ID: 1108334134

View in Genome Browser
Species Human (GRCh38)
Location 13:49421613-49421635
Sequence ACCAAGGCCTCCCCTCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108334132_1108334134 -8 Left 1108334132 13:49421598-49421620 CCACCACTTAGCAGTACCAAGGC 0: 1
1: 0
2: 4
3: 19
4: 138
Right 1108334134 13:49421613-49421635 ACCAAGGCCTCCCCTCCACATGG 0: 1
1: 0
2: 0
3: 22
4: 248
1108334129_1108334134 24 Left 1108334129 13:49421566-49421588 CCAGAGGAGACTTGTTGAGTGCT 0: 1
1: 0
2: 2
3: 9
4: 99
Right 1108334134 13:49421613-49421635 ACCAAGGCCTCCCCTCCACATGG 0: 1
1: 0
2: 0
3: 22
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108334134 Original CRISPR ACCAAGGCCTCCCCTCCACA TGG Intronic
900271379 1:1791018-1791040 CCCTTGGCCTCCCCTCCACAGGG + Intronic
900284577 1:1892941-1892963 ACCGAGGCCCCGCCCCCACAGGG + Intergenic
901257804 1:7846562-7846584 ATCCAGGCCTCCCCTATACATGG + Intronic
902816496 1:18919351-18919373 ACCGAGGCCTGCCCTCATCAAGG + Intronic
903132526 1:21289472-21289494 TCCAATTCCTCCCCTCCCCAGGG - Intronic
903318560 1:22527653-22527675 ACCAGGCACTCCCCTCCACAGGG - Exonic
903486945 1:23696633-23696655 ACCAAACCCTCCCCTCCAAATGG - Intergenic
905483785 1:38281267-38281289 ACCAACTCCTCCCATCCTCATGG - Intergenic
907438640 1:54464997-54465019 CCCAGGGTCTCCCCGCCACATGG + Intergenic
910449918 1:87334557-87334579 ACCAAGGGGTCCCCTTCACCTGG - Intronic
912858627 1:113193404-113193426 ACCAAGCCCTTCCCACCTCAGGG + Intergenic
919297924 1:195724148-195724170 ACAAAGGCTTCCATTCCACAGGG - Intergenic
920092619 1:203465080-203465102 GCCATGGCCTCCTCCCCACATGG - Intergenic
920851635 1:209632016-209632038 AACAAGCCCTCCCCTCCCAAGGG - Intronic
920852975 1:209641311-209641333 ACCAAGGACTCCACTGCACATGG - Intronic
922014494 1:221631396-221631418 ACCAAGGCCACACTTCCCCAGGG + Intergenic
922669151 1:227495462-227495484 CAAAAGGCTTCCCCTCCACACGG - Intergenic
922670446 1:227505840-227505862 CAAAAGGCTTCCCCTCCACACGG + Intergenic
922718438 1:227888509-227888531 GCCCAGGCCTCCCCTCCAGAGGG + Intergenic
923870776 1:237991923-237991945 ACATAGCCCTCCCCTCAACATGG - Intergenic
1062782841 10:231984-232006 ACCAAGGCCTCCCTGTAACAGGG - Intronic
1062958238 10:1554142-1554164 ACCAGGGCCTGCCCTGCAGATGG - Intronic
1065762568 10:28995917-28995939 CCCAAGTCCTTCCCACCACAAGG - Intergenic
1065771969 10:29086095-29086117 TCCCAGTCCTCCCCTTCACATGG - Intergenic
1067081663 10:43215902-43215924 GCTGAGGCCTCACCTCCACAGGG - Intronic
1067163451 10:43846359-43846381 ACAAAGGCCAACCTTCCACAAGG - Intergenic
1067476961 10:46573730-46573752 ACCAAGGCTGCCCCTCAGCATGG - Intergenic
1067617778 10:47768051-47768073 ACCAAGGCTGCCCCTCAGCATGG + Intergenic
1067685691 10:48465039-48465061 ACCAATCCCTCCCCTCATCAGGG + Intronic
1069055809 10:63843716-63843738 CCCAAGGCCTCCCTCCCAGAAGG - Intergenic
1072156089 10:92724988-92725010 CCCAAGACCTCCCTTCCTCAAGG + Intergenic
1072921196 10:99578726-99578748 ACCAACTCCTCCCCTCCCCGTGG + Intergenic
1073445388 10:103577258-103577280 ACCAAACCCTCCCCTCCATTAGG + Intronic
1074986877 10:118666944-118666966 TCCAAAGCCCCCCCACCACATGG + Intergenic
1075535830 10:123271386-123271408 ACCAAGGCCTCCACTCAAACAGG - Intergenic
1075591936 10:123698259-123698281 ACCATTTCCTCCCCTCCAAATGG + Intergenic
1076549927 10:131271713-131271735 CTCCAGGCCTTCCCTCCACATGG - Intronic
1076563334 10:131381675-131381697 ATCAGGGCCCCCCCTCCACCTGG + Intergenic
1078890523 11:15552636-15552658 ACAAAGGCCTCCTCTCCATGGGG - Intergenic
1080951091 11:37033799-37033821 AGCAAGGCATCTTCTCCACAAGG - Intergenic
1081294391 11:41367795-41367817 CCCAAGGCCTCCCTGCCATATGG + Intronic
1081858127 11:46316686-46316708 CCCAAGCCCTTCCCTGCACAAGG - Intronic
1083680994 11:64351856-64351878 TCCCAGCCCTCCCCTCCACAGGG + Intronic
1084333850 11:68445839-68445861 ACAAAGGCACCCCCTTCACAAGG - Intronic
1085637529 11:78170090-78170112 ACCTTGGCCACCCCTGCACAGGG + Intergenic
1088704236 11:112447607-112447629 TCCAGGGCCTCCTTTCCACAGGG - Intergenic
1089387355 11:118077142-118077164 ACCAAGGCCTGCCCTGCACTCGG + Exonic
1090265489 11:125350759-125350781 ACCAAGCTCGCCCCTCCCCAGGG - Intronic
1090543919 11:127740390-127740412 ACCAGGTCCTACCCTTCACATGG - Intergenic
1091890331 12:4048776-4048798 CCAAAGGCCTCCCCTCCCCCGGG + Intergenic
1095337695 12:41048493-41048515 CCTAAGGACACCCCTCCACATGG + Intronic
1102322865 12:111953262-111953284 ACCAATGACTCCCTTCGACATGG + Intronic
1102811538 12:115828527-115828549 AACAAGTCCTTCCCTCCACCAGG + Intergenic
1104110243 12:125697885-125697907 ACCACATCCTCCCCTCCTCATGG - Intergenic
1106227158 13:27794123-27794145 ACCATGGCGTCCCCGCCCCAGGG + Exonic
1107912140 13:45115203-45115225 ACCAGGGGCTTCCCTCCTCAGGG + Intergenic
1108334134 13:49421613-49421635 ACCAAGGCCTCCCCTCCACATGG + Intronic
1108551416 13:51549347-51549369 CCCAAGGTCTCCTATCCACAGGG - Intergenic
1111587978 13:90307175-90307197 ACCAGGTCCTTCCCTCAACATGG - Intergenic
1112313930 13:98344368-98344390 TCCAAGCCCTCTCCTCCACAGGG - Intronic
1116756704 14:48957676-48957698 ACTCAGGCCGCCCCTCCAGAGGG + Intergenic
1117623423 14:57611137-57611159 ACCAAACTCTCCCCACCACAGGG - Intronic
1121432989 14:93900468-93900490 ACCAAACCCCACCCTCCACATGG + Intergenic
1121563559 14:94892414-94892436 ATCACAGCCTCCCCTCCAAATGG - Intergenic
1121656013 14:95596175-95596197 ACCAAGGCCCCCCCACAGCATGG - Intergenic
1121904593 14:97728143-97728165 TCCAAGGCCTGCCCACCACTAGG - Intergenic
1122308906 14:100782550-100782572 ACCAGGGCCTCACCCCCACCAGG - Intergenic
1122730492 14:103793441-103793463 AGCAAGGCAGCTCCTCCACAAGG - Intronic
1122773678 14:104107971-104107993 GCCAAGTCCTCCCACCCACAGGG - Intronic
1122976908 14:105174519-105174541 CCCAAGGCCTCCCCACCTCCGGG + Intronic
1124250503 15:28103973-28103995 CCCAGGGCCGCCCCTCCGCATGG - Intergenic
1125540508 15:40467282-40467304 GCCAAGGCCTAGTCTCCACAAGG - Exonic
1126784312 15:52163985-52164007 AGTCAGGCCTCTCCTCCACAGGG - Intronic
1129231271 15:74198448-74198470 TTCAAGGCCTCCCCTCTCCAGGG + Intronic
1130313951 15:82779257-82779279 CCCCAGGCTTCCTCTCCACATGG + Intronic
1131165902 15:90142020-90142042 ACCAAGGGCTTCCCTGGACAAGG + Intergenic
1131542114 15:93283270-93283292 GCCAAGGCCTCACCTTCCCATGG - Intergenic
1132481148 16:166710-166732 ACCAAGGCCTGCGCAGCACAGGG - Exonic
1132685318 16:1159631-1159653 CCCCAGGCCTCCCCTCCCTAAGG - Intronic
1134010655 16:10849877-10849899 ACCCTGGCCTACCCTCTACATGG + Intergenic
1134233354 16:12446621-12446643 TGCAAGGAATCCCCTCCACAGGG - Intronic
1135565882 16:23510547-23510569 CCCCAGGCCCCCCCTCCACGCGG + Intronic
1136640464 16:31560285-31560307 ACAAAGGTCTCCTATCCACAAGG + Intergenic
1141709304 16:85688770-85688792 AGCCCGGCCTCCCCTCCCCACGG + Intronic
1143294148 17:5857949-5857971 ACCCAGGTCTGGCCTCCACAGGG + Intronic
1143479167 17:7218793-7218815 TCCCAGACCTCCCCTCCACAAGG + Intronic
1143759522 17:9090906-9090928 TCCATGTCCTCCCCTCCACCGGG + Intronic
1148213431 17:45821466-45821488 ACCCTGGACTCCCCTCCATATGG - Intronic
1151324107 17:73368371-73368393 ACCTACCCCTCCCCTCCTCAGGG + Intronic
1151787024 17:76280020-76280042 TCCCAGGCCTCACCTCCGCATGG + Exonic
1154201943 18:12306302-12306324 ACCAAGGCCTCCCCAGGACATGG - Intergenic
1154359481 18:13647381-13647403 ACAGAGGCCCACCCTCCACATGG - Exonic
1155440119 18:25853514-25853536 GGCAAGGTCTCCCCTACACAGGG + Intergenic
1155965606 18:32032700-32032722 ACCAAGCCCGGCCCTCCACTGGG - Intronic
1156827091 18:41444008-41444030 CCCACCACCTCCCCTCCACAAGG + Intergenic
1157282262 18:46353853-46353875 AGCCAGGCCACCCCACCACAAGG - Intronic
1159769906 18:72537637-72537659 CCCAAGTCCTCCCAGCCACATGG + Exonic
1159948003 18:74457865-74457887 ACCCAGCCCTCCCCTTCCCACGG + Intronic
1160450755 18:78964938-78964960 ACCCAGGCTGCCCCTCCACCCGG + Intergenic
1160450773 18:78965000-78965022 ACCCAGGCTGCCCCTCCACCCGG + Intergenic
1160450792 18:78965061-78965083 ACCCAGGCTGCCCCTCCACCCGG + Intergenic
1160450870 18:78965306-78965328 ACCCAGGCGGCCCCTCCACCTGG + Intergenic
1160521486 18:79510790-79510812 ACCCCGGCATCCCCTCCACGGGG + Intronic
1160722985 19:605349-605371 CCCGAGTCCTCCCCTCCATAAGG - Intronic
1160723005 19:605401-605423 CCCGAGTCCTCCCCTCCATAAGG - Intronic
1160723025 19:605453-605475 CCCGAGTCCTCCCCTCCATAAGG - Intronic
1160723045 19:605505-605527 CCCGAGTCCTCCCCTCCATAAGG - Intronic
1160723065 19:605557-605579 CCCGAGTCCTCCCCTCCATAAGG - Intronic
1160723085 19:605609-605631 CCCGAGTCCTCCCCTCCATAAGG - Intronic
1160723105 19:605661-605683 CCCGAGTCCTCCCCTCCATAAGG - Intronic
1160723125 19:605713-605735 CCCGAGTCCTCCCCTCCATAAGG - Intronic
1160860323 19:1234860-1234882 GCCAAGGCCGCCCCACCCCACGG + Intronic
1161024332 19:2028642-2028664 ACCCAGGCTTCCCCGACACAGGG + Intronic
1161299986 19:3537875-3537897 TCCAAGGCCGCCCTTCCCCAAGG - Intronic
1162112082 19:8404776-8404798 GCCAGGGCCTCCCCTCCCCTGGG + Intronic
1163250343 19:16122993-16123015 ACCAAGCCCTCCCCTGCACCAGG + Intronic
1165096624 19:33413254-33413276 AGGAAGGCCACTCCTCCACACGG - Intronic
1165361772 19:35341267-35341289 CCCCAGGCCTCCCCTCCCCTTGG - Intronic
1165406601 19:35634494-35634516 GCCATAGCCTCCCCTCCCCAAGG - Intronic
1165821964 19:38682482-38682504 ATCAATGCCTCCCCTCTACAGGG - Intronic
1166319062 19:42005406-42005428 ACCAGGTCCTCACCCCCACAGGG + Intronic
1166980973 19:46631832-46631854 TGCTGGGCCTCCCCTCCACAGGG - Intergenic
1168167329 19:54559039-54559061 CCCAAGGCGTCCCCTCAATAGGG + Intergenic
1168349669 19:55668854-55668876 GCCATGGTCTCCCCTCCTCAGGG + Intronic
1168414870 19:56161383-56161405 GCCAAAGCCTGCCCTCCATACGG - Intergenic
926303315 2:11618975-11618997 CCCCAGGCCTGCCCTCCAGATGG - Intronic
927050839 2:19327085-19327107 AGCAAGACCTTCCCTCTACAAGG + Intergenic
928649451 2:33389231-33389253 ACCAAGGCGTCCCGTCCATATGG - Exonic
932693375 2:73932511-73932533 ACCAATGCCTAACTTCCACATGG - Intronic
933737315 2:85505575-85505597 ACCAGGACCTCCCCTGCACCAGG + Intergenic
936025145 2:109025991-109026013 ACCAAGGCCTGCCCTCCCTGGGG + Intergenic
937466147 2:122134816-122134838 ACCAAAGCCACCCCTTCAGAAGG - Intergenic
940704424 2:157086079-157086101 ACAAAAGCCTCCCCCACACAAGG + Intergenic
947239224 2:227976524-227976546 ACCAAGGCCTCAGTTCCCCAAGG + Intergenic
947738650 2:232474450-232474472 CCCAAACCCTCCTCTCCACAGGG + Intergenic
948860261 2:240749533-240749555 ACCAAGGTCTCCCCTCACCAAGG - Intronic
948885057 2:240878222-240878244 ACCCCGGCCTCCCCTGCACCTGG - Intronic
1170727963 20:18946865-18946887 ACCAAGGACCCCTCTCCAGAGGG - Intergenic
1171188626 20:23142152-23142174 ACCAAGTCCTCCCCCGCACAGGG + Intergenic
1171440913 20:25162157-25162179 ACCTGGGCCTCTCCTCCCCATGG + Intergenic
1172662420 20:36576269-36576291 AGCAAGGCCCACCCTCCACTTGG - Intronic
1173981315 20:47226216-47226238 ACCAAGGGCTCCTCTCCAGGGGG + Intronic
1174156035 20:48515950-48515972 AACAAGACCTCTCCTCCACTGGG + Intergenic
1174959957 20:55144655-55144677 AGCAAGGCACCCCCTTCACAAGG - Intergenic
1175904505 20:62372766-62372788 ACAAAGGCCTCCCCTCATCCGGG + Intergenic
1177149324 21:17438861-17438883 CCCAAGCCCTCCCTTCCAGATGG + Intergenic
1177422929 21:20884926-20884948 ACCAGGGCCTGACCACCACAAGG + Intergenic
1178373112 21:32044268-32044290 CCCAAGGCTTCCCTTCCACGCGG + Intronic
1178751064 21:35303494-35303516 AACAAGGCATCTCCTTCACATGG + Intronic
1179808469 21:43854966-43854988 AGCATGGCCACCCCTCCCCATGG + Intergenic
1179824686 21:43957459-43957481 GCCAGGGTTTCCCCTCCACACGG + Intronic
1179837208 21:44043944-44043966 ACCAAGGTCTCTGCTCCACCTGG - Intronic
1181377871 22:22474861-22474883 ACCTAGGCCTCCCCATGACAGGG + Intergenic
1181495144 22:23283473-23283495 ACCAATCTCTCCCCACCACAGGG + Intronic
1181630591 22:24149147-24149169 ACCAAGGACTCCCTCACACATGG + Intronic
1182528169 22:30934634-30934656 ATCAAGGCTTCCCGTCCTCAGGG + Intronic
1183380655 22:37489060-37489082 ATCCGGGCCTCCACTCCACAGGG + Intergenic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184253508 22:43274404-43274426 ACCCTGCCCTGCCCTCCACAGGG + Intronic
1184730131 22:46367247-46367269 GGCCAGGCCTCCCCTCCTCAGGG + Intronic
1184825270 22:46946364-46946386 ACCAAGGCCTCTGCTCGTCAGGG - Intronic
1184837255 22:47031380-47031402 ACCAGGGCCTCCACTTCCCAGGG - Intronic
1185371303 22:50462158-50462180 ACCACGGCCCCGCCTCCACTGGG + Intronic
950078580 3:10205290-10205312 ACCCAGCCCTCCCCTCCTCTGGG - Intronic
950297896 3:11847753-11847775 ACCAAGGCCCTCCTGCCACAGGG - Intergenic
953215438 3:40913747-40913769 ACAGAGGCCTCTGCTCCACATGG + Intergenic
953283255 3:41579434-41579456 CCAAAGGCCTCCCCATCACAAGG + Intronic
953806943 3:46078567-46078589 ACCCAGACCTCCCTTCCCCAAGG - Intergenic
954527281 3:51283304-51283326 TCCAAACCCTCCTCTCCACAGGG - Intronic
954793479 3:53149342-53149364 ACCAAGGCTTTCCCTCCTGAGGG - Intergenic
956237835 3:67094702-67094724 GCCAAGGCCTCCTCTCCCTAGGG + Intergenic
958256384 3:91330644-91330666 ACAAAGGCCTCCCCTGCACCAGG + Intergenic
959357677 3:105353645-105353667 ACCAAGATCTCCTCTACACAAGG + Intergenic
960048713 3:113221030-113221052 TCCAAAGCCTCCCCTCAACCAGG - Intronic
961645329 3:128389723-128389745 GCCAAGGCCTCCCTTTCCCAAGG - Intronic
962876221 3:139538034-139538056 GCCAAGAGCTCCCTTCCACAAGG - Intronic
964497041 3:157302413-157302435 CCAAAGGCCTCCCCTCCCAATGG - Intronic
966430036 3:179821620-179821642 GCAAAGGCCTCCTCTCAACAAGG + Intronic
968507427 4:977413-977435 ACCAAGCCTTCCCTTCCACAAGG + Intronic
968561509 4:1285592-1285614 GCCAAGGGCTCCGTTCCACAAGG - Intergenic
969476709 4:7426205-7426227 ACCCAGGGCTTCCCCCCACAAGG - Intronic
970433240 4:16008274-16008296 TCCAAGTCCTTCCCTCCCCAGGG + Intronic
971092632 4:23362491-23362513 CTCAAGGCTTCCTCTCCACAAGG - Intergenic
972899817 4:43669311-43669333 ACCCAGGCCTCTGCTGCACAGGG + Intergenic
979799527 4:124891441-124891463 ACCAAGGACGCCCATCCAAAGGG - Intergenic
981114032 4:140968942-140968964 ACAGAGGCCTCGCATCCACATGG + Intronic
983227841 4:165101645-165101667 CACAAGGCCACCCCTGCACATGG + Intronic
985495406 5:201866-201888 AGCGAGCCCTCCCCTCCCCAAGG + Exonic
987071570 5:14341984-14342006 ACAAAGGCCTCCCAGCCACCTGG + Intronic
987271372 5:16312912-16312934 TCCACTGCCTCCCCTTCACATGG - Intergenic
990069771 5:51766819-51766841 AAAAAGGCCTCCCTTCCACCAGG - Intergenic
995482185 5:112604372-112604394 ACCCAAGCCTCCCCACCAGAGGG + Intergenic
998506879 5:142679356-142679378 ACCCAAGCCTCACCTCCTCATGG + Intronic
1001240123 5:170062539-170062561 TCCAAGCCCTCCTCTCCACAGGG - Intronic
1002061092 5:176626589-176626611 CCCAGGGCCTGCCCTCCCCACGG + Intronic
1003513659 6:6801750-6801772 ACCATGGCCGCCCATCCCCATGG - Intergenic
1004025105 6:11810628-11810650 GGCAGGGGCTCCCCTCCACAAGG - Intergenic
1005517130 6:26565666-26565688 ACCACGTCCTCCCCTACACGTGG + Intergenic
1007837285 6:44683459-44683481 TCCAAGGCCATCACTCCACATGG + Intergenic
1008998952 6:57690516-57690538 ACAAAGGCCTCCCCTGCACCAGG - Intergenic
1009187437 6:60589895-60589917 ACAAAGGCCTCCCCTGCACCAGG - Intergenic
1009823455 6:68835953-68835975 ATCAAGACCTCCACTCTACAAGG + Intronic
1010924778 6:81731540-81731562 AGGAAAGCCTCACCTCCACATGG + Intronic
1011847318 6:91582224-91582246 ACCTAAGCCTCCCCTCCCTATGG - Intergenic
1011908986 6:92410940-92410962 TCCAAACCCTCCTCTCCACAGGG + Intergenic
1012057346 6:94429840-94429862 TCCAAGTCCTCTTCTCCACAGGG + Intergenic
1014563456 6:122918640-122918662 TCAAAGCCCTCCTCTCCACAGGG + Intergenic
1016026341 6:139291117-139291139 ACTTAGGCCTCCCCTGAACACGG + Intronic
1018425133 6:163672876-163672898 ATCAAGGTCTCTCCTCCAAAAGG + Intergenic
1018937508 6:168283364-168283386 CCGAAGTCCTCCCCTCCCCAAGG - Intergenic
1019325646 7:436939-436961 ACCACGGCGACCCCTCCCCAAGG + Intergenic
1020114831 7:5470572-5470594 ACCACGGCCAGCCTTCCACAGGG + Intronic
1021463037 7:20910639-20910661 ACCAACTCTTCCTCTCCACAAGG + Intergenic
1022328135 7:29351839-29351861 TCCAAGGTCTTCCCTGCACATGG - Intronic
1023170589 7:37386813-37386835 CCCAAGCCCTTCCCTGCACACGG + Intronic
1026992593 7:74595714-74595736 GGCAAGGCCTCCCCTCTGCAGGG - Intronic
1027188923 7:75986943-75986965 ACCCAGCCCTCCCCTCCCCCAGG + Exonic
1027723139 7:81769997-81770019 ACCCAGGCATCTCCTCCAGAGGG - Exonic
1028105054 7:86867412-86867434 TCCAAATCCTCCTCTCCACAGGG - Intergenic
1029153514 7:98498662-98498684 TCCATGTCATCCCCTCCACAGGG - Intergenic
1029374364 7:100168962-100168984 AACAAGGCCTCCCATCCTGAAGG + Intergenic
1029405821 7:100373575-100373597 CCCCAGGCGGCCCCTCCACAGGG + Exonic
1032247306 7:130223889-130223911 TGCAAGGCCTCACCACCACACGG - Intergenic
1032706737 7:134426544-134426566 AGCACAGCCTCCCCTCCACAGGG - Intergenic
1033284060 7:140025939-140025961 CCCAGGGCCTCTGCTCCACAGGG + Intronic
1034052764 7:148000285-148000307 ACCTATGCCTGCCCTCCAGAGGG + Intronic
1035033250 7:155878340-155878362 ACCAAGGGCTCCCCACAGCAGGG - Intergenic
1035255146 7:157621198-157621220 ACCCAGGCCTCCCGTCCCCGGGG + Intronic
1035394680 7:158527247-158527269 CCCCAGGCCTCCTCCCCACAAGG + Intronic
1036201478 8:6774390-6774412 GCCAAGATCGCCCCTCCACAAGG - Intergenic
1036657825 8:10689136-10689158 ACCAATCCCTTCCCTACACAGGG + Intronic
1036688015 8:10924584-10924606 ACCCCGGCCTGCCCTCCACCTGG - Intronic
1037881446 8:22575294-22575316 CCCAAGGCCTCCTCTTCCCAGGG + Exonic
1038440637 8:27568932-27568954 AGCAAGGCCTCCTCTGCCCAGGG - Intergenic
1039819746 8:41125180-41125202 CCCAACTCCTCTCCTCCACACGG + Intergenic
1039953576 8:42190819-42190841 ACCCAGGCAACCCCTCGACATGG - Intronic
1039967627 8:42294737-42294759 CCCAAGGGATCCCCTGCACATGG + Intronic
1040776063 8:51044574-51044596 CCCAAGCCCTGCCCTCCACTGGG - Intergenic
1041442256 8:57909932-57909954 ACCAATTCCTTCCCTACACATGG + Intergenic
1041535828 8:58924579-58924601 ACACAGGACTGCCCTCCACAGGG - Intronic
1042509936 8:69600663-69600685 ACCAATGCTGCCCATCCACATGG + Exonic
1044552152 8:93524587-93524609 TCCAAGGCCTCCCCTGCATGTGG + Intergenic
1046332353 8:112735674-112735696 ACCAAGGCCTCCCTTTGAAAGGG - Intronic
1048066917 8:130979510-130979532 CCCTAGCCCTCCCTTCCACATGG - Intronic
1048987866 8:139744982-139745004 CCCGGGGTCTCCCCTCCACAGGG - Intronic
1049282489 8:141757157-141757179 CCCAAGCCCTCCCCTCCCCATGG - Intergenic
1049573146 8:143378845-143378867 AGCTGGGCCTCCCCTCCCCAGGG - Intronic
1049614874 8:143571758-143571780 TCCAGGGCCTCCCCTCCGCTAGG + Exonic
1049688153 8:143947249-143947271 ACCATGACTTCCCCTCTACACGG - Intronic
1053009443 9:34624882-34624904 CTCGAGGCCTCCCCTCCACTGGG - Intronic
1053266119 9:36714749-36714771 ACTCAGCCCTCCCCTCCACCAGG + Intergenic
1053743223 9:41163909-41163931 AACAATACCTACCCTCCACATGG + Intronic
1054348502 9:63993720-63993742 AACAATACCTACCCTCCACATGG + Intergenic
1054446230 9:65320090-65320112 AACAATACCTACCCTCCACATGG + Intergenic
1054484044 9:65701417-65701439 AACAATACCTACCCTCCACATGG - Intronic
1054685120 9:68267380-68267402 AACAATACCTACCCTCCACATGG - Intronic
1056932396 9:90889892-90889914 CCCAAGGGCTGCCCTCCCCAGGG - Intronic
1058868628 9:109183745-109183767 ACCAAGGCCACCACTGCCCAGGG + Intronic
1059385072 9:113958295-113958317 TCTAAGTCCTCCCCTGCACATGG + Intronic
1059780499 9:117521431-117521453 AGCCAAGCCTCCTCTCCACATGG - Intergenic
1060196699 9:121628660-121628682 TCCAAGGCATCCCCTCGGCAGGG + Intronic
1060895260 9:127212887-127212909 GCCCAGCCCTCCACTCCACAAGG - Intronic
1061212325 9:129201086-129201108 ACCAAGGCCTTCCCTCCTTCGGG - Intergenic
1061928983 9:133822563-133822585 AGCAAGGCCTCCCTCCCTCATGG - Intronic
1062197385 9:135281777-135281799 GGCAGGGCCTCCCCACCACATGG + Intergenic
1062280972 9:135751459-135751481 CCCAAGGAGTCCCCTCCCCAGGG + Intronic
1189646463 X:43138178-43138200 TCCAAGGTCTTCCCTCCAAATGG + Intergenic
1189882707 X:45508777-45508799 CCCAAGGACTGCCCTCCACCTGG - Intergenic
1191065549 X:56343467-56343489 ATCATGGCCACCCCTCCACCCGG + Intergenic
1194554082 X:95336666-95336688 AGCAAGGCATCTTCTCCACAGGG + Intergenic
1198390372 X:136168065-136168087 AGCAGGGCCTCCCCCACACAAGG - Intronic