ID: 1108325102

View in Genome Browser
Species Human (GRCh38)
Location 13:49322787-49322809
Sequence TCCTATTAGATCCCCTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108325100_1108325102 10 Left 1108325100 13:49322754-49322776 CCCACTGGTAATTCTTGGCAAAC 0: 1
1: 0
2: 1
3: 3
4: 106
Right 1108325102 13:49322787-49322809 TCCTATTAGATCCCCTGAAAAGG 0: 1
1: 0
2: 1
3: 11
4: 95
1108325097_1108325102 25 Left 1108325097 13:49322739-49322761 CCACTTCAGACACAACCCACTGG 0: 1
1: 0
2: 0
3: 17
4: 160
Right 1108325102 13:49322787-49322809 TCCTATTAGATCCCCTGAAAAGG 0: 1
1: 0
2: 1
3: 11
4: 95
1108325101_1108325102 9 Left 1108325101 13:49322755-49322777 CCACTGGTAATTCTTGGCAAACA 0: 1
1: 0
2: 4
3: 8
4: 146
Right 1108325102 13:49322787-49322809 TCCTATTAGATCCCCTGAAAAGG 0: 1
1: 0
2: 1
3: 11
4: 95
1108325096_1108325102 29 Left 1108325096 13:49322735-49322757 CCTTCCACTTCAGACACAACCCA 0: 1
1: 0
2: 2
3: 21
4: 245
Right 1108325102 13:49322787-49322809 TCCTATTAGATCCCCTGAAAAGG 0: 1
1: 0
2: 1
3: 11
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108325102 Original CRISPR TCCTATTAGATCCCCTGAAA AGG Intronic
905649070 1:39644542-39644564 TCCTCTTAGAGCCCCTGGACTGG - Intergenic
905922903 1:41730858-41730880 TCCCATTAGATCCCCTGAATAGG - Intronic
906342595 1:44993838-44993860 ACCTGACAGATCCCCTGAAAGGG + Intergenic
909393667 1:75144534-75144556 TTTTATTATGTCCCCTGAAAAGG + Intronic
909685658 1:78345523-78345545 TCTTATTAGATCCAGAGAAAAGG + Intronic
909827806 1:80147605-80147627 TCATATTAGAACCCCCAAAAAGG - Intergenic
917261619 1:173175562-173175584 TGCTATCAGGCCCCCTGAAAAGG + Intergenic
919551448 1:198994126-198994148 TCCTATTTCATTTCCTGAAAGGG + Intergenic
922738056 1:228000215-228000237 TCCTGGTTGATCCCATGAAATGG - Intergenic
924405339 1:243739098-243739120 TCCTATGAGAGCCTCTGAACTGG + Intronic
924557702 1:245131853-245131875 TCCTATTAGTTCCCCTCACAGGG - Intergenic
1070821214 10:79355727-79355749 TTCTGTTAGATGCCCTCAAAAGG - Intergenic
1070921907 10:80192658-80192680 TCCTTCCAGTTCCCCTGAAAAGG - Intronic
1076049208 10:127319280-127319302 TCCAATTAGTTCCCCTGCTACGG - Intronic
1078743846 11:14092329-14092351 ACCTTCTAGACCCCCTGAAAGGG + Intronic
1079379465 11:19924861-19924883 TCTTATTAGGTCTCCTGAAATGG - Intronic
1091610687 12:2004939-2004961 ACCTTGCAGATCCCCTGAAAGGG - Intronic
1092232944 12:6787391-6787413 ACCTTGAAGATCCCCTGAAAGGG - Intronic
1093069328 12:14692119-14692141 ACCTCATGGATCCCCTGAAAGGG - Intronic
1093411159 12:18868666-18868688 GCCTGTTAGATTCCCTTAAAGGG - Intergenic
1095967954 12:47882233-47882255 TTCTGTCAGCTCCCCTGAAATGG - Intronic
1097693569 12:62756351-62756373 TCCATGTAGACCCCCTGAAAAGG + Intronic
1101681417 12:106970613-106970635 ACCTTGTAGACCCCCTGAAATGG + Intronic
1107286268 13:38796217-38796239 CCCTATGAGATCCTCTGGAACGG + Intronic
1108325102 13:49322787-49322809 TCCTATTAGATCCCCTGAAAAGG + Intronic
1108710191 13:53025760-53025782 TCCTAGTATATTCCCTGAAGTGG + Intergenic
1110931939 13:81230924-81230946 TCCTATTAGAGGAGCTGAAAAGG + Intergenic
1114787585 14:25618880-25618902 TCCTATTTTCTCTCCTGAAAAGG - Intergenic
1116096070 14:40370274-40370296 TCTTAATAGATACTCTGAAAAGG + Intergenic
1121394636 14:93609327-93609349 TCCTATTATTTCACCCGAAATGG - Intronic
1121612577 14:95291707-95291729 TCCTCTAAGATCACCAGAAATGG + Intronic
1129545612 15:76391911-76391933 TCCTATTTGATTCCATCAAAGGG - Intronic
1132003800 15:98207702-98207724 TACTATTAGATCATCTGAATGGG + Intergenic
1138441371 16:57037052-57037074 TCCTTTGAGATCCCCTGGCAAGG + Intronic
1139677587 16:68535430-68535452 TCCTATTAGATACCCTGCTTTGG + Intronic
1141788114 16:86215220-86215242 TCCTGTCTGATCCCCTGAAACGG + Intergenic
1143111959 17:4558010-4558032 TCCTGTTAGAACCCCTGGAAGGG + Exonic
1149744869 17:59086874-59086896 TTCTATTAGAGCCTCTCAAAAGG - Intronic
1152127918 17:78458513-78458535 TGCTCTCAGACCCCCTGAAAGGG - Intronic
1152713063 17:81884465-81884487 TCCTTTTAGATCTCATGAGATGG - Intergenic
1155226579 18:23734597-23734619 TCCAAATAGATTCCCTGGAATGG + Intronic
1157960885 18:52152149-52152171 TCCTATTATAAGCCCGGAAAAGG + Intergenic
1159108905 18:64033473-64033495 GCCTATTAGCTTCCCTGTAAAGG + Intergenic
928893723 2:36237195-36237217 TCCTACTAAACCCTCTGAAATGG + Intergenic
930214161 2:48676346-48676368 ATCTATTAAATCCCCAGAAATGG + Intronic
931264239 2:60646436-60646458 TCCTATGAGATCCCATAAGATGG - Intergenic
937951103 2:127388290-127388312 TCCGAGTAGATCCCGTGAAAAGG + Exonic
945179414 2:207076503-207076525 TCCTAATAGATCCCAGAAAAGGG - Exonic
946053219 2:216880865-216880887 TCCCATTAGATTCCAGGAAATGG + Intergenic
947834062 2:233162843-233162865 TCTTATTAGAAACACTGAAAGGG - Intronic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1179564696 21:42239976-42239998 TCAAATTAGAGCCCCAGAAAGGG + Intronic
1182695258 22:32194295-32194317 TCCTCTTAGATGCCTAGAAATGG - Intronic
949091316 3:32921-32943 TCCTATGAGAGCCCCTGAAGGGG + Intergenic
951446974 3:22793928-22793950 TTCTGTTAGATTCCATGAAAAGG - Intergenic
956027435 3:64998376-64998398 ACCTATTGCATCCCTTGAAATGG + Intergenic
957031634 3:75249146-75249168 TCCTATGAGAGCCCCTGAAGGGG + Intergenic
957635904 3:82784542-82784564 TCCTGTTAAAGCACCTGAAATGG + Intergenic
958266012 3:91437938-91437960 TCCTGGGAGTTCCCCTGAAAAGG + Intergenic
961531867 3:127544916-127544938 TCTAATTGGATCCCCTGGAAAGG + Intergenic
962400004 3:135050181-135050203 TCCTAGAAGATCCCCTCAATCGG - Intronic
965066917 3:163861275-163861297 TCCTGGTAAATCCCCTGTAAAGG + Intergenic
968481811 4:836575-836597 TCCTAGTAGAAGCCCTGAAGGGG - Intergenic
970138387 4:12951603-12951625 GCCTTATAGATCTCCTGAAAGGG - Intergenic
970389691 4:15595132-15595154 TCTTATTAGATACTCTGTAAGGG + Intronic
970521714 4:16891007-16891029 TCCTAATTGATTACCTGAAAAGG + Intronic
971256008 4:25014010-25014032 TCTTTTTATATCCCCAGAAAAGG - Intronic
975653245 4:76615331-76615353 TCCCATCTGATCCCCTGGAAAGG - Intronic
975898035 4:79118180-79118202 TCTAATTAGGTACCCTGAAAGGG - Intergenic
980869975 4:138600089-138600111 TCCTATTAGTAACCCTGCAATGG + Intergenic
981049142 4:140293749-140293771 TCCCAGCAGATCCCCTTAAAAGG + Intronic
983238907 4:165208989-165209011 TCCCATTAGCTCTCCTAAAAGGG - Intronic
989119429 5:37989830-37989852 TCCTGATTGATCACCTGAAATGG + Intergenic
993128806 5:83870250-83870272 ACCTCTTAGATTCACTGAAATGG + Intergenic
993302788 5:86232895-86232917 ACCTAACAGATCCCTTGAAAAGG + Intergenic
994374710 5:99006027-99006049 GCCTTATAGATCCCCTGAAAGGG - Intergenic
994657095 5:102607519-102607541 GCCTCTTAGATCCCCTGTTAGGG + Intergenic
1003569597 6:7247278-7247300 TCCTAGGAGCTCCCCTGAAGCGG + Intronic
1006051136 6:31345349-31345371 TCCTAATAGATCCACTGACAGGG - Intronic
1007244993 6:40454872-40454894 TCCTATTTGTATCCCTGAAAAGG + Intronic
1008989344 6:57584692-57584714 TCCTGGGAGTTCCCCTGAAAAGG - Intronic
1009177933 6:60483249-60483271 TCCTGGGAGTTCCCCTGAAAAGG - Intergenic
1012184889 6:96200478-96200500 TCCTTCTAGAACCCCTAAAAAGG - Intronic
1012802288 6:103846606-103846628 CCCTATGAGATCCCCCAAAAAGG + Intergenic
1016705910 6:147107497-147107519 TCCTAACACATCTCCTGAAAGGG + Intergenic
1021467939 7:20967237-20967259 TACTTGTAGATCCCTTGAAATGG - Intergenic
1023318903 7:38972589-38972611 TCCTTCCAGACCCCCTGAAAGGG + Intergenic
1024702912 7:51924172-51924194 TCTTCTTATATACCCTGAAATGG - Intergenic
1024833024 7:53483936-53483958 TACTATCAGTGCCCCTGAAAAGG - Intergenic
1030131230 7:106202534-106202556 TCTCATTAGATCCCAGGAAAAGG - Intergenic
1032150219 7:129422665-129422687 TCAGATTAAATTCCCTGAAATGG + Intronic
1032270948 7:130404881-130404903 ACCTTGCAGATCCCCTGAAAGGG - Intronic
1033110761 7:138573026-138573048 ACCTAGTGGATCCTCTGAAAGGG - Intronic
1038038923 8:23707607-23707629 TCGCATTAGATCTCCAGAAAAGG + Intergenic
1041640223 8:60191533-60191555 GCATATTAGAGCCTCTGAAATGG - Intronic
1045673890 8:104588321-104588343 TCCTACTCGATTCCCTGAAAAGG - Intronic
1048158928 8:131993410-131993432 TCCTGTCACATCCCCAGAAAGGG + Intronic
1055493937 9:76835779-76835801 TCCTATTTGACCTCCTTAAAAGG + Intronic
1057136996 9:92698521-92698543 CCATATTAGATCCCCAGCAATGG - Intergenic
1057814908 9:98287193-98287215 TCCGACTAGATCCCCTTCAATGG - Intergenic
1059772960 9:117444950-117444972 TCCTTTGAGATCCTCTTAAATGG + Intergenic
1060719164 9:125963282-125963304 TCCTCATAGATGCCCAGAAATGG + Intronic
1186642453 X:11470538-11470560 TAGTATTAGCTACCCTGAAATGG - Intronic
1186771349 X:12820950-12820972 TCATATTAGATCCCTGAAAAAGG + Intronic
1194898204 X:99471134-99471156 TGCTATTACATCACATGAAAAGG + Intergenic
1196696941 X:118623380-118623402 TCCTAATAGAACCCATGAAACGG + Intronic
1197406375 X:126057023-126057045 TCCTATTATACACTCTGAAAAGG - Intergenic
1199819432 X:151430250-151430272 TCCTAATGGATCAGCTGAAACGG + Intergenic