ID: 1108333966

View in Genome Browser
Species Human (GRCh38)
Location 13:49419795-49419817
Sequence CTCTTTGTTCAGATTTGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108333966 Original CRISPR CTCTTTGTTCAGATTTGGCG GGG (reversed) Intronic
900586655 1:3435868-3435890 CTCGTTGTGCAGATCTGGCGTGG - Exonic
901329006 1:8390168-8390190 CTCTGGGTTCAGATGTGGCGTGG - Intronic
903521574 1:23954767-23954789 CTCTCCGTTCAGCTTTGGCCTGG + Intergenic
910778521 1:90900920-90900942 CTCTTAGTTCAGATGTGGCAAGG + Intergenic
911497528 1:98650000-98650022 CTCTTTCTTCCCATTTGGCCTGG + Intergenic
920757068 1:208742769-208742791 TTATTTGTTCAGTTTTGGCCTGG - Intergenic
923401324 1:233618001-233618023 CTATTTGTTCAGATTTTTCTTGG + Intronic
1063630560 10:7730010-7730032 CTCCTTGTTCAGTTTGGGCATGG + Exonic
1066203959 10:33169247-33169269 CTCTTTGCTCTGATTGGGAGTGG + Intergenic
1072688149 10:97550993-97551015 CTGTTTGTTAAGATGTGGCTGGG + Intronic
1075113362 10:119605818-119605840 CTTTTTGTACAGATTTGGGGGGG - Intergenic
1075990205 10:126830963-126830985 CTTTTTGTTCAGGTTTGGTTTGG - Intergenic
1079481285 11:20883109-20883131 CTCTTGGAACAGATTTGGCAGGG + Intronic
1079712546 11:23704631-23704653 TTATTTGTTTAGCTTTGGCGTGG + Intergenic
1080670410 11:34371780-34371802 CTCCTTGTTCAGACTTAGCCTGG + Intergenic
1082014513 11:47474718-47474740 CTCTGTGCTCAGATTTGACTGGG - Intronic
1090934045 11:131325907-131325929 CTGTTTGTTCAGATTCTGCTCGG - Intergenic
1091236183 11:134023902-134023924 CTCATTGTACAGACTTGGAGAGG + Intergenic
1092239304 12:6827642-6827664 ATCTCTGTTCAGATTTGTTGAGG + Intronic
1096817678 12:54211588-54211610 CTCTTTCCTGAGATTTGGAGTGG - Intergenic
1099664720 12:85613403-85613425 CTCTTTGTTCAGATTTCTCTTGG + Intergenic
1100049421 12:90428572-90428594 CTGTTTGTTCAGATTTTCCTTGG + Intergenic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1101664997 12:106804743-106804765 CTCTTTTATCAGCTTTGGCGGGG - Intronic
1106920195 13:34555139-34555161 ATCTTTGTTAAGATTTGAGGTGG - Intergenic
1108333966 13:49419795-49419817 CTCTTTGTTCAGATTTGGCGGGG - Intronic
1112134744 13:96564629-96564651 CTCTTTGTTTAGATTTGCCCAGG - Intronic
1113114607 13:106861966-106861988 CTGTTTGTTCAGATTCGTCTGGG + Intergenic
1114868227 14:26624108-26624130 CCCTTTGTGCAGATTTGCCCAGG + Intergenic
1117437246 14:55728152-55728174 CTCTTTGTTAAGGTTTTGCTGGG + Intergenic
1124214476 15:27795268-27795290 GTCATTGTTCAGAGTTGGCCTGG + Intronic
1124225607 15:27891276-27891298 CTCTTTGTATAGTTTTGGAGTGG - Intronic
1125184061 15:36910473-36910495 CTAGTTGTTCAGATTTTGAGGGG + Intronic
1125423899 15:39531007-39531029 CTCTCTGCTGAGATTTGGCATGG - Intergenic
1129501300 15:76040038-76040060 CTCTTTTTTTTTATTTGGCGGGG - Intronic
1133519834 16:6546295-6546317 GTCTTTGTGCAGATTAGGCAAGG - Intronic
1135133075 16:19868644-19868666 GTGTTTGTTGAGATTTGGCAGGG - Intronic
1137602854 16:49768424-49768446 CTCTTCGTTTAGATGTGGCCAGG - Intronic
1140822796 16:78678922-78678944 CACTTTGTTCAGAGTGGGCCTGG + Intronic
1141070119 16:80946596-80946618 CTCTTTGTCCACATTTGTCCTGG + Intergenic
1143314682 17:6023373-6023395 CCCTTTGTTAAGAGTTGGGGTGG + Intronic
1144397124 17:14855188-14855210 CTGATTGTTCGGATTTGGCCAGG - Intergenic
1144829327 17:18122662-18122684 ATCTTTGTTCATATTCGGCTTGG + Intronic
1146086163 17:29831985-29832007 CTCATTTTTCAAATTTGGCAAGG + Intronic
1150318869 17:64193068-64193090 CTCTTTGCTCAGCTTTGGCTGGG - Intronic
1150999631 17:70359754-70359776 CTCCTTGTTCAGTATTGGTGTGG - Intergenic
1155283416 18:24264576-24264598 CTTTTTGTGAAGATTTGGCTTGG - Intronic
1158199478 18:54923992-54924014 CTCTTTATTAAGATTGGGCTAGG - Intronic
1158572878 18:58611807-58611829 TTTTTTTTTCAGATTTGGTGCGG - Exonic
1159981113 18:74781361-74781383 CTCTTTGTACAGATTTCTAGTGG + Intronic
1160090393 18:75821365-75821387 CTCTGTGTTCACATGTGGTGTGG - Intergenic
1160272775 18:77403222-77403244 CTGTTTCTTCAGATTTGGGGTGG - Intergenic
925088489 2:1133592-1133614 CTATTTGGTCAGATTAGGCAAGG - Intronic
926514087 2:13819356-13819378 CTCTTTCTTCAGACTTGTCAGGG + Intergenic
927239153 2:20904881-20904903 CTCTTCTTTCAGATATGGCAAGG - Intergenic
933080803 2:77982722-77982744 CTCTTTGTTTAGGTTTGCCTTGG - Intergenic
933189928 2:79323137-79323159 CTCTGTGATCAGGTTTGGCAGGG - Intronic
933657925 2:84905018-84905040 CTCTTTGCTCAGGTTGGGGGCGG - Intronic
936848594 2:116868762-116868784 CTCTTTGTTCAGAATTGTCTTGG + Intergenic
937946013 2:127337748-127337770 CTCTATGTTCAAATTTGACTCGG + Exonic
939189376 2:138897876-138897898 ATCTTTGTGCAGCCTTGGCGAGG - Intergenic
940146648 2:150552277-150552299 CTCTTTTTACACACTTGGCGTGG + Intergenic
944427842 2:199602360-199602382 GTCTTTGTTCAAAATTGGCTGGG - Intergenic
948873558 2:240815885-240815907 CTCATTGTTCAGGTGTGGAGTGG + Intronic
1172901381 20:38337266-38337288 CTCTTGGTTAAGATCTGGAGAGG - Exonic
1174917315 20:54667147-54667169 CTCTTTGTTCAGATTCTTCTTGG + Intergenic
952032795 3:29164561-29164583 CTCATGGTTCAGATTAGGCAGGG - Intergenic
955118413 3:56030187-56030209 CAGTTTGTTCAAATTTGGTGAGG + Intronic
955126365 3:56116181-56116203 CTTTTTATTCAGATATGGTGAGG - Intronic
955378308 3:58416461-58416483 CTGTTTGTTCAGATTCTGCTTGG + Intronic
956352127 3:68349184-68349206 CTCTTTTTTCAGGTTTTGGGGGG + Intronic
957026208 3:75185199-75185221 CTGGTTGTGCAGATTTGGAGAGG + Intergenic
958889739 3:99770159-99770181 CTGTTTGTTCAGATTCTTCGTGG + Intronic
959783387 3:110264135-110264157 CTCTTTTTTCAGATTTTTCTTGG + Intergenic
961785425 3:129344216-129344238 CTCTTTGCCCAGGTTGGGCGGGG + Intergenic
964048395 3:152359992-152360014 CTCTCTGTTCAGCTTTGCCCAGG + Intronic
965970960 3:174555696-174555718 CTCTTTGTTCAGATTCTTCTTGG + Intronic
970074958 4:12207648-12207670 CTCTGTGTTGAGATATGGCAGGG - Intergenic
977040098 4:92005082-92005104 CTCTTTGTTCAGTTTAGGGAGGG - Intergenic
978172599 4:105691611-105691633 CTCTTTGTTGAGATCTGGTAAGG - Intronic
979535622 4:121817088-121817110 CTGTTTGTTTAGGTTTTGCGAGG - Exonic
982709314 4:158744385-158744407 CTCTCTGTTCAGATTTTTCTTGG + Intergenic
986065981 5:4234560-4234582 TTATTTGTTTAGTTTTGGCGGGG - Intergenic
989658338 5:43769817-43769839 CTCTGTGTTGAAATTTGGCAGGG + Intergenic
990597283 5:57324244-57324266 CTCTTTGTTTAGACTTTGCGTGG + Intergenic
992848133 5:80775261-80775283 CTCTCTGTTCAGAATAGGGGAGG + Intronic
992925357 5:81579255-81579277 TTCTTTGTTTAAATTTGGCTGGG + Intronic
996641472 5:125760431-125760453 CTTTTTGTTCAGAATTGCCTTGG + Intergenic
998442295 5:142172769-142172791 CTGTTTGTTCAGATTTCTCTTGG + Intergenic
999951463 5:156656056-156656078 CTCTTTTTTAACATTTGCCGTGG - Intronic
1002366742 5:178718582-178718604 CTCTGGGTTCAGATTTGGACAGG - Intronic
1005396667 6:25389351-25389373 TTCTTTTTTGAGATTTGGGGGGG + Intronic
1007872298 6:45054031-45054053 CTGTTTGTTCAGATTTTTCTTGG - Intronic
1018005245 6:159616015-159616037 TTCTTTGTTCATATTTTGAGAGG - Intergenic
1020246927 7:6436740-6436762 CTCTTTTTTAAGATTTAGCAGGG + Intronic
1034095110 7:148400448-148400470 CTCTTCGTTGAGGTTTGTCGCGG - Intronic
1034321984 7:150193791-150193813 CTGTTCTTTCAGATTTGGTGAGG + Intergenic
1034770765 7:153773475-153773497 CTGTTCTTTCAGATTTGGTGAGG - Intergenic
1037281835 8:17249980-17250002 CTGTTTGTTCAGATTTTTCTTGG + Intronic
1042668978 8:71239778-71239800 CTCTATGTTCAGCTTTTGTGTGG - Intronic
1043039815 8:75248925-75248947 CTCTTTGAAGAGATTAGGCGTGG + Intergenic
1043173627 8:76997203-76997225 CCTTTTGTTCAGATTTGACATGG - Intronic
1043505634 8:80899046-80899068 CTCTTTGATCATAGTTGGCATGG - Intergenic
1044114842 8:88322847-88322869 CTCTCTGTTCAGAGTTGCCTGGG - Intronic
1048176686 8:132158926-132158948 CTCTGTATTCATATTTGGAGAGG - Intronic
1053152458 9:35751682-35751704 ATCTGTGTACAGACTTGGCGAGG + Exonic
1053419945 9:37970935-37970957 CTGATTGTGCAGATTTGGCCTGG - Intronic
1053502437 9:38610272-38610294 CTCTTTGTTCTGATTTGAGAAGG - Intergenic
1056775903 9:89512418-89512440 CACATTGTTCAGAGTTAGCGTGG + Intergenic
1057313179 9:93954242-93954264 CCCTTTCTTCTAATTTGGCGGGG - Intronic
1057950344 9:99364779-99364801 CTTTTTGTTCAGACTTCGCCTGG - Intergenic
1060030069 9:120206893-120206915 CTCTTTGTACAGATTTAGGTGGG - Intergenic
1187085510 X:16038884-16038906 CTGTTTGTTCAGATTTTTCTTGG - Intergenic
1190004594 X:46723415-46723437 CTCATTGTTCAGACTTGCCCGGG + Intronic
1194847645 X:98830911-98830933 TGCTTTTTTCAGATTTGGAGAGG + Intergenic
1196320416 X:114333668-114333690 CTGTTTGTTCAGATTTGTTTTGG + Intergenic
1198379203 X:136068389-136068411 CTCTTTGTTCTCAGTTGGGGAGG + Intergenic
1198612274 X:138415238-138415260 CTCTTTTTTCATATTTAGCCTGG - Intergenic
1199165238 X:144665077-144665099 CTCCTTGTTCAGTTTTGGGAGGG + Intergenic
1199298792 X:146188699-146188721 CTCTCTTTTCAGATTTGCTGTGG - Intergenic