ID: 1108332369

View in Genome Browser
Species Human (GRCh38)
Location 13:49401729-49401751
Sequence TGTCAACTGATTAAACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108332369 Original CRISPR TGTCAACTGATTAAACTGGC TGG Intronic
902873758 1:19328958-19328980 AGACAACTGAATAAACAGGCCGG + Exonic
903012543 1:20341840-20341862 AGGAAACTGATTAAACTGCCTGG + Intronic
904099521 1:28012381-28012403 TGTCCACTTATTAGACTGGTAGG + Intronic
904109208 1:28112241-28112263 AGGCAACTGAATAAACAGGCAGG + Intergenic
906951143 1:50335203-50335225 AGCCATCTGATTAAACTGGCTGG - Intergenic
913304716 1:117415819-117415841 TGTCAACTGGATAAAATGTCTGG - Intronic
913698021 1:121346752-121346774 TGTGAGCTGATTAAACTGGCAGG + Intronic
914139529 1:144933300-144933322 TGTGAGCTGATTAAACTGGCAGG - Intronic
915007740 1:152655706-152655728 TGGCAACTGAGTCAGCTGGCTGG + Intergenic
916968751 1:169984815-169984837 TTTCAACACATAAAACTGGCAGG + Intronic
917069897 1:171139087-171139109 CGACAACTGATTACAATGGCTGG - Intronic
917641440 1:176986837-176986859 TGTTAACTGCTTATAGTGGCAGG + Intronic
920485417 1:206365402-206365424 TGTGAGCTGCTTAAACTGGCAGG + Intronic
923942043 1:238838494-238838516 TTTCAACTTATTAATCTGGTGGG + Intergenic
1066370956 10:34817619-34817641 TTTCAGCTGATAAAACGGGCTGG - Intergenic
1068636027 10:59349315-59349337 TGTCAATTGTTTAAAGTGTCTGG - Intronic
1070469747 10:76766858-76766880 AATCAGCTGTTTAAACTGGCAGG - Intergenic
1071357703 10:84814479-84814501 TTTCAACAGATTAAACAGACAGG - Intergenic
1071369741 10:84939266-84939288 AGTTAACTGATAAAACTGGAGGG - Intergenic
1078252187 11:9625333-9625355 TGTGAGGTGATTAAAATGGCAGG - Intergenic
1079319180 11:19437186-19437208 TATCAACTCATTTAACTGGAAGG + Intronic
1081365576 11:42231039-42231061 TGGCAATTCATTAAAGTGGCTGG + Intergenic
1083067882 11:59944384-59944406 TGTTAACTGAATAATCTGGGTGG + Intergenic
1083514992 11:63248916-63248938 TATCAACAGAGTAAACAGGCTGG + Intronic
1084131449 11:67138979-67139001 TGTCAGCAAATTCAACTGGCAGG - Intronic
1084595437 11:70114014-70114036 TGTCAACAGTTTAAATTGACTGG + Intronic
1087000224 11:93410927-93410949 TTTCAACAAATGAAACTGGCAGG - Intronic
1088154027 11:106782565-106782587 TGTCAGCTGATTGGGCTGGCAGG - Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1092692525 12:11129838-11129860 TATCAATACATTAAACTGGCAGG - Intronic
1098524905 12:71476096-71476118 TGTCCACCTATTAATCTGGCTGG - Intronic
1099080583 12:78175052-78175074 TGAGAACTCATTAAACTGCCAGG + Intronic
1102504727 12:113376653-113376675 TGTCAAATGTGAAAACTGGCTGG + Intronic
1104184614 12:126418282-126418304 AGTCATCTGATTTAACTGGTTGG - Intergenic
1108332369 13:49401729-49401751 TGTCAACTGATTAAACTGGCTGG + Intronic
1108542712 13:51458963-51458985 TATTAACTGATTACATTGGCTGG - Intergenic
1112109507 13:96280077-96280099 TGGCAACATATTACACTGGCAGG + Intronic
1112770182 13:102786817-102786839 TGTAAAATGAATAAACTGGGGGG - Intronic
1113610117 13:111638573-111638595 TGTCTCATAATTAAACTGGCAGG + Intronic
1115708275 14:36020933-36020955 TTTCATCTGAGTAAACTAGCAGG + Intergenic
1116619307 14:47178253-47178275 TGGCAACTCATTAAACTCCCAGG + Intronic
1118664958 14:68058348-68058370 ACTCTACTGATTAAACTGGAAGG - Intronic
1126890224 15:53197172-53197194 TGTTTCCTGATTAAAATGGCTGG - Intergenic
1127883394 15:63177957-63177979 TGTCAAGTAATTAAACTAACTGG - Intergenic
1129533264 15:76287620-76287642 TGCAAACTGAATAAACAGGCAGG + Intronic
1132296463 15:100738416-100738438 TGTCCTCTGATAAAACTAGCTGG - Intergenic
1134456642 16:14400085-14400107 TTTCAAATGATTTCACTGGCAGG - Intergenic
1136635360 16:31518135-31518157 TGTCAACAGATTACAGTGCCAGG + Intergenic
1137917103 16:52443943-52443965 TGTCCTCTGTTTAAACTGGGAGG - Intronic
1143265841 17:5636826-5636848 TGTCAGGTGAGTAAACTTGCAGG - Intergenic
1143356573 17:6333625-6333647 TGACAACTGTTGAAACTGGATGG + Intergenic
1146564441 17:33900223-33900245 TCTCTCCAGATTAAACTGGCTGG - Intronic
1147436033 17:40416268-40416290 TATCAACTGATTGAAATGACAGG + Intronic
1153244079 18:3056540-3056562 TGTCAAAAGATGAAGCTGGCCGG - Intergenic
1155110902 18:22713329-22713351 TGCCAACTGATTAAACCTCCAGG + Intergenic
1158559345 18:58500470-58500492 TGGCAAATCATTAAACTGACAGG - Intronic
1160335781 18:78037857-78037879 TTTCTGCTGTTTAAACTGGCTGG + Intergenic
1161886130 19:6997236-6997258 TGTCAACTTTTTCAACCGGCTGG - Intergenic
933466096 2:82654245-82654267 TGTCAACATATTTAAGTGGCTGG - Intergenic
939069931 2:137526718-137526740 TAAAAACTAATTAAACTGGCTGG - Intronic
941867793 2:170352566-170352588 TGGTAAATGTTTAAACTGGCTGG + Intronic
1170668017 20:18403602-18403624 TCTGATCTGAGTAAACTGGCTGG - Intronic
1175344453 20:58262388-58262410 TGTTAAATGATTATACAGGCAGG - Intergenic
1178186744 21:30230743-30230765 TGTTAACTGATTAATCTCACAGG + Intergenic
1178206043 21:30467476-30467498 AGTCACCTGATTATAATGGCTGG - Intergenic
1178243716 21:30932118-30932140 TGTCAACTTAGTAAACTTGCAGG + Intergenic
950813473 3:15673071-15673093 TGTTAAGAGATAAAACTGGCCGG - Intronic
951659246 3:25044312-25044334 TGTCAACTTTTTAAAATGACAGG + Intergenic
952589777 3:34937137-34937159 TTTCACCTGCTAAAACTGGCAGG + Intergenic
953201608 3:40782858-40782880 TTTAAAATGATGAAACTGGCAGG - Intergenic
953774826 3:45807647-45807669 TGTCAACTGAGTAACCTGAGTGG + Intergenic
957516620 3:81262559-81262581 TATCCACTGATTAAACTGAAAGG + Intergenic
962830586 3:139135790-139135812 GGTCAAATGATGCAACTGGCAGG - Intronic
976393359 4:84529003-84529025 TGTCAACTATTTTAAATGGCTGG + Intergenic
976836809 4:89383881-89383903 TGTTAACTGCTTCAAGTGGCAGG - Intergenic
979409772 4:120362462-120362484 CTTCAACTTTTTAAACTGGCAGG - Intergenic
979499671 4:121425383-121425405 TGGCAGGTGATAAAACTGGCAGG - Intergenic
982822038 4:159953396-159953418 TTTCAACTGATGCAACTGACTGG + Intergenic
991905441 5:71505301-71505323 TGTTAAGTGATAAAGCTGGCTGG - Intronic
992725517 5:79603330-79603352 TGCCCACTGAGTAAACTGGAGGG - Intergenic
995099105 5:108277361-108277383 TATCAACTTATTAAACTTTCTGG + Intronic
995806152 5:116054533-116054555 TATAAACTAAGTAAACTGGCTGG + Intronic
997107677 5:131039644-131039666 TGTCACCTGATTAATTTGCCTGG - Intergenic
1000678613 5:164155244-164155266 TGTCACCTTTTTAGACTGGCAGG - Intergenic
1002963468 6:1939445-1939467 TATCTACTGATTAAAGAGGCTGG + Intronic
1008459977 6:51757442-51757464 AGTGAACTGATTCATCTGGCTGG - Intronic
1012364930 6:98427274-98427296 TCTAAACTAATTAAACTGGAGGG - Intergenic
1020463945 7:8455314-8455336 TGACAACTGATTAAAGTCTCAGG - Intronic
1020599706 7:10257300-10257322 TTTCAACTGATAAAACTTGAAGG + Intergenic
1021365086 7:19768814-19768836 TTTCATCTGATTAATCAGGCAGG - Intronic
1026389081 7:69881505-69881527 TTTCAACTGCTTTAACTTGCTGG - Intronic
1029013466 7:97288064-97288086 TTTCAACATATTAATCTGGCAGG - Intergenic
1033355130 7:140593197-140593219 TGTTTACTTATTAAACTTGCAGG - Intronic
1034090493 7:148359662-148359684 TTTCAACTTATTAAACTTTCAGG + Intronic
1034589379 7:152127087-152127109 TTTGAACTGATGAAACTGCCAGG + Intergenic
1042435352 8:68757938-68757960 TGTAAAGTGCTTAAAATGGCAGG + Intronic
1044444807 8:92263372-92263394 TGTCTACTGATTATATTGGGTGG - Intergenic
1046625436 8:116572122-116572144 AGCCAAATGATTGAACTGGCAGG - Intergenic
1048207381 8:132426207-132426229 TGACATCTGGTGAAACTGGCAGG + Intronic
1049860506 8:144895034-144895056 AGTCAACACTTTAAACTGGCAGG + Intronic
1050019006 9:1264477-1264499 TTTCAACAGTTTAAAGTGGCTGG + Intergenic
1050232893 9:3547436-3547458 TATAAACTGAGCAAACTGGCTGG + Intergenic
1050449546 9:5765737-5765759 TGTAAACTGAATTTACTGGCAGG - Exonic
1056477837 9:86970072-86970094 TTTCAACTGATTCATTTGGCAGG + Intergenic
1061650434 9:132043961-132043983 AGTCAACTGTGTCAACTGGCAGG + Intronic
1062061412 9:134497518-134497540 TTTCATCTGAATAAAGTGGCAGG - Intergenic
1185770322 X:2760984-2761006 TGTCCACTGTTTAAACAGCCTGG + Intronic
1190383419 X:49861583-49861605 TGTGAACAGATGAAAGTGGCAGG - Intergenic
1191680351 X:63833911-63833933 TGCAAACTGGTTAAACTGGGTGG - Intergenic
1192414106 X:70962809-70962831 TGTCAACTGATGAAACAGAATGG + Intergenic
1192877193 X:75243594-75243616 TCTTAAATAATTAAACTGGCTGG + Intergenic
1195993091 X:110702663-110702685 TGTCAAATGATGGAACTGGGAGG + Intronic
1202347056 Y:23942622-23942644 TTTTAAATGATTAACCTGGCTGG + Intergenic
1202523715 Y:25727468-25727490 TTTTAAATGATTAACCTGGCTGG - Intergenic