ID: 1108329422

View in Genome Browser
Species Human (GRCh38)
Location 13:49370402-49370424
Sequence GTGAAAAATACGACCACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108329422 Original CRISPR GTGAAAAATACGACCACTGA TGG Intronic
906472532 1:46143141-46143163 GAGAAAAATACTACCAATGAAGG - Intronic
910843181 1:91580827-91580849 TTTAAAAATACAACCACTGTAGG + Intergenic
915859087 1:159422812-159422834 GTGAAAATGAGGACCACTGGGGG + Intergenic
917262776 1:173187943-173187965 CTGAAAAAGAGGACCACTTATGG + Intronic
917382482 1:174429233-174429255 GTGAAGAAGACGACTAGTGATGG - Intronic
918559457 1:185847089-185847111 GTGAAAAATAAGAAATCTGATGG - Intronic
919527833 1:198677048-198677070 TTGAAAATTACTACCATTGATGG + Intronic
923887706 1:238177374-238177396 GTAAAGAATTAGACCACTGAGGG - Intergenic
924367150 1:243307021-243307043 CTGAAAAATGAGACTACTGAAGG - Intronic
1067052055 10:43027301-43027323 GGGAAAAATAAGAGCTCTGAAGG - Intergenic
1069027588 10:63560495-63560517 ATGAAAAATAAAACCACTTATGG - Intronic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1074069660 10:110053641-110053663 GTGAAAATTAAGACTACTGATGG - Intronic
1074839526 10:117335482-117335504 GGCAAAAATAACACCACTGATGG + Intronic
1078680292 11:13469446-13469468 GTGAAGAACCAGACCACTGAGGG - Intergenic
1080728663 11:34923837-34923859 GTGAATAGTATGAGCACTGAAGG + Intronic
1086596091 11:88572757-88572779 ATAAAAAATACAACCATTGATGG - Intronic
1092035419 12:5330270-5330292 GTGAAAAAGACCACAGCTGAAGG - Intergenic
1096313021 12:50538236-50538258 GTGAAAAATTCCACCTCAGAGGG + Intronic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1099619405 12:84982230-84982252 GATAAAAATATCACCACTGATGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1117291289 14:54336192-54336214 TTGCAAAATGCTACCACTGAGGG + Intergenic
1120470269 14:84914634-84914656 GTGAAAATTAAGATCACTAAGGG - Intergenic
1122335227 14:100971130-100971152 GTGAAAATTGAGACCAATGATGG + Intergenic
1126176308 15:45739013-45739035 GTGAAAAATACGGCAAATTATGG + Intergenic
1126310364 15:47309157-47309179 GTGAAAAGCAAAACCACTGATGG - Intronic
1128912351 15:71527414-71527436 GTGAAAAATGTGACAACAGAAGG + Intronic
1129128872 15:73472322-73472344 GGGAGAATTACAACCACTGAAGG + Intronic
1129550443 15:76443031-76443053 GTAAAAAACACCACCACTGAGGG + Intronic
1140198205 16:72873138-72873160 GTGAAAAATACGCCCATTGAAGG - Intronic
1144141077 17:12348605-12348627 GTGAAATATACGACCTATTATGG + Intergenic
1147033790 17:37664193-37664215 GTGAAAAATATAAAGACTGATGG - Intergenic
1148082314 17:44974180-44974202 GTGAAGAATATGGCCACTGGAGG + Intergenic
1154038162 18:10826962-10826984 GTGAAAAATCCAACCTTTGAAGG - Intronic
1155605427 18:27600357-27600379 GTGAAAAATTCCACAGCTGATGG - Intergenic
1157666639 18:49492921-49492943 GTGAAAAATGCGCTAACTGAAGG + Intergenic
1168303910 19:55423678-55423700 GTGACAAAGGCGAACACTGAAGG + Intergenic
929298160 2:40271498-40271520 GTGAAAAATAGGTTCAGTGAGGG - Intronic
930541067 2:52707261-52707283 GTGAAATATACAAAGACTGAAGG - Intergenic
934934460 2:98454605-98454627 GTGAAAAATAAGAGTACTGTGGG - Intronic
941089602 2:161159869-161159891 GTGAAAAATACTACCAGTTGGGG + Intronic
942782443 2:179661117-179661139 GTTAAAAATAGGAAAACTGAGGG + Intronic
943502862 2:188713460-188713482 TAGAAAAAAACAACCACTGATGG + Intergenic
1170733440 20:18993399-18993421 ATGAGAAAGACGAGCACTGAGGG - Intergenic
1170771229 20:19334499-19334521 GTGAAAAAGATGATCACTTATGG - Intronic
1174592712 20:51658868-51658890 ATGAAAATTAAGACCACTGGCGG + Intronic
1176334690 21:5585034-5585056 CTGCAAAAGAGGACCACTGAAGG - Intergenic
1176393067 21:6235914-6235936 CTGCAAAAGAGGACCACTGAAGG + Intergenic
1176468352 21:7080260-7080282 CTGCAAAAGAGGACCACTGAAGG - Intronic
1176491913 21:7462038-7462060 CTGCAAAAGAGGACCACTGAAGG - Intergenic
1176508729 21:7676345-7676367 CTGCAAAAGAGGACCACTGAAGG + Intergenic
1176970283 21:15257072-15257094 TTAAAAAAAAAGACCACTGAAGG + Intergenic
1177094473 21:16815483-16815505 GTGTAAAATGAAACCACTGAAGG - Intergenic
1178489436 21:33039591-33039613 AGGATAAATACAACCACTGAGGG - Intergenic
1184265933 22:43346044-43346066 GTGAAAAATAGGACAGCTGTGGG - Intergenic
949852616 3:8434157-8434179 GAGAAAAATAAGAAAACTGAGGG + Intergenic
952387967 3:32856530-32856552 GTTAAAAATAGGACCTCTGTTGG + Intronic
954343167 3:49972283-49972305 GTGCAAAATATTAACACTGAGGG - Intronic
955713966 3:61809324-61809346 GAGAAAAATGTGATCACTGATGG + Intronic
957020140 3:75117705-75117727 GTTAAAACTACTACCTCTGAAGG - Intergenic
958806337 3:98815349-98815371 GAGAAAAATAAGAAAACTGAAGG + Intronic
960008767 3:112810493-112810515 GAGAAATATATGACCACTAAAGG - Intronic
964685280 3:159388618-159388640 GTGAAAAAGAGGAACATTGAGGG + Intronic
964711742 3:159678211-159678233 GTGAAAAATAGGACAATTTATGG - Intronic
965038721 3:163478558-163478580 GTGATACATAGGCCCACTGAAGG + Intergenic
969547977 4:7844434-7844456 GTGACAAATGCCACCACTGGGGG - Intronic
969564087 4:7967453-7967475 GTAACAAATATGACCACTGAAGG - Intronic
981125028 4:141095799-141095821 GAGAAAAATATAATCACTGAGGG + Intronic
987581419 5:19798289-19798311 GTGAAAAATATTGCCAATGAGGG + Intronic
993629851 5:90272662-90272684 TTTAAAAATACCACTACTGAAGG + Intergenic
997429604 5:133828365-133828387 GTGAAAAATCCTGTCACTGAGGG - Intergenic
999507526 5:152213615-152213637 GGGAGAAATAGGACGACTGAGGG + Intergenic
1001693339 5:173649274-173649296 GTGCAAAATAGGACCACATATGG + Intergenic
1002386765 5:178873906-178873928 ATGAAAACTACAAACACTGATGG - Intronic
1004643129 6:17534815-17534837 TTGAAAAACACGACCCCTCAGGG - Intronic
1010259890 6:73803709-73803731 GTGTAAAAAACAAACACTGATGG + Intronic
1013856092 6:114574107-114574129 GTGGTAAATACAACCACTGGGGG - Intergenic
1017161574 6:151370555-151370577 ATCAAAAATAAAACCACTGAGGG - Intronic
1019560189 7:1651930-1651952 GGGAAAAGTCCGACCCCTGATGG - Intergenic
1021196285 7:17678125-17678147 GGGAAAAATAAAACAACTGAAGG + Intergenic
1021207664 7:17805132-17805154 TTGAAAAACATGACCACTGGTGG + Intronic
1031324542 7:120377322-120377344 GTGAAAAATACATCCAGAGAAGG + Intronic
1031955923 7:127942238-127942260 GTCAAAAATAAGACCCTTGAAGG - Intronic
1032140069 7:129320769-129320791 GAGGAAAATACCACCACTAATGG - Intronic
1033786807 7:144741592-144741614 GTTAAAAATATAACAACTGAAGG - Intronic
1035244110 7:157551323-157551345 GTGAAAAATACCACAACTGTAGG + Intronic
1035942078 8:3912689-3912711 ATGCAGAATACGACAACTGATGG + Intronic
1037515462 8:19626960-19626982 GTGAAATGTACAACCACTAACGG + Intronic
1038586383 8:28792988-28793010 GGGAAAAAAACGACCACAGAAGG + Intronic
1043023650 8:75038765-75038787 GTGAAAGATAAGACAATTGATGG - Intergenic
1045014979 8:97993362-97993384 TTGAAATAAATGACCACTGATGG - Intronic
1046923243 8:119757236-119757258 GTGTAAAATAAGACTACGGAAGG + Intronic
1050912863 9:11095978-11096000 GTGAAAAATATGCATACTGAGGG - Intergenic
1058162955 9:101590179-101590201 ATGAAAAATTCTAACACTGAAGG - Intronic
1060790061 9:126480000-126480022 AGAAAAAATATGACCACTGAAGG + Intronic
1187095275 X:16141458-16141480 GTGAAAAATGGCACCAGTGAAGG - Intronic
1187300219 X:18041648-18041670 GTGAAAAATCCTATCACTCACGG + Intergenic
1188812432 X:34667358-34667380 GTAAAAAATAAGAAGACTGAAGG - Intergenic
1188987523 X:36780772-36780794 GTGCAGAATACAACCAGTGAAGG - Intergenic
1189506865 X:41619900-41619922 ATGAAAAATACGTGAACTGATGG - Intronic
1194521820 X:94928801-94928823 GTGAAAAATGCAATCACTGTAGG + Intergenic