ID: 1108320363

View in Genome Browser
Species Human (GRCh38)
Location 13:49283657-49283679
Sequence CAAGAGAAGCAGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1034
Summary {0: 1, 1: 0, 2: 7, 3: 108, 4: 918}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108320363 Original CRISPR CAAGAGAAGCAGAAGGAGGC AGG Intronic
900181844 1:1314579-1314601 CATGAGAGACAGAAGGAGCCTGG + Intronic
900424722 1:2571228-2571250 TCAGAGAAACAGAAAGAGGCAGG + Intergenic
900532963 1:3163668-3163690 CCAGGGAGCCAGAAGGAGGCCGG - Intronic
900541822 1:3206716-3206738 CAAGAGGGGCAGAGCGAGGCTGG + Intronic
900851047 1:5143344-5143366 TAAGAGAAGCAGGAGGAGGGAGG + Intergenic
900966230 1:5960632-5960654 CATGACAGGTAGAAGGAGGCTGG + Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901642886 1:10701942-10701964 CAAGAGAAGCCTCAGTAGGCAGG - Intronic
901897363 1:12325552-12325574 GTAGAGAAGTAGAAAGAGGCCGG - Intronic
902361596 1:15945133-15945155 CAAGAGGAGCAAGAGGAGGAGGG - Exonic
903021358 1:20397536-20397558 GAAGACAAGGAGAAGGGGGCTGG + Intergenic
903524647 1:23983903-23983925 AAAGAAAAGAAGAAAGAGGCCGG - Intergenic
903545312 1:24120306-24120328 GAAAAGAACCAGAAGGAGGCTGG - Exonic
903548223 1:24140559-24140581 TAACAGAAGCAGAAGTGGGCTGG - Intronic
903744227 1:25575930-25575952 CAAAAGCAGCAGCATGAGGCTGG + Intergenic
903825261 1:26140273-26140295 CAAGACAAGCAGAAGAGGCCGGG + Intergenic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904357045 1:29947022-29947044 AAAGAGAAGGAGGAGGAGGTTGG - Intergenic
904576251 1:31506915-31506937 AATGAGAAGCAAAGGGAGGCAGG + Intergenic
904625795 1:31801320-31801342 CAAGAAAAGAGGAAGGAGGTGGG - Intronic
904849779 1:33448592-33448614 AAAAAGAAGTAGAAGAAGGCAGG + Intergenic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
905061589 1:35144346-35144368 AAAGAGAATCAGAAGGAAACAGG - Intergenic
905488486 1:38324941-38324963 CAACAGAACCAGTAGGTGGCAGG - Intergenic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
905566768 1:38971799-38971821 AAAGAAAAGAAAAAGGAGGCCGG + Intergenic
905605349 1:39293657-39293679 TAACAGCAGCAGAAGGAGACAGG + Intronic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
906119418 1:43378678-43378700 CATGACAATAAGAAGGAGGCAGG + Intergenic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906192113 1:43905280-43905302 GAAGAGGAGCAGAAGGAGGCAGG - Intronic
906192134 1:43905352-43905374 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192145 1:43905391-43905413 GAAGAGGAGCAGAAGGGGGAGGG - Intronic
906192313 1:43906003-43906025 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192456 1:43906509-43906531 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906192485 1:43906638-43906660 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906668095 1:47635818-47635840 GAAGAGAAGGAGGAGGAGGATGG - Intergenic
907303528 1:53502190-53502212 GAAGAGAGGGACAAGGAGGCGGG + Intergenic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907659883 1:56382185-56382207 CCAGAGAAGAAGAAAGAGGGAGG + Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
908832009 1:68188698-68188720 CAAGAGAGGAAGAGGCAGGCAGG + Intronic
909308490 1:74114088-74114110 CAATAAGAGCACAAGGAGGCAGG + Intronic
910120211 1:83779841-83779863 CAAGAGAGGGAGAGGGAGACAGG + Intergenic
910864958 1:91779930-91779952 CACGAGAACCTGAAAGAGGCTGG - Intronic
910900763 1:92118236-92118258 CAAGAGGAGCCTAAGGAGACAGG - Intronic
911323742 1:96444964-96444986 CAAGAGATGTGGAAGGAGGAAGG + Intergenic
911371235 1:96997155-96997177 CAAAAGTAGCAGAAGGAGAAAGG - Intergenic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
912512944 1:110200890-110200912 CAAGAGGAGGAGGAGGAGGCAGG - Exonic
912950289 1:114116074-114116096 CAAGAGAGGCAGGTGGGGGCAGG - Intronic
913126029 1:115791128-115791150 CAAGGCAACCAGAAGGATGCTGG + Intergenic
913283797 1:117209657-117209679 CAGGAGAAGCAGTGGGTGGCAGG - Intronic
913653960 1:120943993-120944015 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
913656099 1:120961609-120961631 CATGACAAACAGAAGGAAGCAGG - Intergenic
913672945 1:121115498-121115520 CAAGAGAAGCACCTGGAAGCAGG + Intergenic
914024722 1:143902874-143902896 CAAGAGAAGCACCTGGAAGCAGG + Intergenic
914513286 1:148352971-148352993 GCAGAGAAGGAGGAGGAGGCAGG + Intergenic
914520657 1:148412841-148412863 CATGACAAACAGAAGGAAGCAGG - Intergenic
914644153 1:149638161-149638183 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
914718405 1:150269542-150269564 GGAGAGAAGCAAAAGGAGCCTGG + Intronic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
914805908 1:150991529-150991551 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
915017016 1:152743807-152743829 AAAGAGAGACAGAAGAAGGCAGG + Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915361619 1:155289400-155289422 CAGGAGGAGTAGGAGGAGGCAGG + Exonic
915555314 1:156657857-156657879 CACGAGAAAGGGAAGGAGGCCGG - Intronic
915599709 1:156914522-156914544 AAAGAGAAGCAGATGGGGCCTGG - Intronic
915770480 1:158417122-158417144 CAATTGAAGGAGTAGGAGGCTGG + Intergenic
915959254 1:160251056-160251078 CTTGAGTAGCAGAATGAGGCAGG - Intronic
916102936 1:161408268-161408290 AAAGAGAATCAGAAGGAAACAGG - Intergenic
916412306 1:164558902-164558924 GAGGAGGAGCTGAAGGAGGCTGG + Intronic
916657077 1:166885796-166885818 CAAGAGGAGAAGGAGGAGGAGGG - Intergenic
916664166 1:166950399-166950421 AAAGAGAAGGAGAAGGAGAGAGG + Intronic
916678007 1:167080465-167080487 AGAGAGAAGCACTAGGAGGCAGG - Intronic
916797512 1:168180328-168180350 GAGGAGAAGCAGATGGGGGCAGG + Intronic
917695600 1:177520082-177520104 AAAGAAAAGCAGAATGAGCCTGG + Intergenic
917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG + Intergenic
917829652 1:178866923-178866945 CAAGAGTAGCAGAAGTAGAATGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918011848 1:180594064-180594086 CAACAAAACCAGAAGAAGGCTGG - Intergenic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
919868531 1:201802482-201802504 AAAGAAAAGAAAAAGGAGGCCGG + Intronic
920578896 1:207086045-207086067 GAAGGGGAGCAGAGGGAGGCAGG + Intronic
920667827 1:207978682-207978704 CAAGAGAGGAAGAAGGTGCCAGG + Intergenic
920699781 1:208209164-208209186 CATGAGAACCAGAAGAAGCCTGG + Intronic
921343445 1:214157187-214157209 CAAGAGTAGCAGCAGTAGACAGG - Intergenic
921366319 1:214378077-214378099 CTAGAGAAGCAGAAGATGGCAGG - Exonic
921713182 1:218393460-218393482 CAAGATCAGTAGAAGGAAGCCGG - Intronic
921718401 1:218443350-218443372 AAAGAGCAGCATAAGGAGGCGGG + Exonic
921734794 1:218614574-218614596 CAAAAGCAGCAGAAGGAGGTGGG - Intergenic
922327156 1:224538630-224538652 AGAGAGAAGGAGGAGGAGGCAGG - Intronic
922625826 1:227041293-227041315 CTAGAGAAGGGGAAGGAGGGAGG - Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922770652 1:228181151-228181173 CAAGAGAGGCACAAGCGGGCTGG - Exonic
922779865 1:228243349-228243371 CAAGGGCTGCAGACGGAGGCTGG + Exonic
922902244 1:229146228-229146250 GAAGTGCAGGAGAAGGAGGCAGG + Intergenic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923123113 1:231012507-231012529 AGAAAGAAGCAGAGGGAGGCTGG - Intergenic
923202669 1:231727077-231727099 GAAGACAAGCAGGAGCAGGCAGG - Intronic
923266821 1:232322515-232322537 CATAAGGAGCAGAAGCAGGCAGG + Intergenic
923504241 1:234591766-234591788 ATATAGAAACAGAAGGAGGCTGG - Intergenic
923724912 1:236497358-236497380 TAAATGAAGCAGAAAGAGGCCGG - Intergenic
924082697 1:240415940-240415962 GAATAGAAGCTGAAGGAGGCTGG - Intronic
924486430 1:244487779-244487801 GCAGAGAGGCAGCAGGAGGCGGG + Intronic
924679864 1:246220616-246220638 CATGAACAGCAGCAGGAGGCAGG + Intronic
1062822349 10:543942-543964 CCAGAGAAACAGAAGTCGGCTGG - Intronic
1062922844 10:1293036-1293058 GAAGAGATGCAGAGGGAGGGAGG + Intronic
1063022571 10:2144361-2144383 CAAGAGAAGAAGAAGAAGATTGG - Intergenic
1063201989 10:3792961-3792983 CAAGAGGAGGAGGAGGAGGGAGG + Intergenic
1063435999 10:6031288-6031310 AAAGATAAGCATAAGGAAGCTGG + Intronic
1063534224 10:6867065-6867087 AAAGAGAAAGAGAAGGAGGGAGG - Intergenic
1063884884 10:10567479-10567501 GCAGAGAAGCAGAATGGGGCGGG + Intergenic
1063890732 10:10625667-10625689 AAAGAGAAGTTGAAGGAAGCTGG - Intergenic
1064312879 10:14227215-14227237 GAAGAGAAGGAGGAGGAGGAAGG - Intronic
1064913858 10:20434792-20434814 CAAGAGAGGCAGCAAGAGGCAGG - Intergenic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065932541 10:30492416-30492438 CAAAAGATGCAGACGGAGTCTGG + Intergenic
1066174888 10:32893278-32893300 TAAGAGCAACAGAGGGAGGCGGG + Intergenic
1067057479 10:43060703-43060725 CTAGAGAAGCAGAGTGGGGCAGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067432835 10:46255171-46255193 CAAGGAAAGCAGATGGGGGCAGG + Intergenic
1067558168 10:47286651-47286673 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1068550712 10:58404830-58404852 AAAGAAAGGCAGAAGGAGTCTGG - Intergenic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1069334689 10:67334436-67334458 CAAGAGAAGAAGAAAGCTGCTGG + Intronic
1069444291 10:68458550-68458572 AAAAAGAAGAAGAAAGAGGCTGG + Intronic
1069455390 10:68549924-68549946 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1069711956 10:70495336-70495358 CAAGAGAAGGAGAGGGAGGGAGG - Intronic
1070307744 10:75249690-75249712 CAAGAAAAGGAGAGGAAGGCTGG - Intergenic
1070483906 10:76911697-76911719 CAAGAGAGGCAGAGGGAAGCTGG - Intronic
1070759132 10:79012579-79012601 CAGGAGATGCAAAAGGCGGCTGG - Intergenic
1070791010 10:79189360-79189382 CATCAGAGGCAGAAGGAAGCTGG - Intronic
1072054962 10:91745729-91745751 AAAGAGAAGGAGAAGGAAGAAGG + Intergenic
1072193698 10:93096991-93097013 GAAGAGAACCAGCAGGAGCCGGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072279207 10:93850779-93850801 GAAGAGAAGCAGCAGGACGTCGG + Intergenic
1072302508 10:94075039-94075061 GAAGAGAAGGGGAAGAAGGCAGG - Intronic
1073057428 10:100711353-100711375 CAAGAAATGGAGTAGGAGGCTGG - Intergenic
1073100422 10:101003654-101003676 GAAGAGGAGGAGGAGGAGGCAGG - Exonic
1073482032 10:103791992-103792014 CAGGAGAGGCAGGAGGAAGCTGG + Intronic
1073794651 10:106974535-106974557 CAAGAGATCCACAAGGATGCAGG + Intronic
1073984604 10:109193784-109193806 CAAGACAAGCAGATGGATGGTGG - Intergenic
1074454848 10:113588076-113588098 CCAGAGAAGCCCACGGAGGCTGG + Intronic
1074454949 10:113588551-113588573 CAAGGGAGGCAGAAGAAGCCTGG - Exonic
1074456652 10:113601304-113601326 CAGGAGAAGCAGCTGAAGGCTGG + Intronic
1074536897 10:114334549-114334571 CAAGAGGAACAGGAGGGGGCTGG + Intronic
1075055483 10:119215391-119215413 TAAAAGAAGCAGAGGGAGGCAGG + Intronic
1075733666 10:124651318-124651340 CCAAAGGTGCAGAAGGAGGCTGG + Intronic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1077030585 11:464277-464299 CAAGAAAAGCAAAACGGGGCCGG - Intronic
1077352695 11:2100197-2100219 CAAGAGAGGCCGGAGGAGCCTGG - Intergenic
1077388676 11:2288826-2288848 CAAGAGCAACAGTTGGAGGCAGG - Intergenic
1077681620 11:4247053-4247075 CTACAGAAGGAGAAGGATGCTGG - Intergenic
1077862177 11:6192020-6192042 CAAGAGGAGAAAAAGGATGCTGG + Intergenic
1078030779 11:7748912-7748934 TGAGAGAAGGAGAAGGAGGTAGG - Intergenic
1078062884 11:8059862-8059884 CAAGGAGACCAGAAGGAGGCTGG + Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078759155 11:14237857-14237879 TAAGAGCAGCAGAAGTAGGAGGG + Intronic
1078894813 11:15588678-15588700 CAAGTGAAGAGGAGGGAGGCAGG + Intergenic
1079138945 11:17794965-17794987 CAGCAGATGCAGAAGGGGGCAGG - Intronic
1079318142 11:19427338-19427360 AAAGGGAAGCAGAAGGAAGAAGG - Intronic
1079561233 11:21822236-21822258 CAATAAAAGCAAAAGGAGGTGGG + Intergenic
1079996946 11:27305019-27305041 CATGAATAGCAGTAGGAGGCAGG + Intergenic
1080181076 11:29426775-29426797 CAAGATAAGCAGACGGTAGCAGG + Intergenic
1080229352 11:30001190-30001212 CAAGAGGAGCTGACAGAGGCAGG - Intergenic
1080478364 11:32619857-32619879 GAAGGGAAGGAGAAGGAGGAGGG + Intronic
1080886467 11:36372631-36372653 CAAGAGAAGCAGGGAGTGGCTGG + Intronic
1081494815 11:43597929-43597951 AAAGAAAAGCAGGAGGGGGCTGG - Intronic
1081720449 11:45285237-45285259 AAAGAGCAGCAGAAGGGGTCTGG - Intronic
1081781830 11:45718428-45718450 AATGAGGAGTAGAAGGAGGCAGG - Intergenic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1082879211 11:58021834-58021856 CTAGAGAAGCAGTGGGAGGCAGG + Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083434120 11:62630994-62631016 AAAGAGCAGAAGAATGAGGCAGG + Intronic
1083478334 11:62928001-62928023 CCAGAAGAGGAGAAGGAGGCAGG - Intergenic
1083575637 11:63789092-63789114 CTAGAAAAGAAGAAAGAGGCTGG + Intergenic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1084200075 11:67550890-67550912 CAACAGAAGGGGAAGCAGGCAGG - Intergenic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084447713 11:69213335-69213357 CCCCAGAAGCTGAAGGAGGCGGG + Intergenic
1084656588 11:70523211-70523233 CCAGAGCACCAGGAGGAGGCTGG + Intronic
1085477040 11:76795338-76795360 CAAGAGCAGCAGATGAAGGCGGG - Intronic
1086571632 11:88291504-88291526 CAAGAAAAGAAGAGGGAGGGAGG + Intergenic
1086575759 11:88337622-88337644 GGAGAGAAGCAGCAGGAGGGCGG + Exonic
1086642669 11:89178746-89178768 CAAGAGGAGAAGAATGATGCTGG - Exonic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087296657 11:96385130-96385152 CAAGAGAAGTGGAAAGATGCAGG + Intronic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1087940910 11:104095588-104095610 TGAGAGAAGAAGAAGGAGGGAGG + Intronic
1087985317 11:104671561-104671583 TCAGAGAAGCTGAAGGATGCAGG - Intergenic
1088248328 11:107840692-107840714 CCAGAGAAGCAGCAGGAGCCAGG - Intronic
1088494376 11:110418787-110418809 CCAGAGAATCAGCAGGAGGTAGG - Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1089134657 11:116239426-116239448 TAAGTGAAGAAGAAGGAGGTGGG - Intergenic
1089173158 11:116529394-116529416 CCAGAAAAGCAGTAGGAGGCTGG + Intergenic
1089256192 11:117195543-117195565 GAAGAGAATCAGAAGGAAGGAGG + Intronic
1089276263 11:117338063-117338085 CAAGAGCAGCAGAAGGCAGAAGG - Intronic
1089286292 11:117409996-117410018 GAAGAGGAGGAGGAGGAGGCAGG - Intronic
1089693332 11:120200033-120200055 CAAGAGAGGCAGGGGGAGCCAGG + Intergenic
1089798373 11:121002376-121002398 CAAGAGAAGAAGAAGAAGGGAGG + Intergenic
1089933598 11:122340130-122340152 AAAGAGAAGGAGGAGGAGGATGG + Intergenic
1089946461 11:122479256-122479278 CAAGAGAAACAGAATGCAGCAGG - Intergenic
1090521375 11:127483098-127483120 CAAGAGAAGGAAAAGGTGGCTGG + Intergenic
1090742919 11:129682347-129682369 CACCAGAAGCAGGAAGAGGCAGG - Intergenic
1090926145 11:131252012-131252034 CAAGAGAAACAGGGTGAGGCAGG - Intergenic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1091439264 12:499981-500003 CAAGAGCAGCCCAGGGAGGCAGG - Intronic
1091600063 12:1912628-1912650 ACAGAGGAGCAGAAGGAGGGTGG - Intronic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091706477 12:2696916-2696938 CAAGAGAAGCAAAAGAGGGTGGG + Intronic
1091721998 12:2820565-2820587 CAAGGGTAGCAGCAGGAGGAAGG - Intronic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1092964003 12:13624374-13624396 GAAGAGAAACAGAATGAAGCAGG - Intronic
1093698953 12:22195953-22195975 ACATAGAAGCAGAAAGAGGCAGG + Exonic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095435643 12:42184878-42184900 CAAGAGAACTAGAATTAGGCCGG + Intronic
1095958954 12:47821649-47821671 CAACAGAAGGAGAAAGGGGCTGG - Intronic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096204315 12:49707883-49707905 CAAGAGAAGTAGAAACAAGCAGG + Intronic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096692977 12:53332597-53332619 AAAAAGAAGCAGAAATAGGCAGG + Intronic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1096810111 12:54164011-54164033 CAAGAGAAGGGGAGGAAGGCAGG + Intergenic
1097033639 12:56107362-56107384 CTAGAGAAGCAAAAGGAGAAAGG + Intronic
1097458849 12:59834799-59834821 CAAGAGAAGCCAAAGGAAACAGG - Intergenic
1098064600 12:66600541-66600563 AAAGAAAAGCAGAAGTAGGAGGG - Intronic
1098708005 12:73715872-73715894 AAAGAGAAGGAGAAGGAGAGAGG + Intergenic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1100326323 12:93543211-93543233 CAAGTGAAGCAGAATAGGGCAGG + Intergenic
1100543166 12:95577048-95577070 CAAAAGAAACTGAAGCAGGCCGG - Intergenic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100665325 12:96746014-96746036 AGAGAGAGGCAGAAGGAGGCTGG - Intronic
1101147772 12:101857443-101857465 CAAGAGCAGGAGGAGGAGGAAGG - Intergenic
1101552205 12:105773498-105773520 CAAGAGAAGCAGGATGAGAGAGG + Intergenic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1101816091 12:108147281-108147303 CAAGAGAAGCAGGGTCAGGCGGG + Intronic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1101875116 12:108592342-108592364 CAACAGAAGGATGAGGAGGCTGG + Exonic
1101986502 12:109451495-109451517 CAAGGGAAGCAGAAGGGGCCCGG + Exonic
1102230337 12:111257516-111257538 AAAGAGGAGGAGAAGGAGGGAGG - Intronic
1102516399 12:113449770-113449792 CAAGACTAGCAGCAGGAGGCTGG - Intergenic
1102799154 12:115716469-115716491 TAAAGGAAGCAGGAGGAGGCTGG + Intergenic
1103192887 12:119017519-119017541 GATGGGAAGCAGCAGGAGGCTGG + Intronic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1103954964 12:124571006-124571028 CAACAGAGGGGGAAGGAGGCAGG + Intergenic
1104382747 12:128322151-128322173 CAAGAGAGACAGATGGAGGCTGG - Intronic
1104558546 12:129823609-129823631 CCAGGGAAGCAAAAGCAGGCTGG + Intronic
1106139251 13:26997830-26997852 AAACAGAAGCAGATGGAGGCTGG - Intergenic
1106175725 13:27329601-27329623 CAAGGGAAGCAGAAGGATCTAGG - Intergenic
1106548265 13:30749327-30749349 CATGAGAAAGAGAAGGAAGCAGG + Intronic
1106636558 13:31534847-31534869 CAAAAGAAACATAAGGAGGAAGG - Intergenic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1107072495 13:36286333-36286355 CAAAAGAGGCAGAAGGTGGTTGG - Intronic
1107096767 13:36545722-36545744 GGAGAGATGCAGAAGAAGGCAGG + Intergenic
1107112372 13:36711874-36711896 CAAGAGAAGGAGAAGGTTGCGGG - Intergenic
1107486086 13:40828799-40828821 CAAGAAAAGAAAAAGGAGGGTGG + Intergenic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108446064 13:50510251-50510273 CATGAGAAGCAGAGACAGGCTGG - Intronic
1108475019 13:50807402-50807424 TGAGAGAAGCAGGAGGAGGGAGG - Intronic
1108971301 13:56380522-56380544 CATGAGATTTAGAAGGAGGCAGG - Intergenic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1110356327 13:74571952-74571974 TAAGAGAAGCAGAAAGATGCAGG + Intergenic
1110377170 13:74806447-74806469 AAAGAGTAGCAGAAGATGGCAGG - Intergenic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1110678756 13:78283001-78283023 CAAGAGACATAGAATGAGGCAGG - Intergenic
1111961205 13:94812536-94812558 CAAGAGAAAGAGGAGGAGGGAGG - Intergenic
1112505684 13:99974095-99974117 CAAGAGTTGTACAAGGAGGCGGG - Intergenic
1112543639 13:100342649-100342671 CACCACAAGCAAAAGGAGGCAGG - Intronic
1113074353 13:106453222-106453244 CCAGAGAAGAAGACAGAGGCAGG + Intergenic
1113473689 13:110564542-110564564 CAACAGGAGCTAAAGGAGGCGGG - Intergenic
1113765917 13:112881210-112881232 CAAGGGGAGCGGCAGGAGGCCGG - Intronic
1113774043 13:112932404-112932426 CAAGAGGAGCTGAAGGAGACAGG + Intronic
1114173511 14:20298099-20298121 CAAGAGAAGCAAAAGAAGAAAGG + Intronic
1114322030 14:21555034-21555056 CAAGAGATGAAGAGTGAGGCTGG + Intergenic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1114519112 14:23321755-23321777 CAAGAGGAGGAGGAGGAGCCGGG + Exonic
1114630400 14:24155846-24155868 AAAGGGAAGCAGAGGGAGGGAGG + Intronic
1114631283 14:24161046-24161068 CAAGAGTATCTGAGGGAGGCAGG + Exonic
1114842059 14:26275840-26275862 CAACAGGAACAGAAGGAGGGAGG + Intergenic
1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115359894 14:32488807-32488829 CAAGGGGAGCAGAAGCAGGGTGG - Intronic
1116464044 14:45211965-45211987 TAAAAGAGGCAGAGGGAGGCTGG - Intronic
1116626568 14:47272436-47272458 CAAGAGAAGAAGAAGATGGGAGG + Intronic
1117679293 14:58186868-58186890 GGTGAGAAACAGAAGGAGGCAGG + Intronic
1117846863 14:59920480-59920502 CAAGAGAAGGAAAGGGAGGGTGG + Intronic
1117978701 14:61321695-61321717 GAGGAGAAGCAAGAGGAGGCGGG + Exonic
1118245287 14:64104350-64104372 CAAGAAAAGGAGATGGAGGAGGG - Intronic
1118275312 14:64381301-64381323 AAAGAGAAGAAGAAATAGGCCGG + Intergenic
1118297655 14:64585217-64585239 CAACAAAAGCAGAAGCAGGCCGG + Intronic
1118459571 14:65976093-65976115 GAAGAGGAGGAGAAGGAGGAAGG + Intronic
1118704544 14:68468706-68468728 CAAGATAACCAGAAGGAGTCAGG - Intronic
1118867325 14:69713624-69713646 CAAGGGTAGCAGCAGGTGGCAGG + Exonic
1119123022 14:72097573-72097595 GAAGAGGAGGAGAAGGGGGCGGG + Intronic
1119337178 14:73843648-73843670 CAAAAGAAAAAAAAGGAGGCGGG - Intergenic
1119442096 14:74635372-74635394 CTAGAGAAGCAGATGGGGGTGGG - Intergenic
1119643583 14:76331750-76331772 CAAACCAAGCAGAAAGAGGCAGG - Intronic
1119712787 14:76835006-76835028 CAAGAGAAGTAGCAGGTGGAAGG - Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119749448 14:77067083-77067105 CATGGGAAGCAGAAGAGGGCTGG - Intergenic
1121098460 14:91233869-91233891 CGAGGGAAGCAGGAGGCGGCAGG + Exonic
1121128127 14:91421197-91421219 CAAGGGTAGCAGAATGGGGCAGG - Intergenic
1121449129 14:93996582-93996604 CCAGAGAGGGTGAAGGAGGCAGG - Intergenic
1121565600 14:94907161-94907183 CAAGAGAAGAAAACGGGGGCGGG - Intergenic
1122273441 14:100578666-100578688 CTAGAGAAGAAGCAGGAGGTTGG - Intronic
1122354610 14:101115306-101115328 AACGAGATGCAGAAGGAGACGGG - Intergenic
1122626890 14:103089524-103089546 CCAGGGAGGCAGAATGAGGCTGG - Intergenic
1122731658 14:103804187-103804209 CAAGAAATGCAGGATGAGGCAGG + Intronic
1123151499 14:106185971-106185993 CCAGAGCAGGTGAAGGAGGCTGG - Intergenic
1123177938 14:106439647-106439669 GAAGAATAGCAGAATGAGGCAGG + Intergenic
1124013840 15:25860433-25860455 GAATAGAAGGAGGAGGAGGCTGG - Intronic
1124266653 15:28241523-28241545 CAAAAGAAGTAAAAGCAGGCCGG + Intronic
1124336793 15:28863200-28863222 CAAGAGAAGGTGGTGGAGGCTGG - Intergenic
1124635463 15:31361920-31361942 CAAGAGAAAAGGAAGGAGGGAGG - Intronic
1125359524 15:38850347-38850369 GAAGAGAAGAGGAGGGAGGCAGG + Intergenic
1125795793 15:42403095-42403117 CAGGAGCAGCAGAAGGACCCTGG - Intronic
1126288466 15:47043951-47043973 CAAGAGAAGCATGGGGGGGCAGG + Intergenic
1126666352 15:51078857-51078879 AAAGAGAGGCAGAGGAAGGCAGG - Intronic
1126786004 15:52178503-52178525 GAAGAAAGGCAGAAGGAGCCTGG + Intronic
1126888430 15:53177435-53177457 CAAGAACAGCAGATGAAGGCTGG - Intergenic
1127029440 15:54845487-54845509 AAAGAGCAGGAAAAGGAGGCGGG + Intergenic
1127142698 15:55993623-55993645 GAGGAGAAGCGGGAGGAGGCGGG + Intronic
1127381956 15:58438229-58438251 GGAGAGAGGCAGAAAGAGGCTGG + Intronic
1127831883 15:62758177-62758199 CAAGAGAAGCACGAGGGAGCAGG + Intronic
1127954643 15:63842760-63842782 AAAGATAATCATAAGGAGGCTGG + Intergenic
1128237906 15:66080044-66080066 AAAGAGAAGGAGACAGAGGCTGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128880396 15:71237093-71237115 CAAGAGATGCAGCAGGAGCCAGG + Intronic
1128965248 15:72051831-72051853 CATGAACAGCAGGAGGAGGCAGG + Intronic
1129327672 15:74809713-74809735 GAGGAGGAGCAGATGGAGGCAGG + Intergenic
1129601845 15:77003664-77003686 AAAAAGAAGAAGAAGGAAGCGGG + Intronic
1130059306 15:80558199-80558221 CAAGGGACTTAGAAGGAGGCTGG - Intronic
1130956281 15:88629515-88629537 GAAGAGAATGACAAGGAGGCTGG - Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131852113 15:96554582-96554604 AAAGAGTAGGAGAAGGAGGGAGG - Intergenic
1132149332 15:99448179-99448201 CTAGAGAAGCAGAGGCAGGGAGG + Intergenic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1132425298 15:101710811-101710833 CAAGAGAAGGAGAGGGGGGTGGG + Intronic
1132697049 16:1206689-1206711 CCAGAGAGGCTGAATGAGGCAGG + Intronic
1132706427 16:1245462-1245484 CAAGAGGAGCCGGAGGAGACAGG - Intergenic
1132790614 16:1684947-1684969 AAAGAGCAGCAGAAGTAGTCTGG + Intronic
1132979234 16:2727252-2727274 CAAAACAAGCAGAACAAGGCCGG + Intergenic
1133460758 16:5984197-5984219 GAAGAGAAGAAGAAGGGGGAGGG - Intergenic
1133762708 16:8812655-8812677 CAAGCACAGCAGAATGAGGCTGG + Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134330811 16:13249695-13249717 CAAGTGAAGGAGAAGGAAGAGGG - Intergenic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135727700 16:24869787-24869809 GAAGAGAAGTAGAGGAAGGCAGG - Intronic
1135943554 16:26843665-26843687 CAAAAGAAGCTGAAGGGGGCTGG - Intergenic
1136358693 16:29763586-29763608 CAAGAAAAGCACCAGCAGGCTGG + Intergenic
1136608621 16:31352978-31353000 ACAGAGAGGCAGGAGGAGGCTGG - Intergenic
1136777556 16:32879867-32879889 AAACAGAAGTAGTAGGAGGCTGG + Intergenic
1136893068 16:33981647-33981669 AAACAGAAGTAGTAGGAGGCTGG - Intergenic
1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG + Intronic
1137468227 16:48730584-48730606 AAAGAGCAGCAGAAAGAGGGCGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137749062 16:50845254-50845276 CCAGAGGAGCAGAGGGAGACTGG + Intergenic
1137840625 16:51637474-51637496 CAAGAGAGGGAGAAGAAGGAGGG + Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1137908830 16:52354600-52354622 CAAGTGCAGCAGAAAGAGGGAGG - Intergenic
1137975707 16:53029892-53029914 TCAGAGAAGCAGAAGTTGGCAGG - Intergenic
1138341157 16:56289891-56289913 CAAGAGAGGCAGTGGGAAGCTGG - Intronic
1138506759 16:57482158-57482180 CAAAAGAAGAAAAAGAAGGCCGG - Intronic
1138706534 16:58920936-58920958 GAAGACAAGCAGAAGCAGGGTGG - Intergenic
1138923610 16:61564066-61564088 CAAGAGATTAAGAAGGAGGAAGG - Intergenic
1138933868 16:61695073-61695095 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
1139307880 16:66003474-66003496 GGAGTGAAGCAGGAGGAGGCTGG - Intergenic
1139458876 16:67106607-67106629 CAATAGAAGCAGAAGGTGCCTGG - Intergenic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1140288701 16:73629569-73629591 AATGAGAAGAAGATGGAGGCTGG + Intergenic
1140685239 16:77427153-77427175 CAACAGAAGCTCAGGGAGGCTGG - Intronic
1140686473 16:77438306-77438328 TAAGAGGAGCAGAGGGAGGGAGG + Intergenic
1140948947 16:79797523-79797545 CACCAGAAGCTGGAGGAGGCCGG + Intergenic
1141489643 16:84363484-84363506 CATGAGAAGCTGGAAGAGGCAGG - Intergenic
1141704492 16:85657273-85657295 ACAGAGAAGCTGAAGGATGCCGG + Exonic
1141891752 16:86930858-86930880 GAAGAGGAGGAGAAGGAGGAGGG - Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142305657 16:89283501-89283523 CGAGAGAAGGAGAAGAAGGATGG - Exonic
1203079970 16_KI270728v1_random:1141976-1141998 AAACAGAAGTAGTAGGAGGCTGG + Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142762296 17:2049852-2049874 GACGCGGAGCAGAAGGAGGCGGG - Intergenic
1142944512 17:3413189-3413211 GGAGAGAAGCAGCAGGAGGGAGG + Intergenic
1143460170 17:7098381-7098403 CAAGAGGAGCTAAAGGGGGCAGG + Intergenic
1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG + Intronic
1144770969 17:17759226-17759248 CTAGAGAAGAAGAAGCGGGCAGG + Intronic
1145049131 17:19646196-19646218 CAAGAGTAGAAGCAGGGGGCCGG + Intergenic
1145207090 17:20990338-20990360 CACCAGAAGCTGGAGGAGGCAGG - Intergenic
1146831104 17:36070297-36070319 AAAGAGATCCAGAAGGAAGCTGG - Intronic
1147016327 17:37494618-37494640 AAAGAGAAGGAGCAGGAGGGAGG + Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147327358 17:39675878-39675900 CAAGAGGAGCAGAAGCAGCAAGG - Intronic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148047678 17:44753937-44753959 GAAGAGCAGCAGAAGGAAGGAGG + Intergenic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148540615 17:48477502-48477524 CAAGAGCAGAGGCAGGAGGCAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148820803 17:50358487-50358509 CAAGGGCAGCACAAGGAAGCGGG - Exonic
1148841052 17:50497491-50497513 AAAAAGAAGCAGAAGGGGCCAGG + Intergenic
1149185746 17:53995406-53995428 CAAGAGGAGCCTAAGGAGGTGGG + Intergenic
1149309031 17:55376320-55376342 CAAGAGGAGCCTAAGGAGACAGG + Intergenic
1149381445 17:56098059-56098081 AGAGAGAAGCAGAAGGAGATTGG + Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149719123 17:58825660-58825682 CTAGAGAATCAGACTGAGGCTGG - Intronic
1149798932 17:59548437-59548459 GAACAGAAGCAGAGGGAAGCAGG - Intergenic
1150345625 17:64402693-64402715 CCAGAGAGGCAGAGGGAGGCGGG - Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1150752395 17:67877268-67877290 CCACAGAAACAGAAGGAAGCAGG - Intronic
1150801580 17:68287311-68287333 AAAAAGAAGAAGAAGAAGGCTGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150923766 17:69511393-69511415 GAAGCGCAGCAGAAGGAGGCAGG - Intronic
1151200239 17:72462617-72462639 CACGAGGAGGAGAGGGAGGCTGG - Intergenic
1151250680 17:72831978-72832000 GAAGAGGAGGAGAAGGAGGTTGG + Intronic
1151560330 17:74866392-74866414 CAGGGGCTGCAGAAGGAGGCCGG - Intronic
1151895128 17:76974941-76974963 CATGAACAGCAGCAGGAGGCAGG + Intergenic
1152019646 17:77773820-77773842 TAAGAAAATCATAAGGAGGCTGG - Intergenic
1152033765 17:77859268-77859290 GAAGAGAGGGAGAGGGAGGCAGG + Intergenic
1152214926 17:79026613-79026635 CAAGAGGAGGAGAGGGAGGCGGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152732540 17:81979425-81979447 CATGAGAAGCTGGAAGAGGCAGG - Intronic
1152795972 17:82306522-82306544 CAAGAAAATGAGAACGAGGCCGG - Intergenic
1152845669 17:82598335-82598357 CAAGAGAGGCTGAGGCAGGCGGG - Intronic
1152930474 17:83107180-83107202 CACCAGAAGCTGAAAGAGGCAGG + Intergenic
1153780108 18:8486965-8486987 GATGAGAAGAAGAAAGAGGCAGG - Intergenic
1153810059 18:8744536-8744558 CACAAGAAGCAGCAGGAAGCAGG - Intronic
1153833880 18:8947326-8947348 AAAAAAAGGCAGAAGGAGGCTGG + Intergenic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1154166300 18:12017027-12017049 CAAGGGAAGCAGAAAGAGAGAGG - Intronic
1154489910 18:14913352-14913374 CAAGCTACCCAGAAGGAGGCTGG + Intergenic
1154494193 18:14944012-14944034 CAAGACAAGGAGAGGGAGGGAGG + Intergenic
1155086887 18:22467603-22467625 CAGGAGCAGCAGGAGGGGGCTGG + Intergenic
1155163516 18:23214660-23214682 CAAAAGGAGCACAAGGAGGAAGG - Intronic
1155185502 18:23383529-23383551 CAGGAGCAGCAGAAGGTGACAGG + Intronic
1155881732 18:31157658-31157680 CATGAGAAGCAGAAAAAGGGAGG + Intronic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156488235 18:37480226-37480248 GCAGAGAAACAGAAGGTGGCAGG + Intronic
1156883008 18:42103136-42103158 CAAGAAGGGCAGATGGAGGCCGG + Intergenic
1157193509 18:45600710-45600732 CAAGGGAGGCAGCAGGAGGTAGG + Intronic
1157213606 18:45763952-45763974 TAAGAGATGCTGATGGAGGCTGG + Intergenic
1158127739 18:54120716-54120738 CAAAGGAAACAGAAGAAGGCTGG + Intergenic
1158443721 18:57500621-57500643 CTAGAGAAACAGAAGCACGCAGG + Intergenic
1158725502 18:59968224-59968246 CAAGAGACAGAGATGGAGGCAGG + Intergenic
1159491502 18:69140749-69140771 CAAGAGAAGAAGAAGGGGGTGGG + Intergenic
1159507599 18:69357033-69357055 CAAGAGAAGCATAAGGATGCTGG - Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1159996262 18:74968377-74968399 CAAGAGAAGCAGAAGTATGGGGG - Intronic
1160187784 18:76688841-76688863 CAGGAGGAGCAGAAGCAGCCGGG + Intergenic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161552754 19:4923267-4923289 CAGGAGGAGCAGACGGAGCCAGG - Intronic
1161610548 19:5240059-5240081 CAGGAGAAGCAGAAGGGGTGAGG + Intronic
1161829568 19:6592502-6592524 CGAGAACAGCAGCAGGAGGCTGG - Intronic
1162339205 19:10081732-10081754 GAAGAGAAGGAGGAGGAGGGAGG + Intergenic
1163039346 19:14590992-14591014 AAAGAGACGCAGAAATAGGCTGG - Intronic
1163162120 19:15470938-15470960 CTCGAAAAGAAGAAGGAGGCCGG - Intronic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1163505548 19:17703935-17703957 CAAGAGGAGGAGACGGAGGCAGG + Intergenic
1163851646 19:19667788-19667810 AAAAAGAAGCAGGAGGCGGCTGG + Intergenic
1163983183 19:20921073-20921095 AAAGAAAAACAGAAGCAGGCCGG - Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164734757 19:30532636-30532658 AAAGGGAAGCTGAGGGAGGCCGG + Intronic
1164813223 19:31174787-31174809 GATGAGAACCAGAAGGAGCCAGG + Intergenic
1164858637 19:31544966-31544988 AAAGAGAAGGAGGAGGAGGGAGG - Intergenic
1164858645 19:31545018-31545040 AAAGAGAAGAAGGAGGAGGGAGG - Intergenic
1165069753 19:33248494-33248516 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1165303424 19:34987840-34987862 CAACAGAAGCTGGAAGAGGCAGG + Intergenic
1165690932 19:37862582-37862604 AGAGGGAAGCAGAAGGAAGCAGG + Intergenic
1166034961 19:40161420-40161442 GAAGAGAAGCAGAAGGGGAAGGG + Intergenic
1166036006 19:40169096-40169118 AAAGAGAAGCAGAACAGGGCTGG + Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166322701 19:42028483-42028505 CAGGAGGGGCAGAAGGTGGCTGG - Intronic
1166617375 19:44262299-44262321 CAAGAGAAGGACAGGGAAGCTGG + Intronic
1166686033 19:44796884-44796906 CAAGAGAGCCAGCAGGAAGCGGG + Intronic
1166808021 19:45498554-45498576 GAAGAGGAGGAGGAGGAGGCGGG + Exonic
1167084918 19:47302831-47302853 GAAAAGAAGAAGAAGAAGGCCGG - Intronic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167179186 19:47889239-47889261 CAAGAGGAGCCCAAGGAGACAGG - Intergenic
1167342320 19:48923045-48923067 CAAGAGGTCCAGGAGGAGGCTGG - Exonic
1167380684 19:49136298-49136320 CAAGAGAGGAAGTTGGAGGCCGG + Intronic
1167449840 19:49560621-49560643 CACGAGAAGAAGAAGGACACAGG - Exonic
1167637591 19:50664099-50664121 AAAGAAAAGAAAAAGGAGGCTGG - Intronic
1167758895 19:51430983-51431005 AAAGAGAAAGAGTAGGAGGCTGG - Intergenic
1168078294 19:53992186-53992208 CAAGAGAGGCAGTAGGACCCCGG - Intergenic
1168110151 19:54187719-54187741 AAAGAAAAGCAGATGAAGGCCGG + Intronic
1168384888 19:55954891-55954913 CAAGAGCAGCAGAAGTTGGTCGG - Exonic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
1168583004 19:57570805-57570827 GTAGAGAATCAGAAGGAGCCTGG - Intergenic
925047804 2:787883-787905 GAAGAGAAGCAGGTTGAGGCAGG + Intergenic
925142307 2:1558715-1558737 TAAGAAGATCAGAAGGAGGCAGG - Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925589225 2:5493498-5493520 CAAGTGAGGGAGAAGGGGGCCGG - Intergenic
925652814 2:6109882-6109904 CAAATGCAGCAAAAGGAGGCAGG - Intergenic
926103386 2:10135204-10135226 CAATAGAATCAAAAGGAAGCTGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926590071 2:14731175-14731197 CAAGAGAGGCAGAATGGAGCCGG + Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
926997390 2:18751191-18751213 CAAGAGAAGCTGAATGATGGGGG - Intergenic
927013614 2:18932517-18932539 CAAGAGGAGCCTAAGGAGTCTGG - Intergenic
927187354 2:20491316-20491338 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
927506115 2:23615925-23615947 AAAGAGAAGCAGAGGGGGTCTGG - Intronic
927724341 2:25409750-25409772 AAAAAGAAGAAAAAGGAGGCAGG - Intronic
927849708 2:26491160-26491182 CAAGAGGAGCAGCAGGCAGCGGG + Intronic
928100826 2:28436609-28436631 CACGAGAAGCAGCAGGCTGCAGG - Intergenic
928143287 2:28749605-28749627 CAAGTGAGGCAGAGGGAGGCCGG - Intergenic
928368817 2:30723801-30723823 CAAGAGAGGTGGAGGGAGGCAGG - Intronic
928508290 2:31977104-31977126 ATAGAGAAGCAGAAGACGGCAGG + Intronic
928562515 2:32505180-32505202 CAAGAGATGCAAGATGAGGCTGG - Exonic
928731752 2:34239934-34239956 CAAAAGAGGAAGAAGCAGGCAGG + Intergenic
929464182 2:42129891-42129913 CATGAGGGACAGAAGGAGGCAGG + Intergenic
929684893 2:44025060-44025082 CAAGAGAGGCAGAAAGAAGAGGG - Intergenic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
930029025 2:47047162-47047184 CAAGAGGATCAGGAAGAGGCAGG - Intronic
930112874 2:47694190-47694212 CCTGATAAGCAGAAGGAGCCAGG + Intergenic
930208183 2:48609138-48609160 TAAGACAAAAAGAAGGAGGCAGG - Intronic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
931106374 2:59061091-59061113 CAACAAAACCAGAATGAGGCCGG + Intergenic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931473441 2:62563830-62563852 AAAGTGAAGTAGAAGGAGGCAGG + Intergenic
931740132 2:65234724-65234746 TAAGAGAAGCTGGAGGTGGCAGG - Intronic
931750349 2:65324693-65324715 CAAGGGAAGCTCAAGGAGGGAGG + Intronic
931754659 2:65362219-65362241 CAAGTGCTGCAGAAGCAGGCTGG - Intronic
931754776 2:65362958-65362980 CAAGTGCTGCAGAAGCAGGCTGG - Intronic
931858380 2:66328049-66328071 CCAGAGCGGCAGAAGGAGACTGG + Intergenic
932465181 2:71917120-71917142 CATGAGAAGAAGAAGGAGCCTGG - Intergenic
933156624 2:78982585-78982607 AAAGGAGAGCAGAAGGAGGCTGG - Intergenic
933727201 2:85433702-85433724 CAAGGGAAGCAGATGGAGCCAGG - Intronic
933938485 2:87226078-87226100 GAAGAGAAGGGGAAGGGGGCTGG - Intergenic
933938754 2:87228102-87228124 AGAGAGAAGCAGGAGGCGGCTGG - Intergenic
933982912 2:87568124-87568146 CAAGAGAAGCCTAAGGAGATGGG + Intergenic
934117706 2:88812236-88812258 CAAGGGAGGCAGGAGGAGTCAGG - Intergenic
934616094 2:95772192-95772214 GAAGAGAAGCAGAGGCAGGAGGG - Intergenic
934644802 2:96052368-96052390 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934838213 2:97608457-97608479 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
935063267 2:99626468-99626490 GAAGAGAAGGAGAGGGAGGGAGG - Intronic
935133904 2:100281805-100281827 GAAAAGAGGCAGAAGGGGGCAGG + Exonic
935846481 2:107171328-107171350 CAAGAGGAGCTTAAGGAGACAGG - Intergenic
936161373 2:110086302-110086324 CAAGGGAGGCAGGAGGAGCCAGG - Intronic
936183290 2:110285052-110285074 CAAGGGAGGCAGGAGGAGCCAGG + Intergenic
936310928 2:111382670-111382692 CAAGAGAAGCCTAAGGAGATGGG - Intergenic
936354382 2:111737673-111737695 AGAGAGAAGCAGGAGGCGGCTGG + Intergenic
936616697 2:114055355-114055377 CAAGGGATGCAGATGGAGGGAGG - Intergenic
936832824 2:116669801-116669823 GAAGAGGAGGAGAAGGAGGAAGG - Intergenic
937332777 2:121042641-121042663 CAAGAGAAGTGGAAGGGGCCTGG + Intergenic
937379984 2:121367760-121367782 GTAGTGAAGTAGAAGGAGGCCGG - Exonic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938224886 2:129607075-129607097 GAAGAGAAACAGAAGGCTGCAGG - Intergenic
938623166 2:133078622-133078644 CAAGACAAGGAGAATGAGACAGG + Intronic
939345622 2:140963658-140963680 CTAGAAAAGCAAAAGCAGGCTGG + Intronic
939967367 2:148623682-148623704 CAAGAAAAGGAGAAGAAGGATGG - Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940325811 2:152423892-152423914 CAAAAGAAGAGGAAGGAGGTGGG - Intronic
940330362 2:152467447-152467469 CGAGGGAAGAAGCAGGAGGCAGG - Intronic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
940964101 2:159818518-159818540 CAAGAGGAGCTTAAGGAGGCAGG + Intronic
940977917 2:159967080-159967102 CAAGAGTAGGAGATGGAGTCTGG + Intronic
941111351 2:161421739-161421761 TAAGAGAAGTAGAGGGAGGCAGG - Intronic
941732425 2:168933345-168933367 TAAGACAAGTAGAAGGAGACAGG - Intronic
941754613 2:169171639-169171661 CCAGAGAAGTAGAGGGAGGAAGG - Intronic
941774057 2:169372695-169372717 CAAGAGAAGCTTAAGGAGATAGG - Intergenic
943033743 2:182715978-182716000 CAACGGAAGCAGGAAGAGGCGGG + Intergenic
943787918 2:191899490-191899512 CAAAAGAAGCAGAAGGAAAACGG + Intergenic
943937700 2:193943352-193943374 AAAGAGGAATAGAAGGAGGCAGG + Intergenic
944299955 2:198112367-198112389 CAAGAGAAACAAGAGGAGGCTGG - Intronic
944446742 2:199799417-199799439 CTACAGAAGCAGAAGGCAGCCGG - Intronic
944844280 2:203653475-203653497 AAAGAAGAGCAGAATGAGGCCGG + Intergenic
945513618 2:210733741-210733763 GAAGAGAAGAAGGAGAAGGCGGG - Intergenic
945517050 2:210775281-210775303 CAAGAGCAGCACTAGGAGGATGG - Intergenic
945853199 2:215034706-215034728 AAACAGAAGCTTAAGGAGGCTGG - Intronic
946068979 2:217014888-217014910 CATGAGAAGCTAAAGGAGGCTGG + Intergenic
946524676 2:220505546-220505568 CAAGAGAGGGAGAGAGAGGCAGG + Intergenic
946693115 2:222324689-222324711 CAAGAGGAGCCTGAGGAGGCAGG + Intergenic
947074837 2:226331224-226331246 CAAGAAAAGCTGAAGGAGAAAGG + Intergenic
947480563 2:230495752-230495774 CAAGAGAAGCATAAGTAGAATGG - Intronic
947898268 2:233695418-233695440 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
947970601 2:234319924-234319946 GAAGAGAAGAAGGAGGAGGAGGG - Intergenic
948347679 2:237312916-237312938 GAAGAGAGGAAGAAGGAGGTGGG - Intergenic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
1169045541 20:2531884-2531906 GGAGAGAAGGAGAAGGAGGAGGG + Intergenic
1169677669 20:8172831-8172853 CCAGAGAAGCAGCATGGGGCAGG + Intronic
1169792058 20:9421631-9421653 GAGGAGAACCAAAAGGAGGCAGG - Intronic
1170158493 20:13289653-13289675 GAAGAGAAGGAGGAGGAGGAGGG + Intronic
1170641929 20:18162112-18162134 CCAGAGAAGGAGAAGGAGATGGG - Exonic
1170779626 20:19412611-19412633 CAAGAGGAGGAGGAGGAGGAGGG + Intronic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172365242 20:34344052-34344074 AAAAAGAAGAAGAAGGTGGCAGG - Intergenic
1172728200 20:37063806-37063828 CAAGAAAAAAAGAAAGAGGCCGG - Intronic
1172849113 20:37947811-37947833 CAAAAGAAGAAGAAGGTGCCTGG + Intergenic
1173019394 20:39254411-39254433 CACGAGAAGAAGAAGGAGGGAGG - Intergenic
1173134202 20:40424905-40424927 GAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1173226009 20:41162861-41162883 CTAGAGCAGCAGATGGGGGCAGG - Intronic
1173249651 20:41357816-41357838 CCAGAGAAACAGATGGGGGCTGG + Intronic
1173253224 20:41375461-41375483 CCAGAGAAACAGGAGGAGGATGG - Intergenic
1173538342 20:43832632-43832654 TAAGAGAAGCAGGAGGCAGCAGG - Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173971865 20:47159444-47159466 CCAGAGAAGCCTAAGGAGACAGG + Intronic
1174607364 20:51770489-51770511 CAAGAGAAGACCAAGGAGGCCGG + Intergenic
1174615031 20:51828951-51828973 CCAGAGAAGCAGCAGGGGACCGG - Intergenic
1174885286 20:54327571-54327593 CACCAGAAGCTGCAGGAGGCAGG - Intergenic
1175006508 20:55689231-55689253 GAAGAAAGGCAGAAGGAGCCTGG - Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1175122531 20:56727193-56727215 CAAGAAGAGCATAAGGAGACAGG - Intergenic
1175334246 20:58184830-58184852 CAATGGAAGCAGAGAGAGGCTGG + Intergenic
1175534841 20:59702323-59702345 CAAAAGAACAGGAAGGAGGCTGG - Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175902190 20:62364358-62364380 CACGAGCAGCAGAGGGAAGCTGG + Intronic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176387602 21:6146572-6146594 AAACAGAAGCAGTAGGAGACGGG + Intergenic
1176942819 21:14944471-14944493 CCAGAGATGGAGAAGGAGACTGG + Intergenic
1177606255 21:23381354-23381376 CACGAGAAGCAGCAAGAGGGAGG - Intergenic
1178098779 21:29243521-29243543 CAAGAGAGGCAGGAGGTGCCAGG + Intronic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1178624114 21:34201551-34201573 CAAGAAATGCAGAAGGTGGCAGG - Intergenic
1179305091 21:40146289-40146311 TCAGAGAAGTAGAAGGAGGATGG + Intronic
1179735870 21:43391676-43391698 AAACAGAAGCAGTAGGAGACGGG - Intergenic
1181019629 22:20092550-20092572 CCAGAGGGGCAGCAGGAGGCTGG - Intronic
1181294758 22:21827960-21827982 GAAAAGAAGCTGAAGAAGGCAGG + Intronic
1181372435 22:22429037-22429059 CCAGAGCAGGAGAATGAGGCTGG - Intergenic
1181646115 22:24232539-24232561 AGAGAGAGGAAGAAGGAGGCCGG + Intronic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1181943473 22:26497050-26497072 CAAGAGAACAAGGAAGAGGCAGG - Intronic
1182286327 22:29250352-29250374 CAAGAGAAGAAGAAAAAGGCAGG - Intronic
1182888088 22:33793022-33793044 CCAGAGGAGGAGACGGAGGCAGG + Intronic
1183284490 22:36953534-36953556 CAAGGGGAGCAGGAGGAGGGTGG + Intergenic
1183385572 22:37512287-37512309 CAAGAGTGGCAGCAGGTGGCAGG + Intronic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1184321717 22:43746976-43746998 CCAGATAAGCAGCAGGATGCTGG - Intronic
1184379418 22:44135771-44135793 CACCAGAAGCTGGAGGAGGCAGG - Intronic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1185256517 22:49836343-49836365 CACCAGAAGCCGAAAGAGGCAGG + Intergenic
949104016 3:181766-181788 CAAGAGAAGAAGATGCAGGAGGG - Intergenic
949575186 3:5331887-5331909 AAAGAGGAGAAGAAGGGGGCAGG - Intergenic
949815295 3:8051952-8051974 CAAGAGGAGCATAATTAGGCTGG + Intergenic
950072206 3:10161705-10161727 GAAGAGAAGGAGAAGCAGGTAGG + Intergenic
950088781 3:10280033-10280055 AAAGTGAAACAAAAGGAGGCTGG - Exonic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950773365 3:15330028-15330050 GCAGGGAAGCAGAAGGAGGCGGG + Intronic
951914082 3:27781140-27781162 CAAGAGAAGCACAAGGAGACAGG + Intergenic
952240457 3:31526984-31527006 CATTAGAAGCAGAGGAAGGCCGG - Intergenic
952881533 3:37989038-37989060 CCAGAGACACAGAGGGAGGCTGG + Intronic
953136680 3:40187950-40187972 CAAGAGCAGCAGAGAAAGGCAGG + Intronic
953943976 3:47129587-47129609 CAAGAGAAGGAGATACAGGCTGG + Intronic
954181598 3:48885507-48885529 CAAGAAAAACAGAACAAGGCTGG + Intronic
954245370 3:49327239-49327261 AAAGAGAACCAGAAACAGGCTGG + Intronic
954508270 3:51097872-51097894 CCAGGGAAGCACAAGGAGTCAGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955639859 3:61070611-61070633 GAAGAGAAGGAGCAGAAGGCAGG - Intronic
956051154 3:65249874-65249896 CAAGAGGTGGAGAAGGATGCTGG - Intergenic
956420494 3:69081738-69081760 CATGTGATGCAGAAGGAGGCTGG - Intergenic
956516368 3:70052920-70052942 CAAGAGAAGCAGAAAGAAAAGGG - Intergenic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
956747935 3:72324221-72324243 CAAGGGAAGAGGAAGGTGGCAGG - Intergenic
956778946 3:72589479-72589501 CATGAGAAGAAGAAGAAGGATGG - Intergenic
956882121 3:73521101-73521123 CAAGAGAAAAAGGAGGAGACAGG + Intronic
957305343 3:78450831-78450853 CAAGAGAGGGAGAAGGTGTCAGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960303714 3:116035455-116035477 CAAGAGAAGGAAAAGGGGGTGGG + Intronic
960542832 3:118880352-118880374 GAAGAGAAGCAGATGGTGACTGG - Intergenic
960575277 3:119223098-119223120 GAAGAGAGGAAGAAGAAGGCAGG - Intronic
960912772 3:122665938-122665960 AAAGAGAAGCAGTAGGGGCCTGG + Intergenic
961228049 3:125271815-125271837 TAAAAGAACCAGAAGGAGGCAGG - Intronic
961616937 3:128189845-128189867 AAAAGGAAGTAGAAGGAGGCTGG - Intronic
962226945 3:133620928-133620950 CATGAGAGTCAGAAGCAGGCAGG - Intronic
962960537 3:140307333-140307355 CAAGGAGAGCAGGAGGAGGCCGG - Intronic
962966877 3:140363885-140363907 AATGAGGAGCAGTAGGAGGCAGG + Intronic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
963928714 3:150979190-150979212 GGAGAGAAGCAGAAGGAGTAGGG + Intergenic
963972963 3:151449828-151449850 TAAGAGAAGCAGATGGATGCAGG + Intronic
964006267 3:151832970-151832992 CAAGAAGAGCAGGAGGAGGGAGG + Intergenic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964576047 3:158169667-158169689 CAAGAGAAGCAGATGGGGTTAGG - Intronic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965329155 3:167348379-167348401 AAAGAAAAGAAGAAGGAGGGAGG + Intronic
965580972 3:170267375-170267397 AAAGAAAAGCAGTAGTAGGCCGG + Intronic
965749384 3:171960502-171960524 TAAGAAAAGCAAAGGGAGGCCGG + Intergenic
966153931 3:176895677-176895699 TAAGACAAGCAAAAGGAGACTGG + Intergenic
966809789 3:183833361-183833383 CAACGGAAGCAGAAGCAGGTGGG - Intronic
966882268 3:184357274-184357296 GAAGAACAGCAGAGGGAGGCAGG + Intronic
967200383 3:187067538-187067560 GAAGAGAAACAGAAAGTGGCTGG - Intronic
967644399 3:191903772-191903794 CAAGTGAAGAAGAAAGAGGAAGG - Intergenic
967818589 3:193819296-193819318 AAAGAGAAGCCGAGTGAGGCTGG - Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
968672158 4:1857431-1857453 GCGGAGAAGCAGGAGGAGGCAGG - Intergenic
969297232 4:6277356-6277378 ACAGAAAAGCAGAGGGAGGCAGG - Intronic
969461308 4:7330562-7330584 CATGCCAAGCAGAAGGAGCCAGG - Intronic
969506455 4:7591187-7591209 CAAGAGAAGAAGGAGAAGGTGGG - Intronic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970727107 4:19060031-19060053 CCCGGGAAGCAGAAGGAGTCAGG + Intergenic
971386481 4:26145011-26145033 AAAAAGAAGAAGAAGAAGGCAGG - Intergenic
972351998 4:38244559-38244581 CAAGGGAAGGAGGAGGGGGCCGG - Intergenic
973634146 4:52846389-52846411 CAAGAGAAGCAGAAAGCTTCCGG + Intergenic
974049823 4:56930406-56930428 TAAGAAAAGCAAAAGGAAGCTGG + Exonic
974328465 4:60445477-60445499 CAAGAAAAGCAAAAAGATGCAGG - Intergenic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
975136135 4:70876083-70876105 CAAGAGAGGAAGAAAGAGGTGGG - Intergenic
975290242 4:72670088-72670110 CAAGAGAAAGTGAAGAAGGCAGG + Intergenic
975888241 4:78991811-78991833 AGAGAGCAGCAGCAGGAGGCTGG + Intergenic
975969403 4:80015712-80015734 GAAGAGAAGAAGCAGGAGGAGGG + Intronic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
976605567 4:86979391-86979413 TAAGAGAAGCAGGGGCAGGCTGG - Intronic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
977434122 4:96971491-96971513 TAAGAGAAGCAGAAGGAATTAGG - Intergenic
977522354 4:98100970-98100992 TAAGAGCAGCTGAAGGAGGCGGG - Intronic
977672648 4:99714205-99714227 GAAGAGAACCTGAAGGAGGCAGG + Intergenic
978665710 4:111178574-111178596 CAAGAGAAGGAGAAAGAAGCAGG - Intergenic
979604365 4:122622072-122622094 CAAGAGAAGCAGAAGAAAGGAGG - Intergenic
979652743 4:123155001-123155023 CAAGAGAACAATAAGGAGGAGGG - Intronic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
980784320 4:137532632-137532654 AAAGAGACGGAGAAGGAGGAAGG + Intergenic
982305347 4:153924566-153924588 TAAGAGATGCAGAAGATGGCAGG - Intergenic
983081252 4:163387671-163387693 GCAGAGAAGCAGTACGAGGCAGG + Intergenic
983608887 4:169620561-169620583 GAAGAGAAGCGGCAGGAGTCAGG - Exonic
983698259 4:170559503-170559525 GAGGAGAAGCAGGAGCAGGCAGG - Intergenic
983720456 4:170845250-170845272 GAAGAGAAGGAGAAGGTGTCAGG + Intergenic
984624781 4:181994990-181995012 TAAGAAAAGTAGAATGAGGCTGG + Intergenic
984836726 4:184029171-184029193 AAAGAGAAGGAGCAGGAGGTGGG - Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
985573987 5:665300-665322 CAAGAGGAGCAGGAGGAAGGGGG + Intronic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985679994 5:1250943-1250965 GAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985884340 5:2664981-2665003 AGAGAGGAGCAGAAGAAGGCTGG + Intergenic
986009681 5:3700900-3700922 GAAAAGAAGAAGAAGGAGGGAGG - Intergenic
986267888 5:6206004-6206026 CCAGAGAAGCACAAGCAGGTTGG + Intergenic
986454162 5:7899042-7899064 CAAGAGAGGGAGCAAGAGGCAGG + Intronic
986604100 5:9504432-9504454 CTAGAGATGCAGAAGTAAGCAGG + Intronic
986605684 5:9520849-9520871 CAAGAGAAGCCTAAGGAGACAGG + Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987292358 5:16520858-16520880 AAAGAGGAGCAGGAGGTGGCAGG + Intronic
988454317 5:31373651-31373673 CAACAGAAGCAGGAGGAGGCAGG - Intergenic
988563024 5:32298000-32298022 CAACAGAACCAGAAGCAGGCAGG + Intronic
988565947 5:32320249-32320271 CATGAACAGCAGCAGGAGGCAGG - Intergenic
988677269 5:33445336-33445358 GAAGAGAAGCAAAAGGAAGGAGG + Exonic
989120178 5:37997282-37997304 CAAGAGGAGAAAAAGGAGGCAGG - Intergenic
989159057 5:38372453-38372475 AAAAAGAAGCAGTATGAGGCCGG - Intronic
989175805 5:38524599-38524621 CAAGAGGAGCAAAAGGAATCGGG + Intronic
989262359 5:39432509-39432531 CCAGAGAAGGACAAGGAGCCTGG - Intronic
989706116 5:44332882-44332904 CAAGAGAATGAGAAGGAGACGGG + Intronic
989708863 5:44372197-44372219 CACCAGAAGCTGAAAGAGGCAGG - Intronic
989981707 5:50653760-50653782 CAAGAGAATCAGGAGGAAGAGGG - Intergenic
990156376 5:52882202-52882224 CAAGAGAAGGATAAGAAGGATGG - Intronic
991195627 5:63929283-63929305 CAAGGGATGCAGAAGCAGCCAGG + Intergenic
991860883 5:71011996-71012018 TAAGAGCAGTAGAAGGAGGGTGG + Intronic
992072048 5:73157269-73157291 CAACAGAAACAGAATGTGGCAGG + Intergenic
992667126 5:79021458-79021480 CAACAGCAGGGGAAGGAGGCTGG + Intronic
993436493 5:87901939-87901961 CAGGAGAACCAGAAGAATGCAGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994314501 5:98316608-98316630 GGAGAGAAGCAGAATTAGGCAGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994670099 5:102754470-102754492 AAAGGGATGCAGATGGAGGCGGG + Intronic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
995470419 5:112496058-112496080 CAAGAGGTCCAGAAGTAGGCAGG + Intergenic
995497035 5:112757435-112757457 CAAAAAAGGCAAAAGGAGGCTGG + Intronic
996330193 5:122320039-122320061 CAAGAGAAGCTGAAGGCTGAGGG - Intronic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
997232822 5:132256742-132256764 CGAGAGAACCAGAGGGAGGTTGG + Intronic
997338708 5:133125873-133125895 CCAGAGAAATGGAAGGAGGCTGG + Intergenic
997439234 5:133897566-133897588 CAAGCCAAGGATAAGGAGGCAGG + Intergenic
997753165 5:136369571-136369593 CAAGAGACAGAGAAGGAAGCTGG - Intronic
998267177 5:140674836-140674858 CAAGAGCAGAAGATGAAGGCTGG + Intronic
998767012 5:145499575-145499597 CCAGAGAAGCCGAAGGAGAGAGG + Intronic
999251079 5:150182746-150182768 CCTGAGAAGCAGAAGGAGCCGGG - Exonic
999271448 5:150298508-150298530 CCACAGAAGCTGCAGGAGGCAGG - Exonic
999376753 5:151092113-151092135 GAAGAGAAGGAGAAGGAAGTGGG + Intronic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
999625211 5:153513316-153513338 GAAGAGAAGTGGAAGGAGGCTGG - Intronic
1000068938 5:157721122-157721144 CATGGGAAGCAGAAGGGGTCAGG + Intergenic
1000083947 5:157872823-157872845 CAAGAGAATTAAAAGTAGGCTGG + Intergenic
1000850429 5:166333294-166333316 AAAGAGAAGCAGCAGGAGCCAGG + Intergenic
1001225910 5:169944447-169944469 GGAGAGATGCTGAAGGAGGCAGG + Intronic
1002005974 5:176235426-176235448 CAAAAGAAGTAGAGGGATGCAGG + Intergenic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002220405 5:177675206-177675228 CAAAAGAAGTAGAGGGATGCAGG - Intergenic
1002256282 5:177960636-177960658 CAAGAGGAGCAAGAGGAGTCGGG + Intergenic
1002466445 5:179411140-179411162 CAAGAGAGCCAGCAGGAGCCTGG + Intergenic
1002554091 5:180020717-180020739 CAAGAGAAAGAAAAGGGGGCAGG + Intronic
1003154544 6:3579672-3579694 CAAGAGAAGGAACATGAGGCCGG - Intergenic
1003289667 6:4769061-4769083 CAAGAGAAGCGTAAGGAGACAGG + Intronic
1003514394 6:6806016-6806038 GAAGAGATGCGGAAGGAGCCGGG + Intergenic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1003577711 6:7313085-7313107 TAAGAGAAGCAGCAGCAAGCGGG + Exonic
1003584284 6:7372560-7372582 CAAAAGAACCACAAGAAGGCAGG + Intronic
1004177731 6:13354734-13354756 CAAGGGAAGGAGAAGGGAGCAGG - Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004392346 6:15220397-15220419 CAAGAGAAGGAAAAGGAAGTTGG + Intergenic
1004402757 6:15304236-15304258 GAAAAGGAGCAAAAGGAGGCTGG - Intronic
1004899882 6:20184177-20184199 CAAGAGGGGCAGGAAGAGGCAGG + Intronic
1005088499 6:22032073-22032095 AAAAAGAAGAAGAAGGAAGCGGG - Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005222944 6:23608735-23608757 CAACAGATGTAGAAGGAGTCTGG + Intergenic
1005300554 6:24466046-24466068 CAAAAGAAACAGATGGAGGCTGG + Intronic
1005492461 6:26359408-26359430 CAATAAAAGAAGAAAGAGGCTGG - Intergenic
1005636725 6:27759781-27759803 CAAAAGAACAAGAATGAGGCCGG - Intergenic
1005803092 6:29446525-29446547 GCAGAGAAGCAGCAGGAGTCAGG + Intronic
1006030695 6:31174692-31174714 CAAGAGATATAGGAGGAGGCCGG + Intronic
1006201222 6:32293327-32293349 CAAGAAAAGAAGAGTGAGGCAGG - Exonic
1006617746 6:35341380-35341402 AAAGAGAAGCAGAAAGAAGGGGG + Intergenic
1006677579 6:35775579-35775601 AAAAAAAAGCAGAAGCAGGCAGG + Intergenic
1006937550 6:37728957-37728979 CAAGAGAAGCAGGGGAGGGCAGG + Intergenic
1007071868 6:39043828-39043850 GAAGAGAAGCAGGAGGTGGAGGG + Intergenic
1007188887 6:39996868-39996890 CAAGAGGAAAAGAAGGAAGCTGG - Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007824755 6:44592121-44592143 AAAGAGAGGCAGGAGAAGGCAGG + Intergenic
1008211936 6:48736095-48736117 CAAGAGTTGAAGAAGCAGGCAGG + Intergenic
1008246763 6:49184690-49184712 AAAAAGAAGAAGAAGGAGGTGGG - Intergenic
1010022064 6:71171872-71171894 CAAGGCAAGCAGAAGGAAGAAGG - Intergenic
1010082235 6:71877249-71877271 CCAGAGAAGTAGCAGGAAGCAGG + Intergenic
1010249476 6:73693310-73693332 CAAGAGAAGCAGGAGGTGCCAGG + Intergenic
1010595390 6:77756673-77756695 AGAGAGAAGGAGAAGGCGGCGGG - Intronic
1010952635 6:82055271-82055293 TAAGAAAAGCAGAAGCAGGGAGG - Intergenic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011463306 6:87628794-87628816 CAAAAGAAACAGAAAGAGGTGGG - Intronic
1011777333 6:90746398-90746420 CAAGATAGGCACAAGAAGGCTGG - Intergenic
1011866458 6:91834716-91834738 CACCAGAAGCTGAAAGAGGCAGG + Intergenic
1011869439 6:91874080-91874102 CCAGAGAAGAAAAATGAGGCTGG + Intergenic
1011907913 6:92395296-92395318 CAAGAGTAGCTGAAGGAGACAGG - Intergenic
1012137769 6:95579698-95579720 CAAGAGATTCAGAAGCAGGGTGG - Intronic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012613028 6:101239439-101239461 CAAGTGAAAAAAAAGGAGGCCGG + Intergenic
1012669493 6:102024232-102024254 AAAGAGAAACAGAGGTAGGCTGG + Intronic
1012966202 6:105676191-105676213 CAGGAGATGCTGAAGGAGACAGG + Intergenic
1013039616 6:106420774-106420796 CAAGTGAAGCAGTAGGAGTGGGG - Intergenic
1014536142 6:122615320-122615342 CAAGAGATGCTGAATGAGTCAGG + Intronic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015185896 6:130415159-130415181 CAAGGGAAGCAGAAGGAAAGGGG + Intronic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1016694479 6:146976755-146976777 AAAGAGAAGAAGAAGGATGGGGG - Intergenic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1017326694 6:153149230-153149252 CAAGAGAGGAAGCAGGAGGTAGG + Intergenic
1017491163 6:154946451-154946473 AAAGAGAAGAAGAAGAAGACAGG - Intronic
1017587444 6:155942789-155942811 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1017988201 6:159463087-159463109 CAAGAGAATCAAAAGGAAGTGGG + Intergenic
1018282780 6:162206027-162206049 CGAGAGAAGGAGAAGGAAGAAGG + Intronic
1018306373 6:162461203-162461225 GAAGAGAAAAAAAAGGAGGCTGG + Intronic
1018445593 6:163855330-163855352 CAAGAGAAGCATAAGGAAAGAGG - Intergenic
1018905485 6:168073214-168073236 CAAGTGAAGCTGCTGGAGGCTGG + Intronic
1019478721 7:1256322-1256344 CCAGGGACGCAGAAGGTGGCTGG - Intergenic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1019873352 7:3788104-3788126 CAATCGAAGCAGAAGGAGTGAGG - Intronic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1019988865 7:4678670-4678692 GCAGAGAAGCAGAGGGATGCAGG - Intergenic
1020011514 7:4808087-4808109 GAAGAGAGGAAGAAGGAGGAGGG - Intronic
1020630889 7:10637957-10637979 CAAGAGGAACAGAGGCAGGCAGG + Intergenic
1021188977 7:17598468-17598490 CAAGAAAAGCAGAAGCTGCCAGG - Intergenic
1021427810 7:20522628-20522650 AAAGAGGAGGAGAGGGAGGCTGG + Intergenic
1021564996 7:22008202-22008224 CAGGAGAAGCAGCAGTAGACAGG + Intergenic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1022036148 7:26536842-26536864 CAAGAGAAGCAGCAGTTGGCAGG + Exonic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023710977 7:42992279-42992301 CAGGAGTAGCAGAAGGGGACAGG - Intergenic
1023827580 7:44019714-44019736 TGAGGGATGCAGAAGGAGGCAGG + Intergenic
1023992758 7:45139231-45139253 CCAGAGGAGGAGCAGGAGGCTGG - Intergenic
1024100469 7:46027449-46027471 CAAGAGAAAAAGTAGGAGACAGG - Intergenic
1024167055 7:46745841-46745863 CAACAGAATAAGAAAGAGGCAGG + Intronic
1024393108 7:48837495-48837517 CATGTGAAGTGGAAGGAGGCTGG - Intergenic
1024743264 7:52378093-52378115 GAAGAGAAGCAGAAATACGCAGG - Intergenic
1024939268 7:54745326-54745348 CAATAGAACTAGAAGGAGGTAGG - Intergenic
1025900536 7:65740833-65740855 GGAAAGAAGCAGAAGGAAGCCGG + Intergenic
1026226889 7:68450156-68450178 CGTGAGAAGAAAAAGGAGGCTGG - Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026671188 7:72392035-72392057 CAAGAGAAACAGATGGAACCCGG - Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027265779 7:76494562-76494584 CAAGAGCAGAGGAAGGGGGCAGG - Intronic
1027317150 7:76992679-76992701 CAAGAGCAGAGGAAGGGGGCAGG - Intergenic
1029092872 7:98062071-98062093 CAAAAGAAGTAGAATCAGGCTGG - Intergenic
1029530194 7:101120366-101120388 GAAGAGAAGGAGAAGGAGAAGGG + Intergenic
1029599123 7:101553571-101553593 CAAGAGAGTGAGAAGGTGGCTGG + Intronic
1029738754 7:102479483-102479505 TGAGGGATGCAGAAGGAGGCAGG + Intergenic
1029755880 7:102573140-102573162 TGAGGGATGCAGAAGGAGGCAGG + Intronic
1029773822 7:102672213-102672235 TGAGGGATGCAGAAGGAGGCAGG + Intergenic
1030014998 7:105210382-105210404 CAAGAGAGGAAGAAGGAGGGAGG - Intronic
1030064823 7:105651605-105651627 GAAGAAAAGCAGAACGAGGTGGG + Intronic
1030575950 7:111286140-111286162 TAAGAGAAGAAGATGGAGTCAGG + Intronic
1030832607 7:114244385-114244407 CAAGAGGAGCTTAAGGAGACAGG - Intronic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031537417 7:122952438-122952460 GAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1031972355 7:128073976-128073998 CAGGAGAGGCAGAAAGACGCGGG - Intronic
1032523301 7:132562053-132562075 GAAGAGGAGGAGAAGGAGGAGGG - Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033656160 7:143376070-143376092 TCAGAGAAGCAGGAGAAGGCAGG - Intergenic
1033889594 7:145994978-145995000 AAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1034166415 7:149028370-149028392 CAAGAGCAGCAGGAGCAGGAAGG + Exonic
1034435672 7:151061745-151061767 AAAGAGAAGAACAAGGAGACAGG - Intronic
1034563099 7:151894284-151894306 CACGAGGAGCTGGAGGAGGCGGG + Intergenic
1034847804 7:154463501-154463523 TAAGAAAAGGAGAAGTAGGCTGG - Intronic
1034852219 7:154504598-154504620 CAAGAAAAGAAGAATGAGACAGG - Intronic
1034978920 7:155463489-155463511 AAAGAGAAGGAGGAGGAGGAAGG - Exonic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035471207 7:159109926-159109948 GGAGAGAAGCAGAGTGAGGCAGG + Intronic
1036198291 8:6743158-6743180 GAAATGAAGCAGAAAGAGGCTGG - Intronic
1036396794 8:8377267-8377289 CCAGAGAAGCAGCAGGACCCTGG - Exonic
1036409563 8:8486679-8486701 CAAGAAAAGAAGAAGGACGATGG - Intergenic
1037598466 8:20373866-20373888 GAAGAGAAGGAGGAGGAGGAGGG + Intergenic
1037608014 8:20453771-20453793 GAAGAGGAGGAGAAGGAGGCTGG + Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037987546 8:23299291-23299313 GAAGAGAAGCAGAAGGGTGCAGG + Intronic
1038022216 8:23560350-23560372 CAAGAGAGGCAGAAGGCAGGCGG - Intronic
1038067845 8:23982327-23982349 CCAGTGAAGCAGGAGGAGCCTGG - Intergenic
1038394516 8:27237041-27237063 CGAGAGGGGCAGAAGGTGGCAGG + Intronic
1038927116 8:32153175-32153197 GAAGAGAAGCAGAAGGCCGGTGG + Intronic
1039033668 8:33335932-33335954 GAAGAGATGGAGGAGGAGGCAGG + Intergenic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1040700898 8:50064388-50064410 CAAGGTAAGCAGAAGGAGATGGG - Intronic
1041117727 8:54556200-54556222 CAAGTCAAGCAGCAGGGGGCAGG - Intergenic
1041187130 8:55312859-55312881 CAAGACAAGGAGAAAGAGACTGG + Intronic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041280767 8:56210062-56210084 CAAGAGAAGCAGGGGGAGCGAGG - Intronic
1041377078 8:57215936-57215958 CAAGAGAAGCATCAGGGGACCGG - Intergenic
1041479464 8:58302678-58302700 GAAGAGAAGCAGAAGCCGGGAGG + Intergenic
1041521287 8:58759130-58759152 TAAGAGAAACAGGAGGAAGCAGG + Intergenic
1042070847 8:64931503-64931525 CAAGAGAAGCACAAGGGGTCAGG - Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042413293 8:68490044-68490066 CTAGAAAAGCAGAACAAGGCCGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043379132 8:79684068-79684090 TCTGAGAAGCAGGAGGAGGCAGG - Intergenic
1043656957 8:82679672-82679694 GAAGAGGAGAAGAAGGAGGAGGG + Intergenic
1043815723 8:84798824-84798846 CAAGAGAAAAAGCAGGATGCGGG + Intronic
1044142861 8:88675952-88675974 CAGGAGAAGCAGAAGTATACTGG + Intergenic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1046208105 8:111030527-111030549 CAAGAGAGGAAGAAAGAGGGAGG + Intergenic
1046324311 8:112620725-112620747 CACAAGATGCAGTAGGAGGCGGG - Intronic
1046819023 8:118616471-118616493 CAAGAGAATCACACAGAGGCAGG + Intronic
1047430798 8:124789818-124789840 CAGGAGATCCAGAAGGTGGCAGG - Intergenic
1047616740 8:126568836-126568858 CAAGAGAAGCAAAAAGAGGGTGG + Intergenic
1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG + Intergenic
1048564082 8:135575943-135575965 CAAGAGCAGCCTAAGGAGACAGG - Intronic
1049416762 8:142498948-142498970 CAAGAGAGGGAGAGAGAGGCTGG - Intronic
1050533686 9:6612435-6612457 AAAGAAAAGTAGATGGAGGCTGG + Intronic
1051112154 9:13651376-13651398 CCAGGGAAGCAGAAGGGGTCGGG - Intergenic
1051555880 9:18382015-18382037 CAGGAGAAGCAGAAGCAATCAGG - Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1052900655 9:33791944-33791966 CAAGAGGAGGGGCAGGAGGCAGG + Intronic
1052964505 9:34329580-34329602 CACCCGAAGCAGAAGGAGGTAGG - Exonic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053218930 9:36295262-36295284 AAAGAAAAGCAGCTGGAGGCTGG + Intronic
1053242379 9:36506620-36506642 TAAGAGAAGAAGAAAGGGGCTGG - Intergenic
1053472567 9:38357440-38357462 CAAGAGAGACAGGAGGAAGCTGG + Intergenic
1053485010 9:38445794-38445816 CAAAAAAAGCAGAAGGATGTGGG + Intergenic
1053799634 9:41756189-41756211 CAAGAGAACTAGAAGGCGGGGGG - Intergenic
1054145584 9:61558809-61558831 CAAGAGAACTAGAAGGCGGGGGG + Intergenic
1054188043 9:61968244-61968266 CAAGAGAACTAGAAGGCGGGGGG - Intergenic
1054465324 9:65489917-65489939 CAAGAGAACTAGAAGGCGGGGGG + Intergenic
1054650473 9:67620332-67620354 CAAGAGAACTAGAAGGCGGGGGG + Intergenic
1056165547 9:83937409-83937431 GAAGGGAAGAAGAAGGAGGAGGG + Intergenic
1056546468 9:87617838-87617860 CTAGAGAAGCAGAGGGGAGCAGG - Intronic
1056628860 9:88276153-88276175 CAACAGATGCAGAAAGAAGCTGG + Intergenic
1056760130 9:89408663-89408685 CTAGAGGAGGAGGAGGAGGCAGG + Intronic
1056954573 9:91072053-91072075 GAAGAGAAGCAGAGGGAGGGAGG + Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057850291 9:98561488-98561510 GAAGAGAAACAGAAAGAAGCAGG + Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1059014820 9:110504415-110504437 GAAGAAAAGGAGAAGGAAGCAGG - Intronic
1059069393 9:111119829-111119851 CATGAGATTCAGGAGGAGGCAGG - Intergenic
1059361118 9:113742722-113742744 CAACAGAAGCAGGAAGAGGCTGG - Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059450151 9:114366451-114366473 GAAGAGCAGCCGACGGAGGCTGG + Intronic
1059507265 9:114810967-114810989 CAAGAGAACCAGATGGGGGGAGG - Intergenic
1059508551 9:114822371-114822393 AAAGAGTAGCATAAGGAGGTGGG + Intergenic
1059799485 9:117735881-117735903 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1060322996 9:122583324-122583346 CAAGAGAAGCCGAAGGAGACAGG + Intergenic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060443312 9:123662271-123662293 CAAAAGAAGAATAAAGAGGCTGG + Intronic
1060860810 9:126953413-126953435 TGAGAGAGGCAGAAGGAGGGTGG + Intronic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1061082732 9:128381989-128382011 AAAGAGAAAGAGAAGGAGGGAGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062151264 9:135020375-135020397 CCATAGAAGCTGGAGGAGGCAGG + Intergenic
1062287718 9:135780531-135780553 CCAGAGAAGCGAGAGGAGGCCGG + Intronic
1062437884 9:136554691-136554713 CAACAGAAGCTGGAGGAGGTGGG + Intergenic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185513660 X:681852-681874 CAAGAGAGGTAGAAGGAGAAAGG + Intergenic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185745100 X:2566294-2566316 GAAGAGATGAAGATGGAGGCGGG - Intergenic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186376122 X:9003497-9003519 GCAGAGAAGCAGAAGGAGACAGG + Intergenic
1186629900 X:11337533-11337555 CAAGAGCAGCCCAAGAAGGCTGG + Intronic
1187333252 X:18359934-18359956 CAAAAGATGCTGAAGGAGCCAGG - Intergenic
1187576224 X:20559173-20559195 CAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1188331380 X:28875972-28875994 CAAGAGAAGAAGAAAGAGAGAGG - Intronic
1188626657 X:32293414-32293436 GAAGAGAACCAGAAGGAGGGAGG + Intronic
1189216660 X:39330930-39330952 AAAGAGAAGAAGAAGCAGGGAGG + Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189481119 X:41393090-41393112 CAAGAGAAGCTGAGAGAGGCAGG + Intergenic
1189764345 X:44354699-44354721 CAAAAGAAGCAGAAACTGGCCGG + Intergenic
1190415210 X:50174119-50174141 AAAAAGAAGCTGAATGAGGCTGG + Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1191050285 X:56184079-56184101 CATGAGAAGCACAAGGTGTCAGG + Intergenic
1192130219 X:68542879-68542901 AAAAAGAAGAAGAAGAAGGCTGG - Intergenic
1192182150 X:68922775-68922797 CAAGTGAGGCAGGAGGTGGCTGG + Intergenic
1192474600 X:71429277-71429299 AAAAAAAAGCAGAAGGAAGCAGG + Intronic
1195369718 X:104161551-104161573 AAAAAGAAGAAGAAAGAGGCTGG + Intergenic
1195576843 X:106460925-106460947 GAACATAAGCAGCAGGAGGCGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196392785 X:115226123-115226145 CAAGAGAAAAAGGAGGAGGGGGG + Intronic
1197631111 X:128859441-128859463 CAAGAGAAGCCTAAGGATGCTGG + Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1198169275 X:134089916-134089938 AAGGTGAAGCAGAAGCAGGCAGG + Intergenic
1198448619 X:136743655-136743677 CACGAGTTGAAGAAGGAGGCTGG - Exonic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199570058 X:149258215-149258237 GAAGAGAAGCAAAAGCATGCAGG + Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1199721260 X:150544187-150544209 AAAGAGAAGCAGAAAGAATCTGG + Intergenic
1200158295 X:153990023-153990045 GTAGAGAAACACAAGGAGGCTGG - Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic