ID: 1108337790

View in Genome Browser
Species Human (GRCh38)
Location 13:49463826-49463848
Sequence TCTCTATGTTGAGGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 2, 1: 23, 2: 38, 3: 39, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108337786_1108337790 8 Left 1108337786 13:49463795-49463817 CCATAAGAGAAAGGAAAATTTGT 0: 6
1: 5
2: 33
3: 99
4: 611
Right 1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG 0: 2
1: 23
2: 38
3: 39
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108337790 Original CRISPR TCTCTATGTTGAGGGAGTGC TGG Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902748240 1:18487885-18487907 CCTCTATGCTGAGGCAGTGGAGG + Intergenic
905519901 1:38589614-38589636 CCTCTATGCTGGGGGAGTGGAGG - Intergenic
908230460 1:62099535-62099557 TTTGTATGTGTAGGGAGTGCAGG + Intronic
909252011 1:73370447-73370469 TCTCTATATTGAGTGGGTGGTGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913195846 1:116455343-116455365 TCTGTATGCTGAGGGTGGGCGGG - Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
924069552 1:240262173-240262195 TCTCTATGATGAGTGGGTTCTGG + Intronic
1065999676 10:31092531-31092553 TTTCTCTCTTGAGGTAGTGCAGG + Intergenic
1066455012 10:35565183-35565205 TCTACATGTTGATGGAATGCTGG - Intronic
1067336608 10:45371413-45371435 TGTGTATGTTGGGGGGGTGCTGG - Intergenic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1069787427 10:70997824-70997846 TCTCCATGTGGTGGGAGAGCTGG + Intergenic
1070750086 10:78958899-78958921 TCTCTGTGTAGAGGCTGTGCTGG - Intergenic
1071275603 10:84051729-84051751 TGTGTGTGTTGAGGGGGTGCGGG - Intergenic
1072019557 10:91384401-91384423 TCTCCATGCTGTGGGAGTGTGGG + Intergenic
1073214380 10:101828568-101828590 TCTCTAGGCTGAGGGAGGGAGGG - Intronic
1073927518 10:108534127-108534149 TCGCTATGTTGGGGAAGTTCTGG - Intergenic
1075161635 10:120029578-120029600 TCTCTCTGTTGAGGCAGGGCAGG - Intergenic
1076653460 10:132005652-132005674 TCTCCATCTTGAGTGAGGGCTGG + Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1077131661 11:976026-976048 CTTCTATGTTGAAGGACTGCTGG + Intronic
1079230063 11:18641978-18642000 TATCTATGTTGAGAGATTACAGG - Intergenic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081721967 11:45296199-45296221 TCTCCATGTAAAGGGAGTGAAGG - Intergenic
1081731061 11:45371986-45372008 TCTAGTTGTTGAGGAAGTGCTGG - Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1089032591 11:115347999-115348021 CATATATTTTGAGGGAGTGCAGG + Intronic
1090624555 11:128594642-128594664 TGGCTATGTTGAGGGAGTAAGGG - Intergenic
1092773053 12:11916006-11916028 GCTCTATGTTCTGGGATTGCTGG + Intergenic
1092898884 12:13040147-13040169 TCTCTCTGCAGAGGGAGTGAGGG + Intergenic
1093254561 12:16850750-16850772 TCTCTATGATGTTGGAGTGTGGG + Intergenic
1093548951 12:20383901-20383923 TCTCTGTGTTGAGTGAGAGTAGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096840341 12:54376003-54376025 TATCTGTGTTGGGGGAATGCTGG - Intronic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097489084 12:60241847-60241869 TCTCTTTCTTCAGGAAGTGCTGG - Intergenic
1099799190 12:87435728-87435750 TTACTTTGTTGAGTGAGTGCTGG - Intergenic
1100172630 12:91992955-91992977 CCTCTATGTTGAGGGAGACAAGG + Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1104284888 12:127416037-127416059 ACTCTATCTTGAGTGAGGGCTGG + Intergenic
1104355019 12:128077609-128077631 TTTCCATTTTGATGGAGTGCTGG - Intergenic
1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG + Exonic
1104722585 12:131053205-131053227 TCACTGTGATGACGGAGTGCAGG + Intronic
1104751131 12:131239887-131239909 GCTTTCTGTTGAGGGAGGGCTGG - Intergenic
1107140679 13:36995538-36995560 TCTTCATGTCGATGGAGTGCTGG + Exonic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1112343259 13:98569742-98569764 TCTCTCTGCTGGGGGAGAGCGGG + Intronic
1115282808 14:31683768-31683790 TTTCTATGTTGTGGGTCTGCTGG + Intronic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1117334733 14:54747383-54747405 ACTCTAGGTTTAGGGAATGCGGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122596390 14:102895905-102895927 TCTCCGTGTTGAGGGTGAGCAGG + Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1125367733 15:38936885-38936907 TTTCTATGTTGAAGCAGTTCTGG + Intergenic
1127627332 15:60793011-60793033 TCTCTCTTTTGAGGGAGTGGTGG - Intronic
1127774188 15:62252781-62252803 TCTCTAGGCTGAGGGAGTCAGGG - Intergenic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1128690257 15:69719304-69719326 TCTCTATGATGAGCAAGTGGAGG + Intergenic
1129523931 15:76202304-76202326 TCTCTGGGTTTAGGGATTGCTGG - Intronic
1129641276 15:77381053-77381075 TCTCTGTGAAGAGGGAGAGCAGG - Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1134772354 16:16820741-16820763 TCTGTATGTTCAGAGAGTGATGG + Intergenic
1138219797 16:55240971-55240993 TCTCTAAGTTGAGGTCCTGCTGG + Intergenic
1140333878 16:74084840-74084862 ACTCCATCTTGAGGGAGGGCTGG - Intergenic
1143152868 17:4818085-4818107 CCTCAATGTAGAGGAAGTGCTGG - Exonic
1143272046 17:5683073-5683095 TCTCTTTGTGGAAAGAGTGCTGG - Intergenic
1144825676 17:18104466-18104488 GATCTATGTGGAGGGTGTGCTGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146820689 17:35981827-35981849 TCTGTATGTTGGGGAAGGGCAGG + Intergenic
1150446497 17:65230690-65230712 AGTCCATGTTGGGGGAGTGCAGG + Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153489454 18:5631723-5631745 TGTCTATGTTTTGAGAGTGCAGG + Intergenic
1153992785 18:10414842-10414864 GCTCTATGATGAGGGAATGCTGG - Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1155824836 18:30427914-30427936 TCTGTATGTTAAGGAAATGCAGG + Intergenic
1156953358 18:42932124-42932146 TTTCTATCATGAGGGAGTGCTGG - Intronic
1158285575 18:55877627-55877649 TCTCTATCTTGAGAGAGTTGTGG + Intergenic
1158458232 18:57625885-57625907 TCTCTATGTCAAGTTAGTGCAGG + Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1161612132 19:5248983-5249005 TCTCTACCTTAAGGGAGTTCAGG + Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1167485576 19:49761167-49761189 TTTCTATGTTCAGGGAGCCCTGG - Intronic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
925610605 2:5697706-5697728 TCTACATGTTGAGGGGGTGTGGG - Exonic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
930016947 2:46977240-46977262 TATCTAAGTTGAGGGAGGGCAGG + Intronic
930284169 2:49407309-49407331 ACTCTGTGTTGAGTGAGTACAGG - Intergenic
930778198 2:55196378-55196400 TCTCTGGGTTGGGGGAGTGGTGG - Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933031083 2:77329574-77329596 TCTCTGTGCAAAGGGAGTGCAGG - Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
934032518 2:88061113-88061135 TCTTTAGGGTGAGGGAATGCTGG + Intergenic
936936801 2:117846715-117846737 TCTATATGATGAGTTAGTGCTGG - Intergenic
937286689 2:120758484-120758506 CCTCTCTTGTGAGGGAGTGCTGG + Intronic
937303055 2:120854989-120855011 GCTCTGTGTGGAGGGTGTGCAGG - Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
942522751 2:176821438-176821460 TCTCTAGGTTGTGGAGGTGCAGG + Intergenic
943114662 2:183652488-183652510 TCTCTAAATGGTGGGAGTGCAGG + Intergenic
945253464 2:207784172-207784194 TCTCTAAGTTGGGGGATTACAGG - Intergenic
945436150 2:209820251-209820273 TCTTTAGGAAGAGGGAGTGCAGG + Intronic
947849962 2:233278595-233278617 TTTCTGTGGTGAGGGAGTGGTGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1171344771 20:24457677-24457699 ACTCTATGTTGGGGGAGTTGAGG + Intergenic
1171972324 20:31572199-31572221 TCTCTGTGTTGAGGAAGAGGAGG + Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1173943960 20:46935167-46935189 TTGCTATGTAGAGTGAGTGCAGG + Intronic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1175714776 20:61248052-61248074 TCTGTATAATGGGGGAGTGCAGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1176876856 21:14138180-14138202 TATCTATGTTTAGGGGGTTCAGG - Intronic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1182394929 22:30028386-30028408 TCTCTGTGTGGAGAGAGGGCGGG - Intronic
1183716257 22:39535249-39535271 ACTCTTTGTTAAGGGATTGCTGG - Intergenic
949566119 3:5246332-5246354 TCTCTCTCGTGAGGGAGTCCAGG + Intergenic
950216336 3:11162345-11162367 TCTCCTTGGTGGGGGAGTGCGGG + Intronic
954751867 3:52818373-52818395 TCTCGATGTTGAAGTAGTGAGGG - Exonic
955133431 3:56192604-56192626 TCTCTGTGTTTAGGGAGGCCTGG - Intronic
955133824 3:56196277-56196299 TCTCTGTGAGGAGGGAGTGTGGG - Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
963853076 3:150226853-150226875 TCTCTGTGTAGGGAGAGTGCAGG + Intergenic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
967036065 3:185649079-185649101 TCTCTGTTTTCAGGGAGTGGAGG + Intronic
968692284 4:1998740-1998762 TCTCTAGGTTGAGGAAGTTCTGG - Intronic
968722483 4:2217876-2217898 TCTCTGGGTTTAGGGAGTGGAGG - Intronic
969081298 4:4620644-4620666 TGTCTAAGTTGAGAGAGTTCTGG - Intergenic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972310149 4:37873920-37873942 TCTCTCTGTTGAGTGTGTGTGGG + Intergenic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
974328795 4:60449860-60449882 TCTCCACCTTGAGGGAGAGCAGG - Intergenic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
976710484 4:88065696-88065718 TCTCTGTGTTGAGGGTGAACTGG + Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
978552610 4:109943890-109943912 TCTCGATGGTGTGGGAGTGAAGG + Exonic
979505010 4:121485569-121485591 GATCTATGTTGAGGGAGGGTGGG + Intergenic
979679420 4:123443528-123443550 TCTCTTTTTTGAGGGGGTGGAGG - Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
983691474 4:170474223-170474245 TGTCTATGTTGAGAGGGTACAGG - Intergenic
985947061 5:3194090-3194112 TCTCTGTGTAGAGGGAGGGATGG + Intergenic
987369746 5:17182059-17182081 TTTCTTTGTTGAGTGAGTGAAGG - Intronic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
991938967 5:71831764-71831786 TCTTTATGTTGAAGGAGATCAGG + Intergenic
992759559 5:79939455-79939477 TCCATATCTTGAGGGATTGCAGG - Intergenic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
994788694 5:104196838-104196860 TCTCTCTGTTGAGGTATGGCTGG + Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003849658 6:10208872-10208894 TCTCTATGTTGAAGGAGAGTGGG - Intronic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006175300 6:32117734-32117756 CTTCTTTGTTGTGGGAGTGCTGG - Intronic
1006296907 6:33173804-33173826 TCAGGATGTTGAGGGAGAGCTGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007257972 6:40541822-40541844 TGTCTATGGGGAGGGGGTGCTGG - Intronic
1008769349 6:54960638-54960660 TCTCTAGGTAAAGGCAGTGCTGG + Intergenic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1012947403 6:105482327-105482349 TCTGTCTGGTGAAGGAGTGCTGG + Intergenic
1013254035 6:108365858-108365880 TCTCTTTTTTGAGGGGGTGTGGG + Intronic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1017091954 6:150767129-150767151 TCTTTATTTTGAGGGAGTGTAGG + Intronic
1018123825 6:160662645-160662667 TCTGTGTGTGTAGGGAGTGCAGG - Intronic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1022485850 7:30777131-30777153 TCTCAAAGTTCAGGGACTGCAGG + Intronic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1023754931 7:43407654-43407676 TGTCCATGGTGAGGGAGGGCGGG - Exonic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1025192983 7:56910553-56910575 TATCTATGTTTTAGGAGTGCAGG + Intergenic
1025678962 7:63666367-63666389 TATCTATGTTTTAGGAGTGCAGG - Intergenic
1028800556 7:94960368-94960390 CCTCTATGCTGAGGGAGGGAGGG + Intronic
1032420450 7:131774991-131775013 TCTCTTTGCTGAGGAAATGCAGG + Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1032871495 7:135990905-135990927 TTTCCATGTTGATGGAGTGCAGG - Intergenic
1032929485 7:136649768-136649790 TCTCTATGTGGATGGAATCCTGG - Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1035307659 7:157943569-157943591 CCTCCATGTTGAGGGAGTCTGGG - Intronic
1039193729 8:35006468-35006490 TCTTTTTGTTGAGACAGTGCTGG + Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041144600 8:54860664-54860686 GTTCTTTGTTGAGGGACTGCAGG + Intergenic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1041632631 8:60104928-60104950 GGTAAATGTTGAGGGAGTGCTGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055018087 9:71640769-71640791 TCTCTGGGTTGTGGGAGTTCTGG - Intergenic
1055093364 9:72385466-72385488 TTAGTATGTTGAGGGAGTTCAGG - Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1058453391 9:105117279-105117301 TCTCCTTGTTGAGTGAATGCAGG - Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187568690 X:20478475-20478497 GCTCCATGCTGAGGGAGTTCTGG - Intergenic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1190792677 X:53714734-53714756 TCTCTCTGTCAAGGCAGTGCTGG - Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201147566 Y:11073206-11073228 TCTCCATGTTGAGGGCGTGGCGG - Intergenic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic