTGTTGG - Intronic
926069426 2:9873905-9873927 AAGGTCACTCCAGCTGCTGAGGG - Intronic
926753090 2:16214781-16214803 AAGGTATATAAAGATGTTGCTGG - Intergenic
928596471 2:32863806-32863828 AAGGCCTCTGAAGATGCTCCAGG + Intergenic
928623131 2:33111362-33111384 ACGTTTTCTCCAGATGCTGCCGG - Intronic
929607135 2:43242134-43242156 AAGGTGTTCACAGATGCTGAGGG + Intronic
932761746 2:74442305-74442327 ATGGTCTCTTCGGAGGCTGCCGG - Intronic
934705955 2:96480698-96480720 ATGGTCTCTTCAAATGGTGCTGG - Intergenic
934862034 2:97772247-97772269 AAGGTCTATAAAGAAGTTGCTGG - Intronic
935700025 2:105803622-105803644 AATGTCTCTGCACATGATGCAGG - Intronic
936062746 2:109306360-109306382 AAGCACTCTGCAGGTGCTGCTGG - Intronic
937104914 2:119301658-119301680 AAGGACTCCACAGGTGCTGGCGG + Intergenic
939084643 2:137704666-137704688 AATGGCTCTACTGATGCTGGAGG + Intergenic
942064302 2:172255868-172255890 AAGGTCTCTAGGGATGCTCTTGG - Intergenic
942388249 2:175464358-175464380 AAGGACTCTAAAAATTCTGCTGG + Intergenic
943947002 2:194079279-194079301 AAGATATCTACCTATGCTGCTGG - Intergenic
948867691 2:240783887-240783909 AAGGTCTCCACAGCTGTTGAAGG + Intronic
1169702477 20:8463100-8463122 AGAGTTTCTACAGATGCTCCAGG + Intronic
1170404967 20:16026260-16026282 CAGGGCTCTGCAGATCCTGCAGG + Intronic
1171004006 20:21444922-21444944 AAGGCCTCAGCAGATCCTGCAGG - Intergenic
1174858372 20:54067935-54067957 AAGGTCTTTACTGATGTTGGGGG - Intronic
1175365173 20:58448817-58448839 AAGATCTCTGCTGATGCTCCTGG + Exonic
1175742135 20:61427150-61427172 ACGGTCTCTGCAAATGCGGCAGG - Intronic
1176525223 21:7861169-7861191 AAGGTCTCAACAGAGACTGTTGG - Intergenic
1177984566 21:27958117-27958139 AAAGACTCAACAAATGCTGCAGG + Intergenic
1178557776 21:33608542-33608564 ATGGTGGCTACAGAGGCTGCGGG - Intronic
1178659243 21:34491182-34491204 AAGGTCTCAACAGAGACTGTTGG - Intergenic
1179974029 21:44853587-44853609 AAGGCCTGCAGAGATGCTGCTGG + Intronic
1180149850 21:45941872-45941894 CTGCTCTCTACAGAGGCTGCAGG + Exonic
1180709330 22:17829103-17829125 CTGGTCTCTATAGATGTTGCTGG + Intronic
1182796264 22:32993829-32993851 AAGAACTCTGCAGATGCTGTGGG - Intronic
1184922244 22:47613851-47613873 CAGGTCTCTACTGATGTTGTGGG + Intergenic
949501184 3:4681307-4681329 AAGGTCTGCAAACATGCTGCTGG - Intronic
950708522 3:14798682-14798704 AAGGTCTCTCCAGCTCCAGCAGG + Intergenic
954224431 3:49173046-49173068 AAGGCCTCTACAGCAGCTACCGG - Exonic
956249898 3:67224879-67224901 CAGGTGGATACAGATGCTGCTGG - Intergenic
956522688 3:70123184-70123206 AAAGATTCTACTGATGCTGCTGG + Intergenic
956934474 3:74084330-74084352 AAAGTCTCTCCAGATGCTTCAGG + Intergenic
962072012 3:132043554-132043576 AAGGTAACTATAGATGCTGAAGG - Intronic
963716528 3:148810413-148810435 TAGGTTCTTACAGATGCTGCTGG + Intronic
970806154 4:20035877-20035899 AAAATCACTACAGATTCTGCAGG + Intergenic
975587023 4:75960005-75960027 AAGGTCTGCACAGATACTGCAGG + Intronic
983601047 4:169528330-169528352 AATGTCTCTACAAATGCAGGTGG + Intronic
983813128 4:172089174-172089196 TAGGTCTCTATATATGATGCAGG + Intronic
984922446 4:184777721-184777743 AAGGTAGCTACAGATGCTACTGG + Intronic
988291457 5:29293918-29293940 AAGGTCTAGGCAGATACTGCAGG - Intergenic
988732156 5:33983100-33983122 ACGGTCTCTGCTGATGCTGAGGG + Intronic
990875060 5:60474875-60474897 AAGCTCTGTGCAGCTGCTGCTGG + Intronic
999137266 5:149330375-149330397 AAGGTTTCTTCACATGCTGGAGG + Intronic
1006885540 6:37378884-37378906 TATGTCTCTGCAGATGCTCCAGG - Intronic
1007258154 6:40542843-40542865 TAGGTCTCTGCAGATGCAGCAGG + Intronic
1010723416 6:79308948-79308970 AAGCTGTCTGCAGCTGCTGCTGG + Intergenic
1012214365 6:96563220-96563242 AAGGGATCTTCAGATGGTGCTGG + Exonic
1013684349 6:112561950-112561972 AAGGTCTCTAATGTTGCTGGTGG + Intergenic
1014514753 6:122365334-122365356 AAGCTGTCCACAGCTGCTGCTGG - Intergenic
1018347067 6:162910902-162910924 CGGCTCTCCACAGATGCTGCTGG + Intronic
1024392963 7:48836115-48836137 AAGGTTTCAACAGGGGCTGCAGG - Intergenic
1024944322 7:54793482-54793504 AAGTTCCCTATAGATGATGCTGG - Intergenic
1025025558 7:55513615-55513637 AAGACCTCTAAAGATGCTGCAGG + Intronic
1028902992 7:96121970-96121992 GGGGTCACTAAAGATGCTGCAGG + Exonic
1028968253 7:96827279-96827301 AAGGTCTCTACAGTTTCTTACGG - Intergenic
1032702192 7:134391980-134392002 AGGGTCTCTATGGAAGCTGCCGG + Intergenic
1035250977 7:157596671-157596693 TCGGTCTCTGCAGATGCTTCTGG - Intronic
1039011329 8:33096587-33096609 AAAGTGTCTACAGATGGTACTGG + Intergenic
1040059609 8:43093213-43093235 AAGGTCCCTGCAGATGCCGCGGG + Intergenic
1043347114 8:79311160-79311182 AAGGTCTCTAGAAATTCTTCAGG + Intergenic
1046198202 8:110890412-110890434 AAGCTGTCTGCAGCTGCTGCTGG + Intergenic
1047091872 8:121584004-121584026 AAGGACTCAAAAGATTCTGCCGG + Intergenic
1050652157 9:7787220-7787242 AAGCTGTCTGCAGCTGCTGCTGG + Intergenic
1055082794 9:72283582-72283604 ATTGTCTCTACAGAAGCTGGAGG + Intergenic
1055370201 9:75590330-75590352 AAGTTCTCTACTGATTCTTCTGG - Intergenic
1055829883 9:80365762-80365784 ATATTCTCTACAGATGCTGTAGG + Intergenic
1058177008 9:101747852-101747874 AAGGTTTCAACAGAAGGTGCAGG - Intergenic
1058362866 9:104171018-104171040 AAGGTCTCTTCAGGTTCTGATGG + Intergenic
1059018362 9:110546565-110546587 GAGGAATCTCCAGATGCTGCAGG + Intronic
1060862223 9:126963966-126963988 AAGATTTCTCCTGATGCTGCTGG - Intronic
1185455655 X:309378-309400 AAGATCTCTGCGGATGCAGCTGG + Intronic
1186319080 X:8404523-8404545 AAAGTCTCTATTGAAGCTGCTGG + Intergenic
1186510065 X:10124199-10124221 CCGGTCGCTACAGATTCTGCAGG - Intronic
1189103281 X:38212598-38212620 GAGTTCACCACAGATGCTGCTGG + Intronic
1189202919 X:39213158-39213180 CAGGTTCCTACAGGTGCTGCTGG - Intergenic
1190972394 X:55363740-55363762 AAGGTCTATACAGACTCTGAAGG - Intergenic
1197702304 X:129608498-129608520 AAGGTCTTTGTAGATACTGCTGG - Intergenic
1197727364 X:129785471-129785493 AAGGACTATAGAGATGGTGCTGG - Intronic
1199430438 X:147753627-147753649 AAAGTCTTTACAGATTCTGGAGG - Intergenic
1199691038 X:150309133-150309155 AAGTTCTCCCCAGATGGTGCAGG - Intergenic