ID: 1108323990

View in Genome Browser
Species Human (GRCh38)
Location 13:49312327-49312349
Sequence CAGTTGCTCTGGGGGAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 10, 3: 54, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108323990_1108323997 2 Left 1108323990 13:49312327-49312349 CCCTGACTCCCCCAGAGCAACTG 0: 1
1: 0
2: 10
3: 54
4: 266
Right 1108323997 13:49312352-49312374 AGTCCTGTAAGCTCCATTTATGG 0: 2
1: 67
2: 373
3: 606
4: 591
1108323990_1108324000 19 Left 1108323990 13:49312327-49312349 CCCTGACTCCCCCAGAGCAACTG 0: 1
1: 0
2: 10
3: 54
4: 266
Right 1108324000 13:49312369-49312391 TTATGGTAAGTTCCCTATACAGG 0: 2
1: 23
2: 168
3: 393
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108323990 Original CRISPR CAGTTGCTCTGGGGGAGTCA GGG (reversed) Intronic
902124921 1:14201439-14201461 CAGCTGCTCCGGGGCAGCCAGGG - Intergenic
902639021 1:17754671-17754693 CAGGTTTTCTGGGGAAGTCAGGG - Intergenic
903537230 1:24074991-24075013 CACTTGCTCTTGGGAGGTCAAGG + Intronic
905510576 1:38516682-38516704 CAGAGCCTCTGGGGGAGGCAGGG - Intergenic
905511034 1:38520437-38520459 AAGTTGCTCTGGTTGAGTCAGGG + Intergenic
906406938 1:45549595-45549617 GAGTTGCTCTCAGGGAGTAAAGG + Intergenic
910667102 1:89737515-89737537 AAGCTGCTCTGGGTGAGTCAGGG + Intronic
911585674 1:99687866-99687888 CAGTTTTTCTTGGGTAGTCAAGG + Intronic
913142826 1:115958343-115958365 CAGCTGCTCTGTGGGAGACCAGG - Intergenic
913318903 1:117575253-117575275 CAGTATCTCTGTGGGAGTCTAGG - Intergenic
917545059 1:175957247-175957269 AAGCTGCTCTCGGTGAGTCAGGG - Intronic
917703041 1:177600548-177600570 CAGCTGCACTGGGGGTTTCAGGG + Intergenic
918278385 1:182977638-182977660 AAGTTGTTCTGTGTGAGTCAGGG + Intergenic
918424623 1:184395699-184395721 CAGTTTCCCTGGGGCAGTCCTGG + Intronic
919135236 1:193499265-193499287 GATTTTCTCTGGGGGAATCAAGG + Intergenic
919621273 1:199866924-199866946 GAGGTGCTCTGGGGGAGTGGGGG - Intergenic
920309169 1:205038486-205038508 CAGATGACCTGGGGCAGTCAAGG + Intergenic
922136841 1:222837034-222837056 CAGTTGCACTTGTGTAGTCATGG - Intergenic
922635043 1:227159836-227159858 GGGTGGCTCTGGGGGAGTGAGGG + Intronic
923474649 1:234321193-234321215 CAGTCCTTCTGGGGGAGTCTGGG - Intronic
1063956674 10:11273647-11273669 CCGTTCCTCTGGGGAAGTCCAGG - Intronic
1064093046 10:12401639-12401661 CAGTTTGTCTGGGAGACTCAGGG + Intronic
1066050264 10:31628173-31628195 CAGTTGCTCTGGACAAGTCTGGG - Intergenic
1067272406 10:44803721-44803743 CGATTCCTCTGGGGGAGTTAGGG + Intergenic
1069357479 10:67603893-67603915 AAGTTGCTCTCAGTGAGTCAGGG - Intronic
1069716675 10:70525702-70525724 CCGATGCTTTGGGGGAGTCACGG - Intronic
1069987210 10:72292618-72292640 GAGTTGCTGTGGGGGAGGCTGGG - Intergenic
1070098571 10:73363380-73363402 AAGTTGCTCTGGGTGAGTGAAGG + Intergenic
1071209222 10:83318176-83318198 GAGTTGCTGTCGGGGAGTCAGGG - Intergenic
1071473324 10:86003265-86003287 GACTTGCTCTTGGGAAGTCAGGG + Intronic
1071511412 10:86264724-86264746 CTGTTGCTCTGAAGGAGGCAGGG - Intronic
1071520711 10:86330109-86330131 CTCCTGCCCTGGGGGAGTCACGG - Intronic
1074747812 10:116553028-116553050 AAGTTGCTCTGGGCAAGTCATGG - Intronic
1074913425 10:117933279-117933301 AAGTTGCTTTGGGTGAGTCAGGG - Intergenic
1075068155 10:119303545-119303567 TAGTGGTTGTGGGGGAGTCACGG + Intronic
1076442319 10:130488501-130488523 CAGTCGGTCTGGGGAGGTCAAGG + Intergenic
1076909107 10:133378759-133378781 CAGTGGGTCTGGGGGTGCCACGG - Intergenic
1077751969 11:4981555-4981577 AGGTTGCTCTGGGTGAGTCAGGG + Intronic
1078066597 11:8082836-8082858 CAGCTCCTGTGGGGGATTCAGGG + Intronic
1078575235 11:12496443-12496465 CAGTTTCTCTGAGGGTGACAAGG - Exonic
1080518501 11:33045430-33045452 CACTTGAGCTGGGGAAGTCAAGG + Intronic
1083231253 11:61321670-61321692 CACTTGCTCTGGGGCTTTCAAGG - Exonic
1083328361 11:61885212-61885234 CAGCTGCTGTGTGGGATTCACGG - Intronic
1084107891 11:66992298-66992320 CAGCTGCCCTGGGGGTGGCATGG + Intergenic
1084203593 11:67577999-67578021 CAGTTACTCTGGGGGGTTTAGGG + Intergenic
1084337500 11:68468631-68468653 CAGCTGCTCTGCGGAAGTCAGGG + Intronic
1084548870 11:69828897-69828919 CAGTGGGGCTGGGGGAGCCATGG - Intergenic
1084794248 11:71494169-71494191 AAGCCGCTCTGGGTGAGTCAGGG - Intronic
1085466869 11:76730042-76730064 CACTTTCCCTGGGAGAGTCAAGG + Intergenic
1086195403 11:84132784-84132806 CAGTTTCTTTGAGGGAGTAATGG + Intronic
1087432515 11:98071408-98071430 AAGTTGCTCTGGGTGAGGGAGGG - Intergenic
1087734653 11:101818369-101818391 AAGTTGCCCTGGGTGAATCAAGG + Intronic
1089504706 11:118955784-118955806 CTGCTGCTCTGGGAGAGGCAGGG - Intronic
1089695749 11:120215387-120215409 CAGTTGCTCTAGGGGAGGGGAGG + Intronic
1089932562 11:122328795-122328817 CAGATGTCCTGGGAGAGTCAGGG + Intergenic
1090910257 11:131111978-131112000 CAGCTGCAGTGGGGGAGGCACGG - Intergenic
1091144833 11:133269419-133269441 CAGTTACTCTGGGGATTTCACGG + Intronic
1091575207 12:1727594-1727616 CTGCTGCTCTGGGAGAGGCAGGG - Intronic
1091610479 12:2003898-2003920 CTGTGGCTATGGGGGAGGCAGGG - Intronic
1092171902 12:6378826-6378848 CTGGGGCTCTGGGGGAGTCTGGG - Intronic
1092546501 12:9456753-9456775 AAGTTGCTCTGGGTGAGTCAGGG - Intergenic
1092555270 12:9553170-9553192 AAGTTACTCTGAGTGAGTCAGGG + Intergenic
1092785456 12:12022509-12022531 CAGCTGCTCTGGTGAACTCAAGG + Intergenic
1092990114 12:13888848-13888870 AAGTTGCTCTGAGTGAGTCAGGG + Intronic
1094506440 12:31065329-31065351 AAGTTGCTCTGGGTGAGTCAGGG + Intergenic
1094516830 12:31137510-31137532 AAGTTACTCTGAGTGAGTCAGGG - Intergenic
1095865195 12:46964201-46964223 GAGTTGCTCTTTGGCAGTCAAGG - Intergenic
1096142783 12:49256179-49256201 CAGTTGCATTGGGGGTTTCATGG - Intronic
1096791600 12:54048316-54048338 AGGTTTCTCTGGGGGAGTCAAGG + Intronic
1097334509 12:58366968-58366990 AAGTTGCTCCTGGGGAGGCATGG + Intergenic
1097380100 12:58884683-58884705 CAGTTCCTCTGAGGGAGACTTGG - Intronic
1097471060 12:59991980-59992002 CAGTTGCTCTGTGGAAATCAGGG - Intergenic
1097795997 12:63862448-63862470 CAGTTGGTCTGTGGAAGACATGG + Intronic
1103496883 12:121369732-121369754 CAGTTGGTCTGGGGCAGCCTGGG + Intronic
1106414363 13:29534065-29534087 CAGCTGCTTTGGGGGTGACAGGG - Intronic
1106475423 13:30094225-30094247 CAGGTGCTCTGGGGTAGCCATGG + Intergenic
1108323990 13:49312327-49312349 CAGTTGCTCTGGGGGAGTCAGGG - Intronic
1109061857 13:57631033-57631055 CAGTTTTTCTGGGCGACTCAGGG - Intergenic
1109124080 13:58497241-58497263 CAGTTTCTGTGGGAGAGTAAGGG + Intergenic
1109466038 13:62732856-62732878 CACTTGCTCTGGGAGTGTCCAGG - Intergenic
1112201818 13:97283848-97283870 CACTTGCTCTTAGGGAGTCACGG - Intronic
1112203540 13:97301846-97301868 CAGTTGCTCTGGGTGACTTATGG + Intronic
1113341152 13:109427255-109427277 AAGTTGCTATGGTGGAGTGAAGG + Intergenic
1113424432 13:110196253-110196275 CAGTGGCTGTGGGGGACCCATGG - Intronic
1113591498 13:111504518-111504540 CAGGTGCTCTTGGCAAGTCAGGG - Intergenic
1113694478 13:112334322-112334344 AAGTTGCTCTGGGTGAGTCAGGG - Intergenic
1113866183 13:113526808-113526830 AGGTTGCTCTGAGTGAGTCAGGG - Intronic
1113893294 13:113747882-113747904 CAGTAGATCTGGGTGAGTCCAGG - Intergenic
1115316975 14:32035226-32035248 CAGTTGGTCTGGGGTAGGCCAGG - Intergenic
1116001081 14:39243434-39243456 CAGTTTCCCTGGAGGATTCAAGG + Intronic
1117049886 14:51849270-51849292 CATTTGCTCTGGGGGAAACCAGG - Intronic
1119338661 14:73856161-73856183 AAGTTGCTCTGGATGAGTCAGGG - Intronic
1121983113 14:98472113-98472135 CAGTTGCACTGGAGGAACCAAGG - Intergenic
1122142229 14:99669149-99669171 CAGCTGCTCTGGGAGTCTCAGGG + Intronic
1122888593 14:104722604-104722626 CAGTGGGTCTGGGGGTGTCAAGG - Intergenic
1123007162 14:105329489-105329511 CAGGAGCTCTGGGAGAGTCTAGG + Intronic
1123040714 14:105489176-105489198 GAGAGGCTCTGGGGGAGTTATGG + Intronic
1124023590 15:25944999-25945021 CAGTTGTCCTGGGAGAGTTAAGG + Intergenic
1124959642 15:34384863-34384885 CAGCTGCTGTGGGTGAGTCGGGG - Intronic
1124976268 15:34531084-34531106 CAGCTGCTGTGGGTGAGTCGGGG - Intronic
1125743182 15:41981783-41981805 CAGTTGCTCTGGTGGAGGGGAGG + Exonic
1126336565 15:47591524-47591546 CACTTGCTCTGGGGGAAGCTAGG - Intronic
1126869851 15:52976299-52976321 CATTTGCTCTGGGTGACTAAAGG + Intergenic
1128232849 15:66047728-66047750 CAGTGGGCCTGGGGGAGTCTGGG + Intronic
1128293232 15:66495639-66495661 CAGGTGTTCTGGCTGAGTCATGG + Intronic
1132033171 15:98455832-98455854 AAGTTTCTCTGGGTGATTCAGGG - Intronic
1132210760 15:100020530-100020552 TGATGGCTCTGGGGGAGTCAGGG - Intronic
1132288566 15:100683608-100683630 CAGATGCTCTGGTGGAGTGCAGG + Intergenic
1133756468 16:8766156-8766178 GAGATGCTCTGGGGTAGTCGGGG - Intronic
1134193480 16:12140328-12140350 CAGTAGCTCTGGAGAAGTCTTGG + Intronic
1135133391 16:19870684-19870706 CAAATGCTTTGGGGGAGCCAGGG + Intronic
1135165098 16:20132017-20132039 CACTTGCTCTGGGGGAGGTCAGG + Intergenic
1135302758 16:21345154-21345176 GAGGTGCTCAGGTGGAGTCAGGG + Intergenic
1136270775 16:29147001-29147023 CAGGTGGTCTTGGGGAGTGAGGG - Intergenic
1136299516 16:29324368-29324390 GAGGTGCTCAGGTGGAGTCAGGG + Intergenic
1137377401 16:47964586-47964608 AAGTTGCTCTGGATGAGTCCGGG - Intergenic
1138336663 16:56258784-56258806 CAGCTCCTCTGGGAGAGACAGGG + Intronic
1138976407 16:62213786-62213808 CCATTGCACTGGGGGAGCCAAGG + Intergenic
1139297194 16:65911689-65911711 AAGTTGCTTTGGGTGAGTCAGGG - Intergenic
1139357478 16:66375625-66375647 TAATTGGTCTGGGTGAGTCAGGG + Intronic
1139594377 16:67949565-67949587 CACCTGCTCTGGGGGCCTCAGGG + Intronic
1141555397 16:84833848-84833870 CTGCTGGGCTGGGGGAGTCAGGG - Intronic
1141623541 16:85249648-85249670 CAGCTGCTCTGGGGCAGGCCTGG + Intergenic
1141952696 16:87348854-87348876 CAGTTGTTCTGCGGGATCCAGGG - Intronic
1142061262 16:88031197-88031219 GAGGTGCTCAGGTGGAGTCAGGG + Intronic
1143764248 17:9127186-9127208 CGGTTGCTCTGCAGGAGGCAGGG + Intronic
1144056190 17:11542966-11542988 AAGCTGCTCTGGGAGAGGCAGGG - Intronic
1144584823 17:16481851-16481873 CAGGTGCTCCTGGGGAGGCAGGG - Intronic
1144726703 17:17505959-17505981 CAGTGGCTCTGGGGGATGAAGGG - Intronic
1146027231 17:29332094-29332116 CATTTGTTCTGGGGGTGGCAGGG - Intergenic
1149062793 17:52443445-52443467 CAGTCGATCTGGAGGAGTAAGGG + Intergenic
1149261505 17:54884936-54884958 AAGTTGCTCTGGGTGAGTTAGGG + Intergenic
1151523493 17:74647835-74647857 CACTGGCTCTGTGGGAGTCCTGG + Intergenic
1151826707 17:76527840-76527862 CAGTTCCTCTGAGGGAGTAGGGG + Exonic
1152522202 17:80863053-80863075 CAGAAGCTCTGAGGGATTCATGG + Intronic
1152554396 17:81045796-81045818 GAGTGGCTCTGGGGGAGTCTGGG + Intronic
1153166366 18:2266123-2266145 CAGTTGATCTAGGGTAGTTAGGG + Intergenic
1153825359 18:8869509-8869531 CAGTTTATCTGGAGAAGTCAGGG - Intergenic
1158540226 18:58346933-58346955 GAGTGGCTCGGTGGGAGTCAGGG + Intronic
1159308174 18:66672994-66673016 AAGTAGCTCTGGGTGAGACAGGG - Intergenic
1159389141 18:67765857-67765879 AAGTTGTTCTAGGTGAGTCAGGG + Intergenic
1161610937 19:5242267-5242289 CAGTGGCTGTGTGGGAGACAAGG - Intronic
1161869840 19:6861753-6861775 GTGTGACTCTGGGGGAGTCACGG - Intergenic
1162236101 19:9310656-9310678 CACTTGAGCTGGGGAAGTCAAGG - Intergenic
1163018172 19:14469542-14469564 CAGATGCTGTAGGGGAGGCAGGG - Intronic
1164650352 19:29886856-29886878 CAGTGACTCTGGGGCAGGCAGGG + Intergenic
1165673027 19:37695619-37695641 CAGTTGCTGTGGGAGTGTAAGGG - Intronic
1166060806 19:40324165-40324187 CAGTAGCTCTGGGACAGGCAGGG + Intronic
1167002001 19:46751144-46751166 CACTTGAGCTGGGGAAGTCAAGG - Intronic
1167086225 19:47311535-47311557 CAGAGGCTCTGGGGTAGGCAGGG - Intronic
1167456949 19:49601476-49601498 CGGGGGCTCTGGGGGAGACAGGG - Exonic
924966986 2:86427-86449 AAGTTGCTCTGTGAGAGGCAGGG + Intergenic
925197383 2:1937241-1937263 CAGCTGCTCTGGGCAAGGCATGG - Intronic
927089148 2:19697416-19697438 CACTTGCTTTGGGGAAGTCTGGG - Intergenic
927207902 2:20621550-20621572 CACCTGCCCTGGGGGAGTCAAGG - Intronic
927730083 2:25463361-25463383 AAGTTGCTCAGGAGAAGTCATGG - Intronic
927935326 2:27072637-27072659 CTGTTGCTCTGGAGCTGTCAGGG + Intergenic
928933259 2:36647566-36647588 AAGTTGCTCTGGGTGAGTCCAGG - Intergenic
929452140 2:42045130-42045152 CAGAAGCCCTGGGGGAGACAGGG + Intergenic
930001123 2:46862148-46862170 CAGATGCCCTGGGGAGGTCAGGG - Intergenic
930186245 2:48415100-48415122 CTGTTGATATGGGGGAGGCAGGG + Intergenic
930865782 2:56120785-56120807 CAGATGTTCTGGGGGAGAAAGGG + Intergenic
931458869 2:62433211-62433233 CCGTTGCTCTTGGGGAGCCCTGG + Intergenic
932336536 2:70934856-70934878 CAGTTCCTCTGGGCAAGGCAGGG - Intergenic
936608197 2:113978107-113978129 CAGCTGCTGTGGATGAGTCATGG + Intergenic
936808956 2:116372677-116372699 CAGGTGCCATGGGGAAGTCATGG + Intergenic
937281937 2:120723411-120723433 CACTTTGTCTGGAGGAGTCAGGG + Intergenic
937534970 2:122875073-122875095 CAGTTCCTTTGAGGGAGGCAGGG - Intergenic
938462143 2:131504692-131504714 CACATGCTCTGGAGGGGTCAAGG - Intergenic
938750022 2:134319550-134319572 CAGTTGCACAGTGGGAGTGATGG + Intronic
940422954 2:153500011-153500033 CAGCTGCAGTGGGGGAGGCATGG - Intergenic
941522570 2:166565093-166565115 AAATTGCTCTGGGTGAGTCAGGG + Intergenic
942894698 2:181038110-181038132 AAGTTGGTCTGGGTGAGTCAGGG - Intronic
942915070 2:181295037-181295059 GAGGTGCTCTTTGGGAGTCAGGG - Intergenic
947618424 2:231573677-231573699 CAGTTGTTCTGCAGGAGTGAGGG - Intergenic
1169217221 20:3800838-3800860 CAGCAGCTCTGGGGAAGACAAGG + Exonic
1169703064 20:8470626-8470648 CACTTGATCTTGGGAAGTCAAGG - Intronic
1170834743 20:19874581-19874603 CAGGTACTGTGAGGGAGTCAGGG - Intergenic
1173005288 20:39135431-39135453 CACTTGCTCTGGGGACCTCAGGG + Intergenic
1173178605 20:40784346-40784368 CAGTTGCTCTGTGTGTCTCATGG - Intergenic
1173395788 20:42678125-42678147 CAGCAGCTCTGGGGGAGCAATGG + Exonic
1174053589 20:47784121-47784143 CAGGTTCTCAGGGGGAGACAGGG - Intronic
1176063581 20:63182783-63182805 CAGATGCTCTGATGGAGCCATGG + Intergenic
1176067931 20:63209166-63209188 GAGTTGCACTGGGTGAGTCAGGG + Intronic
1176187247 20:63787646-63787668 CTGTTGCTCTGGGAGCGTCATGG - Intronic
1177986481 21:27981356-27981378 CAGTTCCTATGGGGGATCCACGG + Intergenic
1179942866 21:44650935-44650957 CAGATGCTCTGGGGGAGGACAGG + Intronic
1180178432 21:46103984-46104006 CACATGCTCAGGGGAAGTCACGG + Intronic
1180903854 22:19394715-19394737 CAGCTCCTCTGGGGGAGTGTAGG - Intronic
1181033551 22:20159369-20159391 GAGCGGCTCTGGGGGAGGCAAGG - Intergenic
1181303872 22:21903065-21903087 CAGTGGCACTGGGGGAGTTCGGG - Intergenic
1181491352 22:23262643-23262665 CAGCTGCTCTTGGGCAGCCAGGG + Intronic
1183060922 22:35335941-35335963 CAGCTGCTGTGCGGGAGCCAGGG - Intronic
1184409491 22:44318306-44318328 CTGTTGCTTTGGGGGAGTGTTGG + Intergenic
1185131953 22:49044313-49044335 CAGGTGCACTGGGGGACGCAGGG + Intergenic
950705481 3:14777331-14777353 CAGTTTCTCTGGGGCAGGGAAGG - Intergenic
952422643 3:33145486-33145508 AAGTTTCTCTGGTGGAGTAAAGG - Exonic
952502310 3:33974905-33974927 AAGTTGCTCTGGGTGAGTCAGGG + Intergenic
953265222 3:41380618-41380640 CAGTTGGCCTGGGACAGTCAAGG + Intronic
953561846 3:43998314-43998336 CACTTGCTCTGGGGGAGCTTAGG + Intergenic
954459779 3:50619694-50619716 CAGATGCTGTGGGTGAGTCAGGG + Intronic
954803981 3:53204677-53204699 CAGTAGAGCTGGGGCAGTCAGGG - Intergenic
956084966 3:65598426-65598448 CCCTTGCTCTTGGGAAGTCAGGG - Intronic
957613912 3:82505178-82505200 CAGCTGCAGTGGGGGAGGCAGGG + Intergenic
957638107 3:82813721-82813743 AAGTTGCTCTAGGTGAGTCAGGG + Intergenic
958584596 3:96069629-96069651 CAGCTGCAGTGGGGGAGGCATGG - Intergenic
959426185 3:106191880-106191902 CAGTTGCTCTAATGGATTCAAGG + Intergenic
961385479 3:126521212-126521234 CTGCTGCTCTGTGGGAGGCAGGG - Intergenic
961487415 3:127226790-127226812 ACATTGCTCTGGGGGAGACAAGG + Intergenic
962885579 3:139622917-139622939 AAGTTGCTCTGGGTGAATCAAGG + Intronic
964407453 3:156364228-156364250 CAATTGCTCTGAGAGAGTAAAGG - Intronic
967148035 3:186622551-186622573 CAGTTGCTCTAGGGGCATCCTGG + Intergenic
968472372 4:787988-788010 CAGGTGCTCTGGAGTAGTGAAGG + Intronic
968871782 4:3246134-3246156 CAATTGCTCTGGGGAAGTCCAGG + Intronic
969409477 4:7018628-7018650 CAGTGGCTCATGAGGAGTCAGGG + Intronic
970049343 4:11896346-11896368 CAGAGGCACTGGGGTAGTCAGGG + Intergenic
973716961 4:53686334-53686356 AATTTGCTCTGGGAGAGCCAAGG + Intronic
973971258 4:56216059-56216081 CTGTAGCTGTGGGTGAGTCATGG + Intronic
974515158 4:62898296-62898318 CAGGTGCTCTGGCTGAGGCAGGG - Intergenic
976045403 4:80940591-80940613 CTGTTGCTGTAGGGGAGTGAGGG + Intronic
976630872 4:87235198-87235220 AAGTTGCTCTGGGTGAGTCAGGG - Intronic
979393851 4:120161888-120161910 AAGTTGCTGTGGGTGAGTCAGGG + Intergenic
979922808 4:126523008-126523030 GAGCTGCTTTGGGTGAGTCAGGG + Intergenic
980441270 4:132848397-132848419 AAGTTGCTCAGGGTAAGTCAGGG + Intergenic
982096873 4:151931337-151931359 CAGTAGTTCTGGGGCAGCCATGG + Intergenic
982901159 4:161003921-161003943 CAGCTGCAGTGGGGGAGGCATGG - Intergenic
983519008 4:168687515-168687537 CAGTTGATTTGGGGGTGCCAGGG + Intronic
984770685 4:183433885-183433907 TAGTTGCTCTGGGGGGGCCTTGG + Intergenic
985928838 5:3039496-3039518 AAGTGGCTCTGAGAGAGTCAGGG - Intergenic
985974266 5:3403073-3403095 AAGTGGCTCTGGGTGAGTCCGGG - Intergenic
986285782 5:6357770-6357792 AAGTTGCTCCGGGTGAGTCAGGG - Intergenic
986447451 5:7834586-7834608 AAGTTGCTCTGGGTGAGTCAGGG - Intronic
987079997 5:14417937-14417959 CACTGGCACTGGGGGACTCAGGG + Intronic
988416815 5:30955550-30955572 CACTTGCACTGGGGAGGTCAAGG + Intergenic
989791507 5:45408278-45408300 AAGCTGCTCTGGGTGAGTCAGGG - Intronic
989992437 5:50783027-50783049 GAGTTGCTCTGTAGGAGTTAGGG + Intronic
990567452 5:57043532-57043554 CAGACGCTATGGGGGAGTCCAGG - Intergenic
991725962 5:69536192-69536214 AAGTTGCTCTGGGTGAGTCAGGG + Intronic
991868994 5:71091675-71091697 AAGTTGCTCTGGGTGAGTCAGGG - Intergenic
992572828 5:78077359-78077381 CAGTTGGCCTTGGGGATTCATGG - Intronic
995058840 5:107792239-107792261 AAGTTGCTCTGGATGAATCAGGG + Intergenic
995324967 5:110880128-110880150 CAGCTGCTCTGGGAGAGAAAGGG - Intergenic
996192495 5:120563362-120563384 GAGATGCTCTCTGGGAGTCAGGG + Intronic
996688480 5:126310940-126310962 CAGTTTGTCTGGAGTAGTCAGGG - Intergenic
996926434 5:128832608-128832630 AAGTTACTCTGGGTGAGTCAGGG - Intronic
997337672 5:133119383-133119405 CAGGTGCTCTGGGGCAGACTGGG - Intergenic
997579880 5:135010589-135010611 CAGGTGCCCTGGGAGAGTGAAGG + Intronic
1002105860 5:176879208-176879230 CCCATGCTCTGGGGGAGTCTGGG + Intronic
1002456641 5:179349008-179349030 CAGATGCTCTGGCGGAGTTCTGG + Intergenic
1002591891 5:180296133-180296155 CTGGTGCTCTGGGGGATTCCCGG - Intergenic
1003147072 6:3517677-3517699 CAGGTGCTCTGGGTAAGCCAGGG - Intergenic
1005014076 6:21360935-21360957 CCGTTGCTCTGTGGGAGGAAGGG + Intergenic
1005976910 6:30807221-30807243 TAGTTGCTCTGGTGGAGCCTTGG - Intergenic
1007397770 6:41587282-41587304 CAGCTGCTGTGGGAGAGACAGGG - Exonic
1011521078 6:88207393-88207415 AAGTTGCTCTGGGTCAGTGAGGG + Intergenic
1012062173 6:94500913-94500935 AAATTGCTCTGGTTGAGTCAGGG + Intergenic
1013680508 6:112520547-112520569 CAGTTGCTCTGAGGGAGCAATGG + Intergenic
1014781671 6:125571961-125571983 CAGTTGCTAAGGGAGATTCAGGG - Intergenic
1015068880 6:129065507-129065529 CAGTTATTTTGGTGGAGTCAGGG - Intronic
1015959511 6:138632247-138632269 CAGGTGCTGTCTGGGAGTCAGGG - Intronic
1016608208 6:145959235-145959257 AGGTTGCTCTGGGTTAGTCAGGG - Intronic
1017460077 6:154641024-154641046 GTGTTGCTCTGGGTGAGTCAGGG - Intergenic
1020133920 7:5575371-5575393 CACTTGAGCTGGGGAAGTCAAGG - Intergenic
1025263866 7:57439990-57440012 GAGCTGAGCTGGGGGAGTCAGGG - Intergenic
1025635367 7:63316119-63316141 GAGCTGAGCTGGGGGAGTCAGGG + Intergenic
1025647327 7:63432051-63432073 GAGCTGAGCTGGGGGAGTCAGGG - Intergenic
1027188204 7:75984124-75984146 CAGTGGCCATGGGGGAGCCAGGG - Intronic
1027554578 7:79647816-79647838 CTGCTGCGCTGGAGGAGTCAAGG + Intergenic
1029812907 7:103067219-103067241 CAGTTGCTCAGGGGTAAGCACGG + Intronic
1032002608 7:128275292-128275314 CAGTTGCTCAGTGGAACTCAGGG - Intergenic
1032478216 7:132226707-132226729 CACTTCCTCTGGGGGGCTCAGGG + Intronic
1034712518 7:153206306-153206328 CAGTTTTTGAGGGGGAGTCATGG + Intergenic
1034780557 7:153876989-153877011 GAGTTGCTCTGAGTGAGTCTGGG + Intergenic
1035064068 7:156092569-156092591 AAGTTGCTCTGGGTGAGTCGGGG + Intergenic
1035522951 8:290116-290138 CATCTGCTCTGGGGGTGGCAAGG - Intergenic
1035776847 8:2194577-2194599 CATTTGCTCTGGTTGAGTCGGGG - Intergenic
1037648754 8:20817547-20817569 AAGTTGCTCTGGGTGAGTCAGGG + Intergenic
1037703029 8:21292434-21292456 AAGTTTCTCTGGGTGAGTCTGGG - Intergenic
1037867137 8:22453916-22453938 AAATTGCTCTGGGTGAGTCAGGG + Intronic
1038003401 8:23409642-23409664 AAGTTGCTTTGGCTGAGTCAGGG - Intronic
1038834385 8:31102693-31102715 AAGTTGCTCTGAGTGAGTGAGGG + Intronic
1041254977 8:55972169-55972191 CAGTGTCACTGGGAGAGTCACGG + Intronic
1043106359 8:76117076-76117098 AAGTTGCTCTGGATGAGTCAGGG + Intergenic
1043195380 8:77286831-77286853 CAGCTGCAGTGGGGGAGGCATGG + Intergenic
1044775111 8:95678881-95678903 CAGTTGCAGTGGGGGAGGCACGG - Intergenic
1046115582 8:109779643-109779665 CAGATGCACTGGAGGAGGCAGGG - Intergenic
1046557362 8:115791122-115791144 AAGATGCTATGGGGGAGTCAGGG - Intronic
1047136641 8:122086443-122086465 AACTTGCTCTAGGTGAGTCAGGG - Intergenic
1047867295 8:129040472-129040494 CATTTGCTCTGGAGGAGTCCAGG - Intergenic
1048789647 8:138088128-138088150 AAGTTGGTCTGGGTGAGTCAGGG + Intergenic
1048799207 8:138180866-138180888 CACTGGCTCTGGGGCAGGCAGGG + Intronic
1049978447 9:882237-882259 AAGTTTCTCTGGGGGTGTGAAGG + Intronic
1051302240 9:15664330-15664352 CACTTGAGCTGGGGAAGTCAAGG - Intronic
1051709660 9:19918798-19918820 CAGTTCCTCTGAGGCAGACAAGG - Intergenic
1051924417 9:22306215-22306237 AAATTGGACTGGGGGAGTCAGGG + Intergenic
1052669373 9:31535870-31535892 CAGTTGCAAAGTGGGAGTCATGG - Intergenic
1054859684 9:69936665-69936687 AAGTTGCTCTGGATGAGTCATGG + Intergenic
1056424625 9:86464589-86464611 GAGATGCTCTCTGGGAGTCAGGG + Intergenic
1056644747 9:88400927-88400949 CAGTTGAGCTGGGGAAGTCGAGG + Intronic
1057440155 9:95077232-95077254 CTGTGGCTCTGGGGGAGCCTGGG + Intronic
1057752212 9:97802310-97802332 CTCTTACTCTGGGGGAGTCGGGG + Intergenic
1060784492 9:126439338-126439360 GAGTTGCTCTGTGGGAGTCTGGG + Intronic
1060801742 9:126549458-126549480 CAGCTGCTCTGGGGGAGGTGTGG + Intergenic
1061007642 9:127937372-127937394 TAGTTGCTCTGGCGGTGCCAGGG + Intronic
1061876629 9:133547297-133547319 CAGTGGCCCTGGGGGCGTCACGG - Intronic
1062442434 9:136576769-136576791 CAGTTACTCAAGGGGAGTGAGGG - Intergenic
1185464284 X:345891-345913 GGGCAGCTCTGGGGGAGTCAGGG + Intronic
1187726730 X:22211023-22211045 CAGTTGCTCTGGAGCAGTGAAGG + Intronic
1188351219 X:29133300-29133322 CAGTTTCCCTGGGGGAAACAAGG + Intronic
1188855986 X:35196446-35196468 AAGTTGCTCTGGGTGAGTCAAGG - Intergenic
1189135730 X:38547366-38547388 CACTGGCTCTGGGGGAAGCAAGG + Intronic
1190340620 X:49292639-49292661 CTGGTGGTCTGGGGGAGACACGG + Intronic
1191016596 X:55815601-55815623 CAGATCCTCTAAGGGAGTCATGG - Intergenic
1194891592 X:99385239-99385261 CAGCTGCAGTGGGGGAGGCATGG - Intergenic
1196495804 X:116324110-116324132 CAGTTGGTCTGGGGGAGAACAGG - Intergenic
1196594046 X:117522531-117522553 CAGGTGAGCTGGGGGAGACAGGG - Intergenic
1196607699 X:117674610-117674632 CAGATGCACTGTGGGATTCATGG - Intergenic
1197114551 X:122817611-122817633 CAGTTCCTCTGGGGTTGGCACGG - Intergenic
1198119414 X:133577557-133577579 GAGGTGCTCTGGGGGAGTCTGGG + Intronic
1198927394 X:141814475-141814497 GAGGTGCTGTGTGGGAGTCAGGG + Intergenic
1199364902 X:146970141-146970163 CAGCTACTCTGGGGTAGTCTAGG + Intergenic
1200037019 X:153338040-153338062 CAGTGGATCTTGGGGAATCAAGG - Intronic
1200047010 X:153408574-153408596 CAGTGGCTCTGGGGAAAGCAGGG - Intergenic
1201789014 Y:17817306-17817328 GAGTTGCTCAGTGGGAGTCAGGG - Intergenic
1201812539 Y:18088681-18088703 GAGTTGCTCAGTGGGAGTCAGGG + Intergenic
1202164401 Y:21971004-21971026 CATTTGCTCAGTGGGAGTCAGGG - Intergenic
1202226955 Y:22615368-22615390 CATTTGCTCAGTGGGAGTCAGGG + Intergenic
1202316167 Y:23580286-23580308 CATTTGCTCAGTGGGAGTCAGGG - Intergenic
1202350616 Y:23986383-23986405 GAGTTGCTCAGTGGCAGTCAGGG - Intergenic
1202520163 Y:25683738-25683760 GAGTTGCTCAGTGGCAGTCAGGG + Intergenic
1202554597 Y:26089780-26089802 CATTTGCTCAGTGGGAGTCAGGG + Intergenic