ID: 1108324137

View in Genome Browser
Species Human (GRCh38)
Location 13:49313616-49313638
Sequence AACCACGATCTGATACTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108324133_1108324137 9 Left 1108324133 13:49313584-49313606 CCACAGAGATTCTTATGTGAACT 0: 1
1: 0
2: 2
3: 20
4: 209
Right 1108324137 13:49313616-49313638 AACCACGATCTGATACTGACTGG 0: 1
1: 0
2: 0
3: 0
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108324137 Original CRISPR AACCACGATCTGATACTGAC TGG Intronic
901614404 1:10526864-10526886 AATCAAGATCTGCTACTAACGGG - Intronic
902837398 1:19055651-19055673 CACCAGGATCTGATACTTAAAGG + Intergenic
911522845 1:98948847-98948869 AACAACAATCTGTTACTGTCAGG - Intronic
919501047 1:198338645-198338667 AACCACCATCTGTTACTGTTAGG - Intergenic
1065499110 10:26361600-26361622 AAACCAGAGCTGATACTGACAGG - Intergenic
1076815562 10:132913115-132913137 AACCACCACCTGATCCTGGCCGG - Exonic
1098446965 12:70575967-70575989 AACCAGGATCTGAAACACACTGG + Intronic
1108324137 13:49313616-49313638 AACCACGATCTGATACTGACTGG + Intronic
1109624846 13:64961761-64961783 AACCCTGACCTGATACTTACTGG + Intergenic
1133442432 16:5832039-5832061 AATCATGGTCTGATGCTGACTGG - Intergenic
1135089866 16:19504994-19505016 AACCACGCTATGATACTTTCTGG - Exonic
1139502664 16:67380619-67380641 CAGCACTATCTGATACTCACAGG + Intronic
1140708649 16:77655829-77655851 AACCACCTTGAGATACTGACAGG + Intergenic
1167806761 19:51792247-51792269 AACAACTAACTGAGACTGACAGG - Intronic
1168310379 19:55456938-55456960 AACCGGGATCTGATAGTAACCGG - Intronic
937487517 2:122330924-122330946 AACAAAAATCTGAAACTGACAGG + Intergenic
943628114 2:190221517-190221539 AACCTGGCTCTGATACTGATAGG + Intronic
945745688 2:213718292-213718314 AACCACAATGAGATACTGAGAGG + Intronic
1170316469 20:15046629-15046651 ATCCAAGATTTGAAACTGACTGG - Intronic
1173891953 20:46519589-46519611 AAACAGGATCTGATCCAGACAGG + Intergenic
1179896388 21:44365889-44365911 ACCCACGTTCTGATGGTGACAGG + Intronic
1182597004 22:31429515-31429537 AACCAAGAGCTCATACTGATAGG - Intronic
954673514 3:52303343-52303365 AGCCACCATCTGATACCCACTGG + Intergenic
970238517 4:13983351-13983373 AACCAGGATCTGATTCTACCTGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
982058857 4:151582503-151582525 AACCAGAATCTGCCACTGACAGG - Intronic
982371870 4:154642508-154642530 AAACAGGATCTGATCCAGACAGG + Intronic
1005357673 6:24999950-24999972 CACCACCACCTGATACTGATGGG - Intronic
1005651683 6:27890857-27890879 AACGATGATCTGATCCTGATTGG + Intronic
1007221931 6:40285628-40285650 AACCTCAATCTGATCCTGCCAGG - Intergenic
1009370465 6:62894237-62894259 AACAACGATCTTTTATTGACTGG + Intergenic
1011972905 6:93250511-93250533 AACAGCTACCTGATACTGACTGG - Intronic
1018623237 6:165751607-165751629 AAACAGGATCTGATCCAGACAGG + Intronic
1021136094 7:16966483-16966505 AACCAAGATATGATTCTGAAGGG + Intergenic
1024696008 7:51857366-51857388 AACCCTGACCTGATCCTGACAGG + Intergenic
1031399548 7:121315364-121315386 AACCACAATGAGATACTGTCAGG + Intergenic
1031736012 7:125362636-125362658 AATCATGATTTAATACTGACAGG - Intergenic
1031748034 7:125530095-125530117 AAGCACCACCTAATACTGACTGG - Intergenic
1044132490 8:88542477-88542499 TACCACAATCTGTTCCTGACAGG + Intergenic
1050871546 9:10577446-10577468 AACCTCCAACTGATATTGACTGG + Intronic
1052026130 9:23575336-23575358 AACCAAGAGCTGAAAGTGACAGG - Intergenic
1052598359 9:30592519-30592541 AACCCTGATCTTATACTAACTGG - Intergenic
1053609103 9:39692922-39692944 ATCCAGGATCTGCTACTCACTGG + Intergenic
1053866947 9:42449192-42449214 ATCCAGGATCTGCTACTCACTGG + Intergenic
1054089213 9:60778567-60778589 ATCCAGGATCTGCTACTCACTGG - Intergenic
1054244422 9:62649476-62649498 ATCCAGGATCTGCTACTCACTGG - Intergenic
1054558549 9:66684019-66684041 ATCCAGGATCTGCTACTCACTGG - Intergenic
1190628364 X:52359695-52359717 AAACAGGATCTGATTCAGACAGG + Intergenic
1192175860 X:68885067-68885089 AGCCCCGAGCTGATACTGCCTGG - Intergenic