ID: 1108321948

View in Genome Browser
Species Human (GRCh38)
Location 13:49298308-49298330
Sequence CTGTGTCATCAAAAGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 843
Summary {0: 1, 1: 0, 2: 7, 3: 96, 4: 739}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108321948_1108321956 -2 Left 1108321948 13:49298308-49298330 CCCCCTGCCTTTTGATGACACAG 0: 1
1: 0
2: 7
3: 96
4: 739
Right 1108321956 13:49298329-49298351 AGGTTCTGCATAAGGTGAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 168
1108321948_1108321957 1 Left 1108321948 13:49298308-49298330 CCCCCTGCCTTTTGATGACACAG 0: 1
1: 0
2: 7
3: 96
4: 739
Right 1108321957 13:49298332-49298354 TTCTGCATAAGGTGAGAGGGAGG 0: 1
1: 0
2: 3
3: 78
4: 1227
1108321948_1108321959 7 Left 1108321948 13:49298308-49298330 CCCCCTGCCTTTTGATGACACAG 0: 1
1: 0
2: 7
3: 96
4: 739
Right 1108321959 13:49298338-49298360 ATAAGGTGAGAGGGAGGACAGGG 0: 1
1: 0
2: 3
3: 53
4: 499
1108321948_1108321958 6 Left 1108321948 13:49298308-49298330 CCCCCTGCCTTTTGATGACACAG 0: 1
1: 0
2: 7
3: 96
4: 739
Right 1108321958 13:49298337-49298359 CATAAGGTGAGAGGGAGGACAGG 0: 1
1: 0
2: 0
3: 37
4: 366
1108321948_1108321954 -10 Left 1108321948 13:49298308-49298330 CCCCCTGCCTTTTGATGACACAG 0: 1
1: 0
2: 7
3: 96
4: 739
Right 1108321954 13:49298321-49298343 GATGACACAGGTTCTGCATAAGG 0: 1
1: 0
2: 1
3: 7
4: 98
1108321948_1108321955 -3 Left 1108321948 13:49298308-49298330 CCCCCTGCCTTTTGATGACACAG 0: 1
1: 0
2: 7
3: 96
4: 739
Right 1108321955 13:49298328-49298350 CAGGTTCTGCATAAGGTGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108321948 Original CRISPR CTGTGTCATCAAAAGGCAGG GGG (reversed) Intergenic
900821307 1:4891046-4891068 CTGTGTCATTATATGGCAGAAGG + Intergenic
901693311 1:10988575-10988597 CTTTGACATCAAATGGCAGCAGG - Intergenic
901975670 1:12942152-12942174 CTGTGTCATGACAAGTGAGGAGG - Intronic
902009504 1:13259613-13259635 CTGTGTCATGACAAGTGAGGAGG + Intronic
902480466 1:16708765-16708787 CTGAGTCTTCAAGAGGGAGGAGG - Intergenic
902828397 1:18993659-18993681 GTGGGCCATCAAAAGACAGGAGG + Intergenic
902954814 1:19918343-19918365 CTGTGCTAGCAAAAGGAAGGAGG - Intergenic
902967172 1:20014050-20014072 CTGTGTCCTCACATGGCAGAAGG + Intergenic
903150280 1:21403126-21403148 CTGTGTCTTCACATGGCAGAAGG + Intergenic
903277132 1:22229334-22229356 GTGTGGCATGAATAGGCAGGGGG - Intergenic
903643778 1:24878254-24878276 CTGTGTCATAACACGGCAGAGGG + Intergenic
903985264 1:27222886-27222908 CTGTGTCCTCACATGGCAGTAGG + Intergenic
904352854 1:29920271-29920293 CTGTGTCCTCACATGGCAGAAGG - Intergenic
904407510 1:30302650-30302672 CTGTGTCCTCATAGGGGAGGGGG - Intergenic
904596913 1:31652622-31652644 GTCTTTCATCCAAAGGCAGGTGG + Exonic
904781876 1:32955984-32956006 CTTTGTCAGGCAAAGGCAGGAGG + Intronic
904808099 1:33145808-33145830 CTGTGGCAGAAAAACGCAGGTGG + Exonic
905000453 1:34664045-34664067 CTGTGTCCTCACATGGCAGAAGG - Intergenic
905020780 1:34809845-34809867 CTGTGTCTTCACATGGCAGAAGG + Intronic
906173672 1:43749861-43749883 CTGTGTCCTCATATGGCAGAAGG - Intronic
906745663 1:48220698-48220720 CTGTGTCCTCACATGGCAGAAGG + Intergenic
906857099 1:49319761-49319783 CTGAGTCATCAAATGGCAGAAGG + Intronic
906911326 1:49954477-49954499 CTGTGTCATCTTATGGCAGAAGG - Intronic
907962064 1:59293391-59293413 CTGTGTCATCCCATGGCAGAAGG + Intergenic
907976314 1:59434693-59434715 CTGTGTCCTCAAAAGACGGGAGG + Intronic
908112195 1:60908804-60908826 CTCTGGCATCAAAGGGCAGCTGG - Intronic
908113080 1:60916243-60916265 CTGTGTCTTCACATGGCAGGAGG + Intronic
908158930 1:61386947-61386969 CTGTGTCCTCACATGGCAGAAGG + Intronic
908326616 1:63029585-63029607 CTGTGTCTTCACAAAGCAGAAGG - Intergenic
908467288 1:64409173-64409195 CTCTGTTATCAAAAGAAAGGTGG + Intergenic
908499475 1:64728910-64728932 CTGTGTCCTCACATGGCAGAAGG - Intergenic
908901103 1:68957540-68957562 CTGTGTCCTCACATGGCAGAAGG - Intergenic
909457423 1:75866174-75866196 CTGTCTCAAAAAAGGGCAGGGGG - Intronic
910476165 1:87609685-87609707 CTGTGTCATCACATGGCTGAAGG + Intergenic
911160743 1:94680491-94680513 CTGTGTCTTCACATGGCAGAGGG + Intergenic
911190193 1:94940913-94940935 CTGTGTCATAACATGGCAGAGGG + Intergenic
911397947 1:97335800-97335822 CTTTGCTTTCAAAAGGCAGGTGG - Intronic
911441175 1:97927490-97927512 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
911829213 1:102529679-102529701 CTGTGTCATCACATAGCAGAAGG + Intergenic
911901698 1:103513924-103513946 CTATGTCATCACATGGTAGGAGG - Intergenic
912690405 1:111800733-111800755 CTGGCTCATCACTAGGCAGGGGG - Intronic
913581354 1:120230476-120230498 CTGTGTCCTCACATGGCTGGAGG + Intergenic
913626822 1:120667915-120667937 CTGTGTCCTCACATGGCTGGAGG - Intergenic
914563286 1:148841919-148841941 CTGTGTCCTCACATGGCTGGAGG + Intronic
914609541 1:149288304-149288326 CTGTGTCCTCACATGGCTGGAGG - Intergenic
915455474 1:156037629-156037651 CTGTGTAATAATATGGCAGGCGG + Intronic
916162759 1:161935392-161935414 CTGTGTCTTCAAATGGCAGAAGG - Intronic
918153006 1:181814747-181814769 CTGTGTCTTCACATGGCAGAAGG + Intergenic
919275718 1:195413870-195413892 CTGTGTCTTCACATGGCAGAAGG + Intergenic
919344997 1:196363677-196363699 CTGTGTCATCCCATGGCAGAAGG - Intronic
919394267 1:197024585-197024607 CTGTGCAATCAAAAGGAAAGTGG - Intergenic
919454628 1:197806588-197806610 CTGTGTCCTCACATGGCAGCAGG + Intergenic
919462446 1:197894006-197894028 CTGTGTCTTCACAAGGCAGAAGG + Intergenic
920118185 1:203636079-203636101 CTGTCTCCTCAAAAGTTAGGTGG - Intronic
920255047 1:204648984-204649006 CAGAGTCATCAGAAGTCAGGTGG + Intronic
920396133 1:205647506-205647528 CTGTGTCCTCACATGGCAGAAGG + Intergenic
920766549 1:208839172-208839194 CTGTGTCATCATTAGGAAGATGG + Intergenic
920813444 1:209308398-209308420 CTGTGTCATCTAAATGCTTGCGG - Intergenic
921223896 1:212997680-212997702 CTCTGTCATCAAAAGTCTAGAGG - Intronic
921328357 1:214010523-214010545 CTGTGATGACAAAAGGCAGGGGG + Intronic
921700882 1:218267288-218267310 CTGTGTCATCACATAGCAGAAGG + Intergenic
921728002 1:218545304-218545326 CTGTGTCATAGTAAGGCAGAGGG + Intergenic
921922632 1:220686395-220686417 CTGCGTCCTCATAAGGCAGAAGG + Intergenic
922224646 1:223634682-223634704 TTGTGTCCTCAAACGGCAGAAGG + Intronic
922332596 1:224590557-224590579 CTGTATCATCACATGGCAGAAGG + Intronic
922616074 1:226961895-226961917 CTGTGTCCTCATGGGGCAGGAGG + Intronic
922969983 1:229728047-229728069 CTGTGTCATCCAAAACCAGCTGG + Intergenic
923243780 1:232111117-232111139 CTGGGTCAACAAAAAGCAAGGGG - Intergenic
923512954 1:234668651-234668673 CTGTGTCTTCACATGGCAGAAGG - Intergenic
923676854 1:236087869-236087891 CTGTGTCCTCACATGGCAGAAGG + Intergenic
923762443 1:236859187-236859209 CTGTGTCATAACATGGCAGAGGG + Intronic
924012220 1:239677573-239677595 CTGTGTCTTCACATGGCAGAAGG + Intronic
924494866 1:244577595-244577617 CTGTGTCCTCACATGGCAGAAGG + Intronic
924604769 1:245523609-245523631 CTGTGTCTTCACATGGCAGAAGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063041132 10:2338374-2338396 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1063343592 10:5291816-5291838 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1063559131 10:7110215-7110237 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1064767881 10:18693477-18693499 CTGTGTCATGACATGGCAGGAGG + Intergenic
1065228826 10:23575562-23575584 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1065393701 10:25211409-25211431 CTGTGTCATCTTGTGGCAGGAGG + Intronic
1065640198 10:27774278-27774300 CTGTGTCATACAATGGCAGAAGG + Intergenic
1066007134 10:31155762-31155784 CAGTGCCATCACATGGCAGGTGG - Intergenic
1066020085 10:31289723-31289745 CTGTGTCCTCACATGGCAGATGG - Intergenic
1066277412 10:33882325-33882347 CTGTGTCATCTCATGGCAGAAGG + Intergenic
1066474902 10:35737703-35737725 CTATGTCCTCACATGGCAGGAGG + Intergenic
1066630024 10:37450138-37450160 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1067052595 10:43030879-43030901 CTGTGTCTTCACATGGCAGAAGG + Intergenic
1067571286 10:47372957-47372979 CTGTGTCAACACCCGGCAGGAGG - Intronic
1067846452 10:49725927-49725949 CTGTGTCCTCACATGGCAGATGG - Intergenic
1068003804 10:51369359-51369381 CTGTGTCCTCATATGGCAGGAGG + Intronic
1068065003 10:52119844-52119866 CTGTGTTATCCAATGGCAGAAGG + Intronic
1068510387 10:57958224-57958246 CTGTGTCCTCAAAAGGTGGAAGG - Intergenic
1068659658 10:59611115-59611137 CTGTGTCCTCAGATGGCAGGGGG - Intergenic
1069656366 10:70092163-70092185 CTGTGTCCTCACATGGCAGAAGG - Intronic
1069787767 10:71000207-71000229 CTGTGTCCTCATATGGCAGATGG + Intergenic
1070332644 10:75429403-75429425 CTGTGTCCTCAAATGGTAGGAGG - Intergenic
1071029959 10:81165619-81165641 CTGTGTCATAACACGGCAGAAGG - Intergenic
1071860013 10:89662794-89662816 CTGTGTCATAACATGGCAGAAGG - Intergenic
1072100174 10:92221869-92221891 CTGTGTCCTCACATGGCAGAAGG - Intronic
1072313613 10:94180816-94180838 CTGTGTCCTCACATGGCAGAAGG - Intronic
1072494669 10:95945033-95945055 CTGTGTCCTCACATGGCAGATGG - Intergenic
1072762489 10:98068441-98068463 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1073375015 10:103026067-103026089 CTGTGTCATCCCATGGCAGAAGG - Intronic
1073586814 10:104718268-104718290 CTGTGTCATCCCATGGCAGAAGG + Intronic
1073722458 10:106188576-106188598 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1074644784 10:115435402-115435424 CTGTGTCATCCCATGGCAGAAGG - Intronic
1075133574 10:119762351-119762373 CTGAGTCCTCACATGGCAGGAGG + Intronic
1075331353 10:121576477-121576499 CCCTTTCATCAAAAGGCATGTGG + Intronic
1075350958 10:121724981-121725003 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1075436191 10:122444675-122444697 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1075872393 10:125780251-125780273 CTGTGTCCTCATATGGCAGACGG - Intergenic
1076001110 10:126913692-126913714 CCCTGTCTTCAAAAGGCAGATGG + Intronic
1076539298 10:131204106-131204128 CTGTGTCCTCCCATGGCAGGAGG - Intronic
1077861334 11:6183551-6183573 CTGTTTCATCATATGGCAGAAGG + Intergenic
1078908174 11:15706635-15706657 CAGTGTCCTCACATGGCAGGGGG - Intergenic
1080081847 11:28229601-28229623 CTGTGTCCTCACATGGCAGAAGG - Intronic
1081044271 11:38251564-38251586 CTGTGCCTTCAAGAGGCAGGTGG + Intergenic
1082776912 11:57252512-57252534 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1082920839 11:58492069-58492091 GTTGGTGATCAAAAGGCAGGAGG - Intergenic
1083643408 11:64158023-64158045 CTGCGTCCCCAAAAGACAGGTGG + Intronic
1084081106 11:66825528-66825550 CTGTGTCCTCACATGGCAGAAGG - Intronic
1084851267 11:71942936-71942958 CTGTGTCTTCACATGGCAGAAGG + Intronic
1085765714 11:79279986-79280008 CTGTGTCCTCAAATGGCAGAGGG - Intronic
1086363309 11:86081623-86081645 CTGTGTCTTCACATGGCAGGAGG - Intergenic
1086509046 11:87536295-87536317 CTGCATCATCAAATGGCAGAAGG - Intergenic
1086737327 11:90322504-90322526 CTCTGTAAACAAAATGCAGGGGG - Intergenic
1087329400 11:96760972-96760994 CTGTCTCATCCCAAGGCAGAAGG - Intergenic
1087448468 11:98286122-98286144 CTGTGACATCACATGGCAGAAGG - Intergenic
1087923147 11:103890055-103890077 CTGTGTCCTCACATGGCAGAGGG + Intergenic
1088131155 11:106492569-106492591 CTGTGTCATCTTATGGCAGAAGG - Intergenic
1089238750 11:117055854-117055876 CTGTGTCCTCACATGGCAGAAGG - Intronic
1089295763 11:117466670-117466692 CTGTCTCAACAAAAGGAGGGTGG + Intronic
1089333877 11:117709357-117709379 CTGTGTCCTCACATGGCAGATGG + Intronic
1089595663 11:119578020-119578042 CTGTGTCTCCAAGAGGGAGGGGG + Intergenic
1089768063 11:120782897-120782919 CTGCATCCTCACAAGGCAGGAGG + Intronic
1089786741 11:120912845-120912867 CAGTGTCAGTAAAAGGTAGGCGG + Intronic
1090250297 11:125246234-125246256 CTGTGTCATAACATGGCAGGAGG + Intronic
1090346447 11:126075487-126075509 CTGTGTCTTCACATGGCAGAAGG - Intergenic
1090699456 11:129280299-129280321 CAGTGCCATCCACAGGCAGGGGG - Intergenic
1090742843 11:129681878-129681900 CTGCGTCCTCACATGGCAGGTGG - Intergenic
1091065078 11:132502195-132502217 CTGTGTCTTTAAGAAGCAGGTGG - Intronic
1091553872 12:1557458-1557480 CTGTGTCCTCACATGGCAGAAGG + Intronic
1092747946 12:11691108-11691130 CTGTGTCCTCACATGGCAGAAGG + Intronic
1092936544 12:13369127-13369149 CTGTGTCCTCACACAGCAGGAGG + Intergenic
1093070355 12:14701874-14701896 ATGTGTCCTCAAATGGTAGGGGG - Intergenic
1093135477 12:15444697-15444719 CTGTGTCATCACATGGTGGGAGG - Intronic
1093241538 12:16682769-16682791 ATGTGTCTTCAAAGGGCAGGAGG - Intergenic
1093269493 12:17041776-17041798 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1093722769 12:22463508-22463530 CTGTGTTATCACAGGGCAGAAGG - Intronic
1094045661 12:26163536-26163558 CTGTGTCGTCACATGGCAGAAGG + Intronic
1095967752 12:47880263-47880285 CTCTGTCACCCAAGGGCAGGAGG - Intronic
1096727507 12:53576533-53576555 CTGTGTCCTCACATGGCAGTTGG - Intronic
1097325553 12:58272418-58272440 CTGTGTCCTCACATGGCAGTAGG + Intergenic
1097486266 12:60205676-60205698 CTGAGTCATCACATGGCAGCAGG - Intergenic
1097714104 12:62947263-62947285 CTGTGTCATAACAGGGCAGAAGG + Intergenic
1097897798 12:64843010-64843032 CTGTCTCAAAAAAGGGCAGGGGG - Intronic
1098015802 12:66103423-66103445 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1098327063 12:69313846-69313868 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1098430329 12:70412251-70412273 TTGTGGCATCAGAAAGCAGGAGG - Intronic
1098482655 12:70983962-70983984 CTCTGTTCTTAAAAGGCAGGTGG - Intergenic
1098493186 12:71105995-71106017 CTGTGTCATCTCATGGCAGAGGG + Intronic
1098599976 12:72319156-72319178 CTGTGTCATCAGCAGTCAGCTGG - Intronic
1099013045 12:77314253-77314275 CTGTATCATCTTAAGGCAGAAGG + Intergenic
1099207923 12:79749209-79749231 CTGTGTCATAAAATGGCAGAGGG - Intergenic
1099507500 12:83497652-83497674 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1099975351 12:89540812-89540834 CTGTGAAATCAAAAGGCAAGAGG + Intergenic
1100063934 12:90616846-90616868 CTGTGTCTTCACATGGCAGAAGG - Intergenic
1100234052 12:92639844-92639866 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1100272920 12:93043540-93043562 CTGTCTCAAAAAAAGGAAGGAGG - Intergenic
1100310477 12:93390609-93390631 CTGTCTCAAAAAAAGGGAGGGGG - Intronic
1100455511 12:94747953-94747975 CTGTGTCATGACATGGCAGAGGG - Intergenic
1100610094 12:96184704-96184726 CTGTGTCCTCACACGGCAGAAGG - Intergenic
1100752190 12:97710583-97710605 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1100818685 12:98410511-98410533 CTGTGTCATAACATGGCAGAGGG - Intergenic
1101355680 12:103975496-103975518 CTGCGTCATAAAATGGCAGAAGG + Intronic
1101416554 12:104513576-104513598 CTGTAACACCAAAGGGCAGGAGG + Intronic
1101423432 12:104567867-104567889 CTGTGTCTTCACATGGCAGAGGG - Intronic
1102492448 12:113297422-113297444 CTGTGACTTCAGAAGGCAGGTGG + Exonic
1102900038 12:116629346-116629368 CTGTCTCATAGAAAGGAAGGAGG + Intergenic
1104317040 12:127712686-127712708 ATGTGTCAAAAAAAAGCAGGGGG + Intergenic
1104569837 12:129915562-129915584 CTGTTTCATCAAAAAACAGTAGG - Intergenic
1105519317 13:21117366-21117388 CTGTGTCCTCATATGGCAGAGGG + Intergenic
1106945114 13:34818872-34818894 CTGTGTCATCCCATGGCAGGAGG + Intergenic
1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG + Intergenic
1107260546 13:38485418-38485440 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1107414041 13:40184621-40184643 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1107747553 13:43526935-43526957 CTGTGTCTTCACACGGCAGAAGG - Intronic
1107876084 13:44791576-44791598 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1108321948 13:49298308-49298330 CTGTGTCATCAAAAGGCAGGGGG - Intergenic
1108359434 13:49655808-49655830 CTGTGTCATCTCATGGCAGAAGG + Intergenic
1108374185 13:49797973-49797995 CTGTGTCCTCACATGGCAGGAGG - Intergenic
1108374190 13:49798004-49798026 CTGTGTCCTCACATGGCAGGAGG - Intergenic
1108519580 13:51234366-51234388 CTTTTTCCTCAAAATGCAGGGGG + Intronic
1108746814 13:53404496-53404518 CTGTATCCCCAAAAGGCATGGGG + Intergenic
1109330005 13:60917910-60917932 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1109330229 13:60919912-60919934 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1109440850 13:62370927-62370949 CTGTGTCAGGCAAAGGCAGGAGG - Intergenic
1109732656 13:66436303-66436325 CTGTGTCTTCACAAGGCAGAAGG - Intronic
1110157037 13:72329920-72329942 CTGTGTCCTCACAAGGCAGAAGG + Intergenic
1110241266 13:73269898-73269920 CTGTGTCTTCACATGGCAGAAGG - Intergenic
1110324125 13:74194485-74194507 CTGAGTCCTCATAGGGCAGGAGG + Intergenic
1110454774 13:75679092-75679114 CTGTGTCATGAAAAGAAAGGGGG - Intronic
1111258716 13:85706787-85706809 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1112207275 13:97337173-97337195 CTGTGTCCGCACATGGCAGGAGG - Intronic
1112263731 13:97902937-97902959 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1112369173 13:98779823-98779845 CTATGGCATCAAAAGACAGTTGG + Intergenic
1113454081 13:110435097-110435119 CTGTTCCATCAAAAAGCAGAAGG - Intronic
1113501010 13:110774311-110774333 CTGTGTCCTCACATGGCATGAGG + Intergenic
1113971362 13:114193475-114193497 CTGTGTCCTCATATGGCAGATGG + Intergenic
1114639144 14:24207410-24207432 TGGTGTCATCAAAGGGCAGATGG - Exonic
1114790675 14:25654973-25654995 CTGTGTCATCTCATGGCAGAAGG + Intergenic
1115373875 14:32651614-32651636 CTGTGTCCTCACATGGCAGAAGG + Intronic
1116576246 14:46580017-46580039 CTTTGTCTTCAAGTGGCAGGTGG - Intergenic
1116756083 14:48949844-48949866 CTGTATCATAACATGGCAGGAGG + Intergenic
1116953996 14:50904824-50904846 CTGTATCCTCAAATGGTAGGAGG - Exonic
1117202518 14:53406777-53406799 CTGTGTCCTCAGATGGCAGAAGG - Intergenic
1117613199 14:57504985-57505007 CTGGGTCATCAAAGGGCACATGG + Intergenic
1117733080 14:58743481-58743503 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1117851949 14:59982480-59982502 CAGTGTCATAAAATGGCAGTGGG + Intronic
1118408044 14:65446371-65446393 GTGTGTCATCAGAAGGCACTTGG + Intronic
1118437854 14:65787765-65787787 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1118628629 14:67682022-67682044 CTGTGTCATAATATGGCAGAGGG - Intronic
1118782563 14:69018671-69018693 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1120005260 14:79349357-79349379 CTGTGTAAGCAGAAAGCAGGAGG + Intronic
1120413156 14:84184060-84184082 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1120566719 14:86068755-86068777 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1120671463 14:87367058-87367080 CTGTGTCCTCACAAGGTAGAAGG + Intergenic
1120865523 14:89292602-89292624 CTGTGTCTTCACATGGCAGAAGG - Intronic
1121428517 14:93870915-93870937 CTGTGTCCTCACACGGCAGAAGG - Intergenic
1122281560 14:100625832-100625854 CTGTGTCCTCACAAGGCAGAAGG - Intergenic
1122304697 14:100755511-100755533 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1122361695 14:101171072-101171094 CTGTGTCTTCACATGGCAGAAGG + Intergenic
1122671528 14:103376389-103376411 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1123122329 14:105922518-105922540 CTGTGTCATCACATGGCGGAAGG - Intronic
1123404987 15:20014083-20014105 CTGTGTCATCATATGGCAGAAGG - Intergenic
1123514318 15:21020731-21020753 CTGTGTCATCATATGGCAGAAGG - Intergenic
1125237167 15:37528907-37528929 CTGTGTCCTCACATGGCAAGGGG + Intergenic
1126117911 15:45225739-45225761 CTGTGTCCTCAAAGGGCAGAGGG + Intergenic
1126369871 15:47934238-47934260 CTGTGTCCTCACATGGCGGGAGG + Intergenic
1126565300 15:50090509-50090531 CTGTGTCCTCACATGGCAGAAGG - Intronic
1127241597 15:57121594-57121616 CTGTATCTTCAAATGGCAGAAGG - Intronic
1128230980 15:66034955-66034977 CTGTGTCATAACATGGCAGAGGG - Intronic
1128455800 15:67830691-67830713 CTGTCTCCTCTAAAGGCAGAAGG + Intronic
1129630013 15:77248566-77248588 CTGTGTCCTCACATGGCAGAAGG - Intronic
1129670573 15:77605696-77605718 CAGGGTCATCCAGAGGCAGGAGG - Intergenic
1129911380 15:79229942-79229964 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1130405984 15:83602453-83602475 CTGTGTCCTCACATGGCAGAAGG + Intronic
1130429607 15:83833349-83833371 CTGTGTCCTCACATGGCAGAAGG + Intronic
1131072407 15:89474513-89474535 CTGCATCATCCAATGGCAGGTGG + Intronic
1131518831 15:93098333-93098355 CTGTGTCATAATATGGCAGAAGG + Intergenic
1131560745 15:93437250-93437272 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1132625667 16:890343-890365 CTGTGACTTGAAAAGGCATGAGG - Intronic
1132862030 16:2076508-2076530 GGGTGTCATCAAAAGACAAGAGG - Exonic
1133358293 16:5153295-5153317 CTGATTCATGGAAAGGCAGGAGG + Intergenic
1133568714 16:7020680-7020702 CTGTGTCATCACACTGCAGAGGG + Intronic
1133666953 16:7978051-7978073 CTGTCTCTTCTAAAGACAGGAGG + Intergenic
1133830176 16:9315693-9315715 CTGTGACATCAAAAGGGAGACGG + Intergenic
1134310229 16:13069848-13069870 CTGTGTCCTCACAGGGCAGAAGG - Intronic
1135253961 16:20925655-20925677 CTGTGTCGTTATAAGGCAGAAGG + Intergenic
1135650296 16:24200624-24200646 CTGTGTCATCCCATGGCAGAAGG + Intronic
1135690651 16:24534761-24534783 CTTTGTCAGCAACAGGAAGGAGG + Intergenic
1135745342 16:25012146-25012168 ATGAATCAACAAAAGGCAGGTGG + Intronic
1137982070 16:53078416-53078438 CTGTGTCATCAGGTGGCAGAAGG - Intronic
1138307057 16:55988051-55988073 CTGTGTCATAACAGGGCAGAAGG - Intergenic
1138605139 16:58083810-58083832 CTGTGAAATCAAGAGGCAAGGGG + Intergenic
1138890046 16:61130778-61130800 CTGTGCCATCTAAAGGGAGGTGG - Intergenic
1139011111 16:62635532-62635554 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1139022812 16:62772857-62772879 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1139264050 16:65622972-65622994 CTGGGTCAATGAAAGGCAGGAGG + Intergenic
1140020482 16:71233671-71233693 CTGTGTCTTCACATGGCAGAAGG - Intergenic
1140333046 16:74076370-74076392 CTATGTCATAATAAAGCAGGAGG + Intergenic
1140706875 16:77638972-77638994 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1140777650 16:78264756-78264778 CTGTGTCCTCACATGGCAGAAGG - Intronic
1141179588 16:81743462-81743484 CTGCGTGGTCAAAAGCCAGGAGG + Intronic
1141624447 16:85253893-85253915 CTGTGTGTGCAAAGGGCAGGAGG + Intergenic
1141651018 16:85393262-85393284 CTGTCTCAAGAAAAGGGAGGCGG + Intergenic
1142507276 17:372534-372556 CTGTGTCCTCACATGGCAGGAGG - Intronic
1143454339 17:7056416-7056438 CTGTGTCCTCACAGGGCAGAAGG - Intergenic
1143517802 17:7428796-7428818 CTGAGTCATAATGAGGCAGGTGG - Intergenic
1143907395 17:10220096-10220118 CTGTGTCATAACATGGCAGAAGG - Intergenic
1143919841 17:10322442-10322464 CTGTGTTATCAGGAAGCAGGAGG + Intronic
1144192249 17:12857392-12857414 CTGTGTCATAACATGGCAGAGGG + Intronic
1144457014 17:15427009-15427031 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1145378411 17:22373054-22373076 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1145850834 17:28094428-28094450 CTCGGTCAGCAAAAGGCAAGTGG - Intronic
1147437699 17:40427723-40427745 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1148671370 17:49413029-49413051 CTGTGGTATGAAATGGCAGGAGG + Intronic
1149258632 17:54855477-54855499 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1150515902 17:65808979-65809001 CTGTGTCATAACATGGCAGAAGG - Intronic
1150600663 17:66648113-66648135 CTGTGTCCTCACATGGCAGAAGG + Intronic
1150634570 17:66903939-66903961 TGGTGTCCTCAAAAGGCAGAGGG + Intergenic
1152466177 17:80467868-80467890 CTGTGTTATCAAAAGCAAGAAGG + Exonic
1153819068 18:8817313-8817335 CTGTGTCATCATCAGGGAGGTGG + Intronic
1154179467 18:12119525-12119547 CTGTGTCCTCACATGGCAGAAGG + Intronic
1155343947 18:24840104-24840126 CTGTGTCCTCACACGGTAGGAGG - Intergenic
1156092025 18:33482829-33482851 CTGAGTCATCCCAAGGCAGAAGG + Intergenic
1156423324 18:36980031-36980053 CTGTGTCATCACATGGCAGAAGG - Intronic
1156534296 18:37847910-37847932 TTGTGTATTCAAAAGGGAGGAGG + Intergenic
1156585730 18:38428908-38428930 CTTAGTCCTCAAAAGGGAGGAGG + Intergenic
1156685297 18:39637693-39637715 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1156806592 18:41190453-41190475 CTTTGTCAGCAGAAGGCATGAGG + Intergenic
1156931444 18:42649641-42649663 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1156950687 18:42893421-42893443 CTGTGTCCTCAAAAGGCAGAAGG + Intronic
1157110625 18:44816853-44816875 CTGGGTCAGGAAAAGGCAAGAGG - Intronic
1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG + Intergenic
1157301752 18:46484438-46484460 CTGTGTCCTCACATGGCAGAAGG - Intronic
1157647035 18:49285022-49285044 CTGTGTCTTCACATGGCAGAAGG - Intronic
1157901703 18:51524274-51524296 TTGTATCATCACAAGGCAGAAGG + Intergenic
1157942666 18:51946133-51946155 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1158727566 18:59987384-59987406 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1159152006 18:64533727-64533749 CTATGCCATCACAAGCCAGGAGG + Intergenic
1159202962 18:65211394-65211416 CTGTGTCTTCACACGGCAGAAGG - Intergenic
1159232515 18:65627760-65627782 CTGTGGCAAAAAAAGGCAGGGGG - Intergenic
1159493840 18:69174553-69174575 CTGTGTCATAACATGGCAGAGGG - Intergenic
1160103058 18:75941892-75941914 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1160348480 18:78153879-78153901 CTGTGTTCTCACATGGCAGGAGG + Intergenic
1161435255 19:4259021-4259043 CTGTGTCCTCAGAAGGCGGCTGG - Intronic
1162878851 19:13642103-13642125 CTGTGTCATAACATGGCAGAGGG - Intergenic
1164439876 19:28267518-28267540 CTGTGTCCTCAAAAGGCAAAAGG + Intergenic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1164760838 19:30727181-30727203 CTGTGTCTTCAAATGTCAGAAGG + Intergenic
1164964745 19:32472561-32472583 CTCTTTCAGCAAAAGTCAGGCGG + Intronic
1165164362 19:33841027-33841049 CATTGCCATGAAAAGGCAGGGGG - Intergenic
1165600086 19:37047349-37047371 CTGTGTCCTCACATGGCAGAAGG - Intronic
1165758971 19:38309575-38309597 TTGTGTCATCGAAAAGCTGGTGG + Exonic
1166248440 19:41547797-41547819 TTTTGTCATCAAAAGCCAGCTGG + Intergenic
1167845339 19:52158999-52159021 CTGTGTCCTCACATGGCAGAAGG - Intronic
1168281734 19:55309564-55309586 CTGTGTCTTCACATGGCAGAAGG + Intronic
1168413180 19:56152761-56152783 CTGTGTCCTCACAGGGCAGAAGG + Intronic
1202714508 1_KI270714v1_random:34673-34695 CTGAGTCTTCAAGAGGGAGGAGG - Intergenic
925270105 2:2599615-2599637 CTGTGCACTCAAAAGGCAGGGGG + Intergenic
925317604 2:2937829-2937851 CTGTTTCAAAAAAAGGGAGGTGG - Intergenic
925749585 2:7075604-7075626 CTTTGTCATGACACGGCAGGAGG - Intergenic
925880638 2:8349604-8349626 CTGTGTCCTCACATGGCAGAAGG + Intergenic
926489492 2:13506439-13506461 CTGTGTCATCACATGGCAGAAGG + Intergenic
926498078 2:13616587-13616609 CTGTGTCCTCACAAGGCAGAAGG - Intergenic
926863457 2:17333789-17333811 CTGTGTTATCACATGGCAGAAGG - Intergenic
927482506 2:23465444-23465466 CTCTATCAGCAAGAGGCAGGAGG + Intronic
928072220 2:28228303-28228325 CTGTGTCCTGGAAAGGCAGAAGG + Intronic
928307158 2:30179639-30179661 CTGTGTCCTCACATGGCAGAAGG + Intergenic
928411755 2:31059757-31059779 CTGTGTCTTCACATGGCAGAAGG - Intronic
928929258 2:36607139-36607161 TTGTGTCATCTCAAGGCAGAAGG + Intronic
929314959 2:40465935-40465957 CTGTGTCCTCACATGGCAGAAGG - Intronic
929489720 2:42385476-42385498 CAGTGTCAGCAAAATGCAGGAGG + Intronic
929797852 2:45073735-45073757 CTGTGTCCTCACATGGCAGAGGG - Intergenic
930154077 2:48087776-48087798 CTGTGCCATCACATGGCAAGAGG + Intergenic
930207418 2:48602065-48602087 CCGTGTCCTCACATGGCAGGAGG + Intronic
930394024 2:50796985-50797007 CTGTGTCCTCACATGGCAGAAGG + Intronic
930620774 2:53641433-53641455 CTCTGTCAGGAAAAGGGAGGGGG - Intronic
930866166 2:56123948-56123970 CTGTGTCCTCACAAGGCACAGGG + Intergenic
931210202 2:60186487-60186509 CTGTGTCCTCACATGGCAGAAGG + Intergenic
931290492 2:60869019-60869041 GTGTGTCATCACATGGCAGAAGG + Intergenic
931307327 2:61043061-61043083 TTGTGTCATAACATGGCAGGAGG - Intronic
931579937 2:63761267-63761289 CTGTGTCATCCCATGGCAGGAGG - Intronic
931654700 2:64500454-64500476 GTGTGGTATCAAAAGGCAGTGGG - Intergenic
931861254 2:66356830-66356852 CAGTGTCAGCAACAGTCAGGTGG - Intergenic
932294817 2:70615561-70615583 CTTTGTCCTCACATGGCAGGAGG + Intronic
932790364 2:74649632-74649654 CTGTGTCATCCCATGGCAGAAGG + Intergenic
932797495 2:74709743-74709765 CTGTGTCATCCCATGGCAGAAGG + Intergenic
933107911 2:78356713-78356735 CTGTGTCCTCACATGGCAGAAGG + Intergenic
933223751 2:79721317-79721339 CTGTGTCATAAAATGGCAGAAGG + Intronic
934539349 2:95161057-95161079 CTGTGTCCTCACATGGCAGGAGG - Intronic
935478678 2:103557951-103557973 CTGTGTCCTCACATGGCAGAAGG + Intergenic
935716455 2:105943509-105943531 CTGTGTCCTCACATGGCAGAAGG + Intergenic
936596902 2:113856785-113856807 CTGTGTCCTCACATGGCAGAAGG - Intergenic
937420281 2:121748374-121748396 CTGTGTCTTCATATGGCAGAAGG - Intronic
938213692 2:129490306-129490328 CTGTGTCAGCAAAATGGATGTGG + Intergenic
938318716 2:130347666-130347688 CTGTGTCCTCACATGGCAGGAGG - Intronic
938737811 2:134202362-134202384 CTGTGTACTCAAATGGCAGAAGG - Intronic
938775422 2:134537408-134537430 CTGTGTCCTTACAAGGCAGGGGG + Intronic
938974723 2:136465276-136465298 CTGTGTCCTCACATGGCAGAAGG + Intergenic
939903394 2:147879305-147879327 CTGTGTCCTCACAGGGCAGAGGG + Intronic
940174730 2:150865448-150865470 CTGTGTCATCCCATGGCAGAAGG + Intergenic
940285564 2:152029787-152029809 CTGTGTCCTCAAATGGTAGAAGG - Intronic
940372571 2:152919115-152919137 CTGTGTCCTCACATGGCAGAAGG - Intergenic
940515327 2:154677232-154677254 CTGTGTCATAACATGGCAGAGGG - Intergenic
940613173 2:156016328-156016350 CTGTGTCCTCACAAGGTAGGGGG + Intergenic
940850045 2:158679280-158679302 CTGTGTCATTGAAAGGGAAGAGG - Intronic
943539378 2:189193034-189193056 CTGTGTCATCCCATGGCAGAAGG - Intergenic
943678872 2:190746485-190746507 CTGTGTCTTCACATGGCAGAAGG - Intergenic
944467605 2:200018786-200018808 CTGTGTCCTCACATGGCAGAAGG + Intergenic
944835199 2:203572482-203572504 CTGTGTCATAAACAAGCACGAGG - Intergenic
944948405 2:204717666-204717688 CTATGTCAAATAAAGGCAGGTGG + Intronic
945666058 2:212744175-212744197 CTATGTCATAACATGGCAGGAGG - Intergenic
945930721 2:215852544-215852566 CTGTGTCCTCACATGGCAGAAGG + Intergenic
945974476 2:216259556-216259578 CTGGAGGATCAAAAGGCAGGAGG - Exonic
946138573 2:217668593-217668615 CTCTGTCATCAAATCGCACGTGG + Intronic
946293425 2:218763747-218763769 CTGTGTCCTCACATTGCAGGAGG + Intergenic
946637703 2:221747863-221747885 CTGTGTCCTCACATGGCAGAAGG - Intergenic
946823744 2:223655697-223655719 CTGTGTCCTCAAATGGCTGAAGG - Intergenic
946866738 2:224047657-224047679 CTGTGTCCTCACATGGCAGGAGG - Intergenic
947202914 2:227631242-227631264 CTCTTTCTTCAAAAGGCAGGGGG - Intronic
947845134 2:233237701-233237723 CTGTGTCCTCACATGGTAGGAGG + Intronic
948006934 2:234617331-234617353 CCTTGTCATCGGAAGGCAGGTGG + Intergenic
948222815 2:236287076-236287098 GTTTGTCAGCAAAAGGCAAGAGG + Intergenic
948281544 2:236751088-236751110 CTGTGTCTTCAAATGGTAGAAGG + Intergenic
948511332 2:238467184-238467206 CTGTGTCCTCACATGGCAGAGGG + Intergenic
1168777352 20:459037-459059 CTGTGACATAAAAAGGGAAGAGG + Intronic
1168865363 20:1081372-1081394 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1169348012 20:4844757-4844779 CTGTCTCAAGAAAAGGAAGGAGG + Intergenic
1169737294 20:8850682-8850704 CTGTGTCCTCACATGGCAGAAGG - Intronic
1169830832 20:9823140-9823162 CTGTGTCCTCACATGGCAGAAGG - Intronic
1170014028 20:11760641-11760663 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1170435932 20:16328797-16328819 CTGTGTTCTCACATGGCAGGAGG + Intronic
1170794625 20:19535908-19535930 CTGTGTCATCCCATGGCAGAAGG + Intronic
1170967476 20:21087918-21087940 CTGTGTAATTAATTGGCAGGAGG - Intergenic
1171431561 20:25086052-25086074 CTGTGTCATCAACTGACAGAGGG + Intergenic
1171524866 20:25800936-25800958 CTGTGTCCTCACATGGCAGAAGG + Intronic
1171551961 20:26054947-26054969 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1171781224 20:29420089-29420111 CTTTGTAATGACAAGGCAGGAGG - Intergenic
1171793071 20:29546247-29546269 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1171855380 20:30338159-30338181 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1172045588 20:32077825-32077847 CTGTGGTATAAAAAGGAAGGAGG - Intronic
1172232371 20:33345593-33345615 CTCTGTCATCAACAGTCTGGCGG + Intergenic
1172758202 20:37302363-37302385 GTGTGGCATCAACAAGCAGGTGG + Intronic
1173163702 20:40671330-40671352 CTGTCTCACCACAAGGCATGTGG - Intergenic
1173218266 20:41108627-41108649 CTGTGTAATCAAAATCCTGGGGG - Intronic
1173519987 20:43692187-43692209 CTCTACCATCAAAAGGAAGGTGG + Exonic
1173904806 20:46618593-46618615 CTGTGTCCTCACATGGCAGAAGG - Intronic
1174144546 20:48442276-48442298 CTGTGTCCTCAAACGACAGAAGG + Intergenic
1174310010 20:49645351-49645373 CTATGTCATCACTAGGCAGTAGG - Intronic
1175142537 20:56871824-56871846 ATGGGTGATCAAAAGGAAGGCGG - Intergenic
1176037353 20:63046172-63046194 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1177006246 21:15675872-15675894 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1177040722 21:16106934-16106956 CTGTGTCATCTCATGGCAGAAGG + Intergenic
1177096861 21:16846358-16846380 CTGTGTCATAACATGGCAGAAGG + Intergenic
1177208941 21:18045820-18045842 CTGTGTCCTCACATGGCAGAAGG - Intronic
1177575574 21:22950682-22950704 CTGTGTCATCCCATGGCAGGAGG + Intergenic
1177693605 21:24542070-24542092 CTGTGTCTTCACATGGCAGAAGG + Intergenic
1178071408 21:28972152-28972174 CTGTGTCCTCACATGGCAGAAGG - Intronic
1178168228 21:30007462-30007484 CTGTGTCATCACACGGTAGAAGG + Intergenic
1178328337 21:31663586-31663608 CTGTGTCCTCAAAAGGGAGATGG - Intronic
1178383192 21:32128687-32128709 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1179131496 21:38641290-38641312 CTGTGTCCTCAAATGGTAGAAGG - Intronic
1179149824 21:38800215-38800237 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1179382855 21:40915447-40915469 GTCTGACATCCAAAGGCAGGAGG - Intergenic
1181330384 22:22086416-22086438 GCGTGTCATCAGAAGGCTGGGGG + Intergenic
1181665483 22:24393022-24393044 CTGTGTCATCAAAGGTGGGGTGG - Intronic
1182817640 22:33180014-33180036 CTGTGTCCTCACATGGCAGAAGG - Intronic
1182951033 22:34376036-34376058 CTGTGTCATAACATGGCAGAGGG + Intergenic
1182986330 22:34721428-34721450 CTGAGTCTTCACAAGGAAGGGGG + Intergenic
1183047017 22:35228422-35228444 CTGTGTCCTCACAAGACAGAGGG - Intergenic
1183387209 22:37521705-37521727 CCCTGTCTGCAAAAGGCAGGCGG + Intergenic
1183729881 22:39612218-39612240 CTGTGTCATCACGTGGCAGAAGG - Intronic
1184549989 22:45199395-45199417 CTGTGTCACCAAAGAGCACGTGG + Intronic
1184559782 22:45255542-45255564 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1184899178 22:47433615-47433637 ATGTGTCATTAAAAGGCATTTGG + Intergenic
1185201263 22:49506987-49507009 CTGTCTCATAAAAAGGAAGAAGG + Intronic
949416023 3:3814753-3814775 CTGTGTCTTCACATGGCAGAAGG - Intronic
949636257 3:5984641-5984663 CTGTATCATCACATGGCAGAAGG + Intergenic
950531742 3:13556299-13556321 CTGTGTCCTCACAAGGTGGGGGG + Intronic
951889985 3:27559507-27559529 CTGTGTTCTCACATGGCAGGGGG + Intergenic
952011422 3:28904527-28904549 CTGTGTCCTCACATGGCAGAAGG + Intergenic
952478917 3:33739802-33739824 CTGAGCCATAAAAAGACAGGGGG - Intergenic
952830607 3:37561754-37561776 CAGTGTCATAAAAAGCCACGCGG - Intronic
953042156 3:39265000-39265022 CTGTGTCATGTAAAGTCTGGGGG + Exonic
953144366 3:40260845-40260867 CTGTGTCATCCCATGGCAGAAGG + Intergenic
953145372 3:40270077-40270099 CTGTGTCCTCACACGGCAGAAGG + Intergenic
953437879 3:42894159-42894181 CTGTGTCCTCATATGGCAGAAGG + Intronic
953875480 3:46664256-46664278 GTCTGTCATCAAATGACAGGGGG + Intergenic
954608888 3:51933893-51933915 CTGTGTCACCAGGTGGCAGGAGG - Intronic
954928635 3:54260413-54260435 CTGTGTCATAACATGGCAGAAGG + Intronic
955026919 3:55176639-55176661 CTGTGTCATCCCATGGCAGATGG + Intergenic
955040111 3:55308236-55308258 CCGTGTCCTCACAAGGCAAGGGG + Intergenic
955241644 3:57183234-57183256 CTGTGTCCTCACATGGCAGAAGG + Intergenic
955423642 3:58764799-58764821 CTGAGTCCTCAAGAGGAAGGAGG - Intronic
955525705 3:59817656-59817678 CTGTGCCTTTAAAAGGCTGGAGG - Intronic
955998062 3:64698364-64698386 CTGTGTCATCACATGGCAGAAGG + Intergenic
956271571 3:67453418-67453440 CTGTGTCCTCACATGGCAGAAGG + Intronic
956689554 3:71863426-71863448 CTGTGTCCTCACATGGCAGAAGG + Intergenic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
956758361 3:72412967-72412989 CTGTGTCCTCACATGGCAGAAGG - Intronic
956919189 3:73908274-73908296 CTGTGTCCTCACATGGCAGAAGG - Intergenic
957062811 3:75495883-75495905 CTGATTCATGAAAAGGCAGGAGG + Intergenic
957310304 3:78510337-78510359 CTGTGTCCTCACATGGCAGAAGG + Intergenic
957477310 3:80741146-80741168 CTTTGACATCAAAAGGAAGAGGG + Intergenic
957786709 3:84891638-84891660 CTGTGGAAACAAAAGACAGGAGG - Intergenic
958069905 3:88596915-88596937 CTGTGTCCTCACATGGCAGAAGG - Intergenic
958686799 3:97408670-97408692 CTGTGTCCTCACATGGCAGAAGG + Intronic
959051489 3:101528787-101528809 CTGTGTCTTCACATGGCAGATGG - Intergenic
960164051 3:114381792-114381814 CTGTTTCTTCAGAGGGCAGGAGG + Intronic
960241115 3:115343198-115343220 CTGTGTCCTCACACGGCAGAAGG - Intergenic
960356429 3:116659209-116659231 CTGTGTCCTCACATGGGAGGTGG - Intronic
960362776 3:116734518-116734540 CTGTGTCCTCCACAGGCATGCGG + Intronic
960668108 3:120130848-120130870 CTGTCTCCTCAGAATGCAGGTGG - Intergenic
961290587 3:125843533-125843555 CTGATTCATGACAAGGCAGGAGG - Intergenic
962099084 3:132322969-132322991 CTGTGTCATAACATGGCAGAAGG - Intronic
962368261 3:134800122-134800144 CTGGGAGATGAAAAGGCAGGTGG - Intronic
962440665 3:135412742-135412764 CTGTGGCAGCCAAGGGCAGGTGG - Intergenic
962991448 3:140581032-140581054 CTCAGTCATGAAAAGTCAGGAGG - Intergenic
963103608 3:141626834-141626856 CTGTGCCCTCCAGAGGCAGGCGG - Intergenic
963261575 3:143197129-143197151 CTGTGTCCTCACACGGCAGAAGG - Intergenic
963847379 3:150172859-150172881 CTGTGTCCTCACAGGGCAGAAGG - Intergenic
965230901 3:166051835-166051857 CTGTGTCATCACATGGTAAGAGG - Intergenic
965529456 3:169756728-169756750 CTGAGTCATCCACAGCCAGGTGG - Intergenic
966288750 3:178329581-178329603 CTGTGTCCTCACATGGCAGAAGG + Intergenic
966316930 3:178657770-178657792 CTGTGTCATAACATGGCAGATGG + Intronic
966338706 3:178901274-178901296 CTGTGTCATCCCATGGCAGAAGG - Intergenic
966393234 3:179475019-179475041 CTGTGTCATCCAATGGCAGGAGG + Intergenic
967719608 3:192801606-192801628 CTGTGTCCTCACATGGCAGAAGG - Intronic
967959754 3:194911067-194911089 CTGTGTCCTCACATGGCAGGAGG + Intergenic
968497259 4:925713-925735 CTGTGTCCTCACAGGGCAGAAGG - Intronic
968926745 4:3552340-3552362 CTGTGTCATCACATGGCAGAAGG - Intergenic
969006710 4:4026017-4026039 CTGATTCATGAAAAGGCAGGAGG + Intergenic
969361606 4:6667586-6667608 CTGTGTTTTCACATGGCAGGAGG - Intergenic
970162718 4:13205358-13205380 CTGTGTCCTCACATGGCAGAAGG + Intergenic
970222996 4:13829639-13829661 CTGTGTCATAACATGGCAGAGGG - Intergenic
970918662 4:21367035-21367057 CTGTGTCCTCACATGGCAGGAGG - Intronic
970964564 4:21913404-21913426 CTGTGTCCTCACATGGCAGAAGG - Intronic
971047182 4:22817790-22817812 CTGTGTCCTCATATGGCAGAAGG - Intergenic
971077595 4:23167894-23167916 CTGTGTCTTCACATGGCAGAAGG + Intergenic
971302739 4:25455451-25455473 CTGTGTCATCCAGTGGCAGAAGG + Intergenic
971412693 4:26391982-26392004 ATGTGTCCTCACATGGCAGGAGG + Intronic
971794747 4:31212597-31212619 CTGTGTCATAACATGGCAGAAGG - Intergenic
972181369 4:36470847-36470869 CTGTGTCCTCACATGGCAGAAGG - Intergenic
972263601 4:37437309-37437331 CTGTGTCCTCACAGGGCAGGAGG + Intronic
972847704 4:43009650-43009672 CTGTGTCATCACATGGTAGAAGG + Intronic
973062862 4:45750927-45750949 CTGTGTCCTCACATGGCAGAAGG + Intergenic
973558504 4:52110143-52110165 CTGTGTCCTCATATGGCAGAGGG - Intergenic
973766126 4:54164670-54164692 CTGTGTCCTCACATGGCAGAAGG + Intronic
974202033 4:58655152-58655174 CTGTGTCCTCACATGGCAGAAGG + Intergenic
974382485 4:61159375-61159397 CTGTGTCATCCCATGGCAGACGG + Intergenic
974437221 4:61871385-61871407 TTGTGTAATCAAAAGGAATGAGG + Intronic
974821462 4:67071374-67071396 CTGTGTCCTCACATGGCAGAGGG - Intergenic
975244458 4:72103391-72103413 CCGTGTCATCACAAGGCAGGAGG - Intronic
975839194 4:78455947-78455969 CAGAGTAATCCAAAGGCAGGTGG + Intronic
975974777 4:80082195-80082217 CTGTGTCCTCAGATGGCAGAAGG + Intronic
976074682 4:81284411-81284433 CTGTGTCCTCACACGGCAGAAGG + Intergenic
976437341 4:85033285-85033307 CTGTGTCATCACATGGTAGAAGG + Intergenic
976468107 4:85394667-85394689 CTGTGTCATCACATGGCAGAAGG + Intergenic
976710480 4:88065679-88065701 CAGAGACATCAAAATGCAGGAGG - Intronic
976953484 4:90864503-90864525 ATGTGTCATCACATGGTAGGAGG - Intronic
977490705 4:97706427-97706449 CTGTGTCCTCACATGGCAGAAGG - Intronic
977706778 4:100080428-100080450 CTGTGCCATCCAATGGCAGAAGG + Intergenic
977748467 4:100579864-100579886 CTGTGTCCTCACATGGCAGAAGG - Intronic
977748602 4:100581009-100581031 CTGTGTCCTCACATGGCAGAAGG - Intronic
977880495 4:102198942-102198964 CTGTGTCCTCACATGGCAGAAGG + Intergenic
977916530 4:102600506-102600528 GTGTGTCAGGAAAAGTCAGGGGG + Intronic
978367934 4:108002122-108002144 CTGTGTCCTCATATGGCAGAAGG - Intronic
978863628 4:113480885-113480907 CTGTGTCTTCACATGGCAGAAGG - Intronic
979174388 4:117644490-117644512 CTGTGTCCTCACATGGCAGAAGG + Intergenic
979616419 4:122747687-122747709 CTGTGTCTTCACATGGCAGAAGG - Intergenic
979824011 4:125210619-125210641 CTGTGTCATCACATGGGAGACGG + Intergenic
980535194 4:134111166-134111188 CTGTGTCTTCACAAGGCAGAAGG + Intergenic
980662324 4:135878579-135878601 CTGTGTCCTCACATGGCAGAAGG - Intergenic
981244006 4:142513363-142513385 CTGTGTCCTCACATGGTAGGAGG + Intronic
981377559 4:144033419-144033441 CTGTGTCCTCACATGGCAGAAGG - Intergenic
981497478 4:145410327-145410349 CTGTCTCAAGAAAAGGGAGGTGG - Intergenic
982268653 4:153564337-153564359 CTATGTCCTCAAATGGCAGAAGG - Intronic
982277074 4:153647083-153647105 CTGTCTCATCACATGGCAGAAGG + Intergenic
982287213 4:153747962-153747984 CTGTGTCATCTCATGGCAGAAGG + Intronic
982421043 4:155198042-155198064 ATATGTCATCAAAAGGTATGTGG + Intergenic
982951193 4:161698147-161698169 CTGTGTCCTCACATGGCAGAAGG - Intronic
983500638 4:168495397-168495419 CTGTGTCCTCACATGGCAGAAGG - Intronic
984244128 4:177254193-177254215 CTGTGTCATGTCATGGCAGGTGG - Intergenic
984273113 4:177572559-177572581 CTGTGTCATAACATGGCAGAAGG + Intergenic
984305414 4:177983193-177983215 CTGTGTCCTCACAGGGCAGAAGG - Intronic
984399516 4:179243900-179243922 CTGTGTCCTCACATGGTAGGAGG + Intergenic
984863387 4:184259187-184259209 CTGTGTCCTCACATGGCAGAAGG - Intergenic
984900649 4:184583230-184583252 CTGTGTCCTCACATGGCAGAAGG - Intergenic
985254736 4:188058473-188058495 CTGTGTCCTCACATGGCAGAAGG + Intergenic
985698897 5:1358743-1358765 CTGTGTCCTCCAATGTCAGGGGG - Intergenic
986226686 5:5822307-5822329 CTGTGTCCTCCAAAGCCACGGGG + Intergenic
986363479 5:7005016-7005038 TTTTGTCATCACAAGGCAGGAGG - Intergenic
986535650 5:8784129-8784151 CTGTGTCCTCACATGGCAGAAGG - Intergenic
986575921 5:9213049-9213071 CTGTGTCCTCACAAGGTGGGAGG + Intronic
986912214 5:12572329-12572351 CTGCATCATCAAATGGCAGAAGG + Intergenic
987455425 5:18138703-18138725 CTCTCTCATCAAAAGACTGGAGG - Intergenic
987575842 5:19726932-19726954 CTGTGTCATCATATGGCAGAAGG - Intronic
987941351 5:24542785-24542807 CTGTGTCTTCACATGGCAGAAGG + Intronic
988063455 5:26203587-26203609 CTGTGTCTTCACATGGCAGAAGG - Intergenic
988288567 5:29254896-29254918 CTGTGTCCTCACATGGCAGAAGG + Intergenic
988441354 5:31237293-31237315 CTGTGTCCTTAAAAGGATGGAGG + Intronic
988802736 5:34711657-34711679 CTGTGTCCTCATATGGCAGAAGG - Intronic
989213612 5:38881387-38881409 CTGAGTTTTCAAAAGGCAGGAGG + Intronic
989311659 5:40025607-40025629 CTGTGTCATAACATGGCAGAAGG - Intergenic
990322059 5:54639861-54639883 ATGTATCAGCAAAAGCCAGGTGG + Intergenic
990532046 5:56683821-56683843 CTGTGTCTTCACATGGCAGAAGG - Intergenic
990559259 5:56967160-56967182 CTGTGTCCTCAAATGGTAGAAGG - Intronic
991349146 5:65702590-65702612 CTGTGTCCTCACATGGCAAGAGG + Intronic
991514851 5:67424000-67424022 CTGTGTCCTCACATGGCAGAAGG - Intergenic
992058684 5:73019993-73020015 CTCTGTCATCAAAGGGCTGCTGG - Intronic
992261205 5:74972082-74972104 CTGTGTCTTCATATGGCAGAAGG - Intergenic
993021904 5:82602114-82602136 CTGTGTCCTCAAATGGCAGAAGG + Intergenic
993023362 5:82618478-82618500 CTGTGTCCTCACATGGCAGAAGG + Intergenic
993354932 5:86894118-86894140 CTGTGTCATCACATGGCAGAAGG - Intergenic
993748476 5:91633025-91633047 CTGTGTCAACAGAAGGAAAGTGG + Intergenic
993998267 5:94748192-94748214 CTGTGTCTTCCAAAGGTATGTGG + Intronic
994052856 5:95382051-95382073 CTGTGTCTTCACATGGCAGAGGG + Intergenic
994908725 5:105873746-105873768 TTGTGTCTTCAAATGGCAGAGGG + Intergenic
995377746 5:111495388-111495410 CTGTGTCCTCATATGGCAGAAGG + Intergenic
995755482 5:115499190-115499212 CTGTGTCCTCACATGGCAGAAGG + Intergenic
996437729 5:123453950-123453972 ATGTGGCATCAAGAGGCAGGAGG - Intergenic
996914742 5:128698880-128698902 CTGTATCATCAAAAGGCTCTGGG - Intronic
997385805 5:133471519-133471541 CTGTGTCCTCACATGGCAGAAGG - Intronic
997753173 5:136369642-136369664 CTGTGTCATAACAGGGCAGAAGG - Intronic
997779067 5:136638894-136638916 CTGTCTCATCACAGGGCAGGAGG + Intergenic
998388144 5:141770131-141770153 CTGTGTCTTCACATGGCAGAAGG + Intergenic
998822208 5:146067227-146067249 GTGTGTCTTGAAAAGTCAGGGGG + Intronic
1000042900 5:157498313-157498335 CTCTGCCATCCAGAGGCAGGTGG + Intronic
1000731855 5:164844528-164844550 CTATGTCAGCAAAAGGCACAGGG - Intergenic
1000966044 5:167658161-167658183 CTGTGTCCTCACATGGCAGATGG + Intronic
1001548507 5:172585543-172585565 TTGTGTGCTCAAAAGCCAGGTGG - Intergenic
1001814271 5:174654928-174654950 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1002119400 5:176990305-176990327 CTGTGTCTTCACATGGCAGAAGG - Intronic
1002592139 5:180298181-180298203 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1002883979 6:1277496-1277518 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1004105033 6:12659697-12659719 CTGTGAAATCAAAAGACAAGTGG - Intergenic
1004371811 6:15059342-15059364 CTGTGTCTTCATATGGCAGAAGG + Intergenic
1004564914 6:16787294-16787316 CTGTGTTCTCACATGGCAGGAGG - Intergenic
1004823194 6:19392499-19392521 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1004971752 6:20918153-20918175 CTGTGTCCTCACATGGCAGAAGG - Intronic
1005878497 6:30034709-30034731 CTGTGTCTTCACATGGCAAGTGG - Intergenic
1006115276 6:31772954-31772976 CTGGGTCATGAAAAGGCACCAGG + Exonic
1007031888 6:38635668-38635690 CTGTGTCATAACATGGCAGAAGG - Intronic
1007076123 6:39067454-39067476 CTGTGTCCTCACATGGCAGAGGG + Intronic
1007164520 6:39819788-39819810 CTGTGTCCTCACATGGCAGATGG + Intronic
1008614813 6:53216472-53216494 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1008615552 6:53222277-53222299 CTGTGTCTTCACATGGCAGAAGG - Intergenic
1008638015 6:53431981-53432003 CTGTGTCTTCACCTGGCAGGAGG + Intergenic
1008756754 6:54804849-54804871 CTTTGTCATCAAAAGGTCTGTGG + Intergenic
1009878707 6:69538570-69538592 CTGTGTCCTCACAAAGCAGAAGG + Intergenic
1010473652 6:76261052-76261074 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1010652971 6:78477730-78477752 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1011073264 6:83409063-83409085 CTGTGTCCTCACATGGCAGAAGG - Intronic
1011078617 6:83464937-83464959 CTGTGTAGTAAAAAGGCAGAGGG + Intergenic
1012065753 6:94549423-94549445 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1012079154 6:94733940-94733962 ATGTGTCATCACATGGCAGAAGG + Intergenic
1012431883 6:99172523-99172545 CTGAGCCATAAAAAGGGAGGAGG + Intergenic
1012496144 6:99835577-99835599 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1013597595 6:111674093-111674115 CAGTGTAATCAAAAAGCAGTGGG + Intronic
1013692615 6:112663798-112663820 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1013729926 6:113153638-113153660 CTGTGTCATCTCATGGCAGAAGG - Intergenic
1013823696 6:114185355-114185377 CTGTGTCTTCACATGGCAGAAGG - Intronic
1013996063 6:116309766-116309788 CTGTGTCTTCATATGGCAGAAGG + Intronic
1014559185 6:122870405-122870427 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1014952796 6:127578075-127578097 CTGTGTCATCAGCAGGGAGTGGG - Intronic
1015091882 6:129368253-129368275 CTGTGTCCTCACACGGCAGAAGG - Intronic
1015210110 6:130687242-130687264 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1015494798 6:133869240-133869262 CTGTGTCCTCATGAGGCAGAAGG - Intergenic
1015606389 6:134959311-134959333 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1015731890 6:136357497-136357519 CTGTCTCAAAAAAAAGCAGGGGG - Intronic
1015840980 6:137476963-137476985 CTGTGTCTTCACATGGCAGAAGG - Intergenic
1016265397 6:142227390-142227412 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1016286429 6:142478280-142478302 CTGTGTCATCACATGGCAGGAGG - Intergenic
1016388040 6:143548172-143548194 CTGTGTCCTCACATGGCAGAGGG + Intronic
1016563216 6:145420790-145420812 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1016745479 6:147574709-147574731 CTGTGTCATCACATAGCAGAAGG + Intronic
1017192372 6:151668230-151668252 CTGTGTCCTCATATGGCAGAAGG + Intronic
1017627918 6:156367335-156367357 CTGTGTCATAACATGGCAGAAGG + Intergenic
1017662843 6:156690693-156690715 CTGGGTCATAAAAATGCAAGTGG + Intergenic
1017761441 6:157573023-157573045 CTTGGTCATCAAAGGGCATGTGG - Intronic
1018061744 6:160095000-160095022 CTCTGTCATCAAAGGGCTGCTGG + Intronic
1018225870 6:161628377-161628399 CTGTGTCTTCACACGGCAGAAGG + Intronic
1018296119 6:162346017-162346039 CTGTGTCATAACATGGCAGAGGG - Intronic
1018736051 6:166688055-166688077 GTGAGTATTCAAAAGGCAGGAGG + Intronic
1018750560 6:166800528-166800550 CTGTGTCCTCACATGACAGGAGG - Intronic
1018805141 6:167253462-167253484 CTGTGTCCTCACATGGCAGAGGG + Intergenic
1018805444 6:167255830-167255852 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1019464055 7:1176775-1176797 CTGACTCATCAGAAGCCAGGTGG - Intergenic
1019623506 7:2003773-2003795 CACTGTCATCAGGAGGCAGGTGG + Intronic
1020327214 7:6984162-6984184 CTGATTCATGGAAAGGCAGGAGG + Intergenic
1020676080 7:11186446-11186468 CTGTGTCCTCACAAGGTAGAAGG - Intergenic
1021064077 7:16150817-16150839 CTGTGTCATCCTATGGCAGGAGG + Intronic
1021412795 7:20347057-20347079 CTGTGTCTTCATATGGCAGAAGG - Intronic
1021686132 7:23188103-23188125 CTGTTTCCTCAAAAGGACGGAGG - Intronic
1021976937 7:26020223-26020245 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1022150292 7:27596222-27596244 CTGTGTCCTCACATGGCAGAAGG + Intronic
1022212470 7:28224970-28224992 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1023603471 7:41904467-41904489 CTGTGTCTTCACATGGCAGAAGG - Intergenic
1023963931 7:44951629-44951651 CTGTGTCATCTCATGGCAGAAGG + Intergenic
1023988877 7:45115997-45116019 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1024132021 7:46362773-46362795 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1024210475 7:47199008-47199030 CTGTGTCCTCACATGGCAGGGGG + Intergenic
1024678838 7:51662236-51662258 CGGTGCCATCAAGATGCAGGGGG - Intergenic
1024937277 7:54723036-54723058 CTATTTCATTAGAAGGCAGGAGG + Intergenic
1025285527 7:57657536-57657558 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1025887896 7:65615578-65615600 CTGTGTCCTCACATGGCAGATGG + Intergenic
1026136162 7:67663069-67663091 CTGTGTCATCTGAAGGCAGTAGG + Intergenic
1027160158 7:75796573-75796595 GTGTCTCATCAAAAGAAAGGTGG - Intergenic
1027382646 7:77627251-77627273 CTTTCTCATCAAGAGGCAAGCGG - Exonic
1027761459 7:82284606-82284628 CTGAGTCCTCACATGGCAGGAGG + Intronic
1028210581 7:88069274-88069296 CTGTGTCATCATATGGTAGAAGG - Intronic
1028331480 7:89600092-89600114 CTGTGTCCTCACATGGCAGGAGG - Intergenic
1028446942 7:90935076-90935098 CTGTGTCATCCAAGGGCAGCAGG + Intronic
1028776839 7:94687284-94687306 CTGTGTCCTCATATGGCAGAAGG + Intergenic
1029442090 7:100592577-100592599 CTGGGTCCTCAAAAGAGAGGTGG - Intronic
1029952582 7:104602825-104602847 CTGTGTCATCCCATGGCAGAAGG + Intronic
1030203446 7:106929056-106929078 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1030814866 7:114023454-114023476 CTGTGTCCTCAAATGGCAGAAGG + Intronic
1030897497 7:115079028-115079050 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1031116612 7:117675900-117675922 CTGTGTCATCCCATGGCAGAAGG - Intronic
1031136448 7:117889559-117889581 CTGTGTGATCAAACGGCATTTGG - Intergenic
1031203447 7:118721863-118721885 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1031349108 7:120706455-120706477 CTGTGTCTTCACATGGCAGAAGG + Intronic
1031854493 7:126906160-126906182 CTGTGTCCTCACATGGCAGATGG - Intronic
1032417246 7:131745487-131745509 CTTAGTCATTAAAAGGCAGGAGG + Intergenic
1032724498 7:134578016-134578038 GTGTGTTATCAATAGGCAGGAGG + Intronic
1032876857 7:136047104-136047126 CTGTGTCCTCACAGGGCAGAAGG + Intergenic
1033093311 7:138406705-138406727 CTATGTCATCATATGGCAGAAGG - Intergenic
1033366521 7:140676200-140676222 CTGTGTCATCACATGGTAGAAGG + Intronic
1033616823 7:143024329-143024351 CTGTGTCATCCTATGGCAGAAGG - Intergenic
1033714535 7:143986036-143986058 GTGTGTCAACAAAAGCCAGAAGG - Intergenic
1033980219 7:147155221-147155243 CTGTGTCCTCACATGGCAGAAGG - Intronic
1034055879 7:148034497-148034519 CTGTGTCATAACATGGCAGAAGG - Intronic
1034496174 7:151424058-151424080 CTGTGTCCTCACACGGCAGAAGG - Intergenic
1034716448 7:153247053-153247075 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1034747355 7:153534881-153534903 CTCTGTCATCAGGAGGCAGTAGG + Intergenic
1035088369 7:156281359-156281381 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1035863941 8:3060865-3060887 CCGTGTCATCACATGGCAGGAGG - Intronic
1035892875 8:3364714-3364736 CTGTGACATCACATGGCAGAAGG - Intronic
1036122144 8:6030196-6030218 CTGTGTCCTCACATGGTAGGAGG - Intergenic
1036161794 8:6395872-6395894 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1036168090 8:6456731-6456753 CTGTCTGATCAAAAGGCATGAGG + Intronic
1036917644 8:12820203-12820225 CTGGGTCTTCACATGGCAGGAGG + Intergenic
1038036215 8:23689060-23689082 CTGTGTCCTCACATGGCAAGAGG + Intergenic
1038074848 8:24060547-24060569 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1038402081 8:27291793-27291815 CTGTGTCATCCCATGGCAGAAGG + Intronic
1038841435 8:31188075-31188097 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1040586873 8:48751979-48752001 CTGTGTCTTCACATGGCAGAGGG - Intergenic
1040702547 8:50084857-50084879 CTGTGTCATAAAATGTCAGAAGG - Intronic
1041191308 8:55357953-55357975 CTGTGTCAACAAAGGGCATTAGG - Intronic
1042076606 8:65002204-65002226 CTGTGTCATCCAAGAGCAGAAGG + Intergenic
1042076984 8:65007209-65007231 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1042096384 8:65220367-65220389 CTGTGTCCTCACACGGCAGAAGG - Intergenic
1042169553 8:65978341-65978363 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1042747367 8:72121890-72121912 CTGACTCATGAAAAGGCAGTAGG + Intergenic
1042936653 8:74066196-74066218 CTGTGTCCTCATATGGCAGAAGG + Intergenic
1043320197 8:78975157-78975179 CTGTGTCCTGACAAGGCAGAAGG + Intergenic
1043322431 8:79006125-79006147 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1043357423 8:79429303-79429325 CTGTGTCATCACAAGGCAGAAGG - Intergenic
1043506182 8:80905384-80905406 CTGTGTCATAACATGGCAGAAGG - Intergenic
1043604016 8:81977356-81977378 CTGTGTCCTCACATGGCAGAGGG - Intergenic
1043966458 8:86482915-86482937 CTGTTTCCTCCAGAGGCAGGTGG + Intronic
1043996913 8:86829185-86829207 CTGTGTCCTCATATGGCAGGAGG + Intergenic
1045313364 8:101022850-101022872 CTGTGTCATAACACGGCAGAGGG - Intergenic
1045683144 8:104683850-104683872 CTGTGTCCTCACATGGCAGAAGG + Intronic
1046650448 8:116831651-116831673 CTGTGTCCTCACATGGCATGGGG - Intronic
1047252866 8:123193772-123193794 CTGTGTCCTCACATGGCAGAAGG + Intronic
1047452837 8:124981754-124981776 CTGTGTCATAACATGGCAGAAGG + Intergenic
1047532411 8:125688923-125688945 CTGTGTCATCCCATGGCAGGAGG + Intergenic
1047683574 8:127279970-127279992 CTGTGACAATAACAGGCAGGTGG - Intergenic
1047766326 8:127992855-127992877 CGGTGTCACCAAAGGCCAGGAGG - Intergenic
1048639059 8:136332552-136332574 CTGTGGTACCAAAAGGCAGGAGG + Intergenic
1049246477 8:141565476-141565498 CTGTACCATCTAAAGGCATGTGG + Intergenic
1050206774 9:3204695-3204717 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1050225983 9:3456044-3456066 CTGTGTCCTCACATGGCAGAAGG + Intronic
1051080802 9:13291165-13291187 CTGTGTAATCCACAGGCAGGTGG + Intergenic
1051114918 9:13683712-13683734 CTGTGTCGTCACATGGCAGAAGG + Intergenic
1051922881 9:22288307-22288329 CTGTATCATCACATGGCAGAAGG + Intergenic
1051964846 9:22815314-22815336 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1052127415 9:24794437-24794459 CTGTGTCATTCCAAGGCAGAAGG - Intergenic
1053233010 9:36427555-36427577 CTGTGTCCTCACAAGGCAAAAGG - Intronic
1053563851 9:39226420-39226442 CTGTATCATAACAAGGCAGAAGG + Intronic
1053793209 9:41701444-41701466 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1053801662 9:41767722-41767744 CTGTGTCATCACATGGCAGAAGG - Intergenic
1053829638 9:42064317-42064339 CTGTGTCATAACAAGGCAGAAGG + Intronic
1054133297 9:61392650-61392672 CTGTATCATAACAAGGCAGAAGG - Intergenic
1054143542 9:61547104-61547126 CTGTGTCATCACATGGCAGAAGG + Intergenic
1054151968 9:61613395-61613417 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1054181618 9:61913456-61913478 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1054190094 9:61979876-61979898 CTGTGTCATCACATGGCAGAAGG - Intergenic
1054463315 9:65478439-65478461 CTGTGTCATCACATGGCAGAAGG + Intergenic
1054471740 9:65544525-65544547 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1054600923 9:67123137-67123159 CTGTGTCATAACAAGGCAGAAGG - Intergenic
1054648421 9:67608715-67608737 CTGTGTCATCACATGGCAGAAGG + Intergenic
1055669537 9:78588955-78588977 CTGTGTCATCACATGGCAGAAGG - Intergenic
1055753884 9:79536316-79536338 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1055840109 9:80493519-80493541 CTGTGTCATCCCAGGGCAGAAGG + Intergenic
1056100283 9:83294196-83294218 CTGTGTCCTCACATGGCAGAAGG - Intronic
1056333262 9:85539520-85539542 CTGTGTAATGAAAAGGCAGGGGG + Intergenic
1056396468 9:86186018-86186040 CTTTGTATTCAAAAGGCAGCTGG + Intergenic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1057035106 9:91806317-91806339 CTGTGTCCTCACATGGCAGAAGG + Intronic
1057517807 9:95736796-95736818 CTTGCTCATTAAAAGGCAGGCGG - Intergenic
1057707037 9:97402275-97402297 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1058145263 9:101403668-101403690 CTGTGTCTTCACATGGCAGAAGG + Intronic
1058188428 9:101883903-101883925 CTGTGTCCTCAAATGGTAGAAGG - Intergenic
1059881594 9:118696420-118696442 CTGTGTCCTCAAATGGCAGAGGG + Intergenic
1059945123 9:119401826-119401848 CTCAGTCATGAGAAGGCAGGGGG - Intergenic
1060319314 9:122541091-122541113 CTGCTGAATCAAAAGGCAGGAGG - Intergenic
1060739264 9:126087509-126087531 CTGTGTCATAACATGGCAGGAGG + Intergenic
1061683633 9:132257735-132257757 CTGTGTCATTGAAAGGGAAGAGG + Intergenic
1061956154 9:133962244-133962266 CAGTGTCTTCTGAAGGCAGGAGG + Intronic
1062637100 9:137497303-137497325 CTGTGTCTTCCGCAGGCAGGGGG - Exonic
1203365274 Un_KI270442v1:250303-250325 GAGTGTCAGCAAAAGGGAGGCGG - Intergenic
1185697877 X:2209005-2209027 CTGTGTGCTCACAAGGCAGTGGG + Intergenic
1185774400 X:2790794-2790816 CTGTCTCAAAAAAAGGCGGGGGG + Intronic
1186562017 X:10622586-10622608 CTGTGTCCTCACATGGCAGAAGG - Intronic
1186651976 X:11570981-11571003 CTGTGTCCTCACATGGCAGAAGG - Intronic
1186709466 X:12178146-12178168 CTGTATCCTCAAATGGCAGAAGG - Intronic
1186940295 X:14499685-14499707 CTGGGACTCCAAAAGGCAGGAGG + Intergenic
1187013323 X:15302101-15302123 CTGTGTCATGAGATGGCAGCTGG - Intronic
1187316712 X:18202522-18202544 CTGTGTCCTCACATGGCAGAAGG - Intronic
1187440508 X:19313758-19313780 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1187550002 X:20293052-20293074 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1187609375 X:20924602-20924624 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1187944647 X:24414446-24414468 CTGTGTCATCCCACGGCAGAAGG - Intergenic
1188620966 X:32223241-32223263 CTGTATCTTCACAAGGCAGAAGG + Intronic
1188686299 X:33074683-33074705 CTGGGGCATCACATGGCAGGAGG - Intronic
1188719458 X:33505381-33505403 CTCTGTCATCACAAGCCTGGAGG + Intergenic
1189367125 X:40397470-40397492 CTGTGTCTTTACAAGGCAGAAGG + Intergenic
1189394928 X:40612899-40612921 CTGTGTCGTCACATGGCAGAAGG + Intergenic
1189569759 X:42283940-42283962 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1189582131 X:42417768-42417790 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1189622037 X:42851809-42851831 TTGTTTCATCAAAAAACAGGTGG - Intergenic
1189916161 X:45857742-45857764 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1189973577 X:46441198-46441220 CTGTGTCATAACATAGCAGGAGG + Intergenic
1190997599 X:55625288-55625310 CTTTATCATCAAAAGGCTTGGGG - Exonic
1191910681 X:66146223-66146245 CTGTGTCCTCACAAGGCAGAAGG - Intergenic
1192123640 X:68480033-68480055 CTGTGTCATAACATGGCAGAGGG - Intergenic
1192695459 X:73410500-73410522 CTGAGTCATCAAAGAGCAGGAGG + Intergenic
1192780282 X:74287067-74287089 CTGTTTCTTCAAAAAGCATGTGG - Intergenic
1193698095 X:84734320-84734342 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1193903418 X:87212763-87212785 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1194629348 X:96264513-96264535 CCATGTCTTCACAAGGCAGGGGG + Intergenic
1195050662 X:101093873-101093895 CTGTGTCCTCACATGGCAGAAGG + Intronic
1195168015 X:102239352-102239374 CTGTGTCATCCAATGGCAGAAGG + Intergenic
1195190842 X:102447735-102447757 CTGTGTCATCCAATGGCAGAAGG - Intronic
1195292588 X:103443470-103443492 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1195600593 X:106742965-106742987 CTGTGTCATGAAATGGGAAGTGG + Intronic
1195761941 X:108255891-108255913 TGGAGTCATCATAAGGCAGGAGG + Intronic
1197312045 X:124916831-124916853 TTGTGTCATCACATGGCAGAAGG - Intronic
1197356078 X:125438647-125438669 CTGTCACATCAAAAGGAAGGAGG - Intergenic
1197378335 X:125709570-125709592 CTTTGGCATCCAAAGTCAGGAGG - Intergenic
1197712966 X:129685392-129685414 CTGTGTCTTCACATGGCAGAAGG + Intergenic
1197765586 X:130057521-130057543 ATGTACCATCCAAAGGCAGGAGG + Exonic
1197827890 X:130610201-130610223 CTGTGTCCTCACAAAGCAGAAGG - Intergenic
1198078819 X:133219457-133219479 CTGTGTCCTCACATGGCAGCAGG + Intergenic
1198232037 X:134699325-134699347 CTGTGTCCTCATTAGGCAGAAGG - Intronic
1198546442 X:137697449-137697471 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1198798114 X:140421202-140421224 CTGTGTCATAACATGGCAGAGGG + Intergenic
1198911825 X:141623511-141623533 CTGTGTCTTCACATGGAAGGTGG - Intronic
1199194705 X:145014424-145014446 CTGTGTCCTCACACGGCAGAAGG + Intergenic
1199370776 X:147044877-147044899 CTGTGTCTTCACATGGCAGAAGG + Intergenic
1199695073 X:150338196-150338218 CTGTGTCCTCACACGGCAGAAGG + Intergenic
1199736064 X:150687766-150687788 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1199797458 X:151214174-151214196 CTGTGTCCTCACAAGGCAGATGG + Intergenic
1200382979 X:155859130-155859152 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1200815214 Y:7524423-7524445 CTGTGTCTTCAAATGGTAGAAGG - Intergenic
1201676102 Y:16586110-16586132 CTGTGTCCTCACATGGCAGAAGG - Intergenic