ID: 1108320187

View in Genome Browser
Species Human (GRCh38)
Location 13:49281934-49281956
Sequence CTGTAATCCCAGATACTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21848
Summary {0: 1, 1: 294, 2: 3190, 3: 7479, 4: 10884}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108320187_1108320198 30 Left 1108320187 13:49281934-49281956 CCCCCCAGTATCTGGGATTACAG 0: 1
1: 294
2: 3190
3: 7479
4: 10884
Right 1108320198 13:49281987-49282009 GTATTTTTAATAATAGAGACGGG 0: 1
1: 7
2: 109
3: 1474
4: 3529
1108320187_1108320197 29 Left 1108320187 13:49281934-49281956 CCCCCCAGTATCTGGGATTACAG 0: 1
1: 294
2: 3190
3: 7479
4: 10884
Right 1108320197 13:49281986-49282008 TGTATTTTTAATAATAGAGACGG 0: 1
1: 5
2: 151
3: 1648
4: 3556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108320187 Original CRISPR CTGTAATCCCAGATACTGGG GGG (reversed) Intronic
Too many off-targets to display for this crispr