ID: 1108344045

View in Genome Browser
Species Human (GRCh38)
Location 13:49526864-49526886
Sequence AAGCTTTACCAGCTCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108344045_1108344050 3 Left 1108344045 13:49526864-49526886 CCAGGCAGGAGCTGGTAAAGCTT 0: 1
1: 0
2: 0
3: 15
4: 158
Right 1108344050 13:49526890-49526912 GCGGCTTCTCTGCTCTTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 133
1108344045_1108344047 -1 Left 1108344045 13:49526864-49526886 CCAGGCAGGAGCTGGTAAAGCTT 0: 1
1: 0
2: 0
3: 15
4: 158
Right 1108344047 13:49526886-49526908 TCCTGCGGCTTCTCTGCTCTTGG 0: 1
1: 0
2: 3
3: 20
4: 249
1108344045_1108344051 8 Left 1108344045 13:49526864-49526886 CCAGGCAGGAGCTGGTAAAGCTT 0: 1
1: 0
2: 0
3: 15
4: 158
Right 1108344051 13:49526895-49526917 TTCTCTGCTCTTGGGTGGCGAGG 0: 1
1: 0
2: 1
3: 13
4: 164
1108344045_1108344049 0 Left 1108344045 13:49526864-49526886 CCAGGCAGGAGCTGGTAAAGCTT 0: 1
1: 0
2: 0
3: 15
4: 158
Right 1108344049 13:49526887-49526909 CCTGCGGCTTCTCTGCTCTTGGG 0: 1
1: 1
2: 1
3: 18
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108344045 Original CRISPR AAGCTTTACCAGCTCCTGCC TGG (reversed) Intronic
901849336 1:12005614-12005636 GGGCTCTACCAGCTACTGCCAGG - Intronic
903920931 1:26800145-26800167 AACCTTGTCCAGCTCATGCCAGG - Intergenic
904352233 1:29916029-29916051 AAGCTTTCCCTGATCCTACCAGG + Intergenic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
905450129 1:38050918-38050940 AAGCCCAAGCAGCTCCTGCCTGG - Intergenic
907771114 1:57464835-57464857 AATATTTACCTGCTCCTCCCAGG - Intronic
908249343 1:62252864-62252886 AAGCTGTGCAAGCTCCTGGCTGG + Intronic
909300192 1:74003077-74003099 AAGCCTTACCATCTTCTGCCTGG + Intergenic
910017563 1:82546417-82546439 GGGCTGTAGCAGCTCCTGCCAGG + Intergenic
912756016 1:112325416-112325438 CAGTTTTACCAGCTTCAGCCAGG + Intergenic
914717783 1:150266336-150266358 AAGCTTTACCAGGAGCAGCCTGG - Intronic
915079577 1:153342699-153342721 ATGCTTTCCAAGTTCCTGCCAGG - Intronic
915432649 1:155878546-155878568 AGGCTTTACCAGCTGATGCCTGG - Intronic
916868685 1:168888356-168888378 GACATTTTCCAGCTCCTGCCTGG + Intergenic
920982766 1:210853688-210853710 AAGATTTATCAGGTCTTGCCAGG + Intronic
924309650 1:242726863-242726885 AACAATCACCAGCTCCTGCCTGG - Intergenic
1063695937 10:8334923-8334945 AAGCTTTGCCACTTCCTTCCTGG - Intergenic
1066084049 10:31959778-31959800 AAGCTCTTCCAGCTCCCTCCAGG - Intergenic
1070689718 10:78515590-78515612 GCCCTTTACCAGCTCCTGCAGGG - Intergenic
1070745313 10:78930174-78930196 AAGCCCTCCCAGCCCCTGCCTGG - Intergenic
1070896489 10:79986828-79986850 AAGCTGTACCAGCAGCTGCTGGG + Intergenic
1072004556 10:91231806-91231828 AGCCATTACCATCTCCTGCCTGG - Intronic
1072142785 10:92604548-92604570 AAGCATTACCAGATACTACCTGG + Intronic
1073062606 10:100741505-100741527 AGGCCTGACCGGCTCCTGCCCGG - Intronic
1074304334 10:112262902-112262924 CATCTCTACCAGCTACTGCCCGG - Intergenic
1077993326 11:7431843-7431865 AAGGTTTAGCAGCTTCTGCCTGG + Intronic
1078262572 11:9724135-9724157 AAGCTTTTCCTGCTCATGCTAGG + Intronic
1080441196 11:32296194-32296216 CAGCTGCACCAGCTCCTGCTAGG - Intergenic
1081513382 11:43799873-43799895 ATCCTTTCCCAGCTCCTGCCTGG + Intronic
1083033726 11:59616683-59616705 TAGCTTTTCCAGCCCCTTCCTGG + Intergenic
1084526119 11:69699033-69699055 TAGCTTGCCCAGCTGCTGCCTGG - Exonic
1084879289 11:72158861-72158883 GAGCTTTACCAGCACCACCCAGG + Intergenic
1085449842 11:76625186-76625208 ACCCTTGACCAGCTCCTGCCTGG + Intergenic
1088487530 11:110355184-110355206 AGGCTTTTCCTTCTCCTGCCAGG - Intergenic
1089126487 11:116180062-116180084 AACCTTTACCACCTCCTCACGGG - Intergenic
1090539034 11:127679927-127679949 AGGCATTACCACCTCCTCCCCGG + Intergenic
1092127917 12:6088154-6088176 AAACTTCACCACCACCTGCCGGG - Intronic
1095973953 12:47926607-47926629 AAGCTACATCACCTCCTGCCTGG + Intronic
1096771678 12:53939434-53939456 CAGCTTCGCCAGCTCCTACCAGG + Exonic
1100648289 12:96555273-96555295 ATGCTTTACACGCCCCTGCCAGG - Intronic
1102667566 12:114588618-114588640 CAGCTTTACATGCTGCTGCCTGG + Intergenic
1102919828 12:116783513-116783535 AAGGTGGACCAGCTCCTGCAAGG + Intronic
1105618696 13:22046023-22046045 AACCTCTGCCAGCTCCTACCAGG - Intergenic
1107141152 13:36999749-36999771 AAGCCTTCCCAGCTCCCTCCAGG + Intronic
1107482656 13:40797843-40797865 AAGCTTTAAGAGCTCCTCTCAGG + Intronic
1107734905 13:43388768-43388790 AAATTTTACCAGCTCCTCCAAGG - Intronic
1108344045 13:49526864-49526886 AAGCTTTACCAGCTCCTGCCTGG - Intronic
1119591090 14:75888599-75888621 AAGCTATACCACCTATTGCCAGG - Intronic
1119691353 14:76675202-76675224 AAGATTTACCAGCGATTGCCCGG - Intergenic
1121683785 14:95816670-95816692 AAGCTTTGCCAGTAACTGCCAGG - Intergenic
1122617792 14:103032290-103032312 AGGCCTCACCAGCTCCTGACTGG + Intronic
1122745910 14:103897147-103897169 AGGCGTTACCACCTCCAGCCCGG + Intergenic
1125598871 15:40904714-40904736 CCGCCTTCCCAGCTCCTGCCTGG + Intergenic
1126738847 15:51757772-51757794 AAGCTTTTCCAGCTCATGGCTGG - Intronic
1128122608 15:65165039-65165061 AATATTAACCAACTCCTGCCGGG + Intronic
1128500583 15:68224638-68224660 AAGATTAATCAGCACCTGCCTGG + Intronic
1130898620 15:88190155-88190177 AAGCTTTTCCCGCTCCTCTCTGG + Intronic
1134598445 16:15514427-15514449 AGGCCTTGTCAGCTCCTGCCTGG - Intronic
1135062836 16:19285731-19285753 AGTCTGTCCCAGCTCCTGCCAGG + Intronic
1135417846 16:22282431-22282453 AAGCTTTATCACCTCCTCACAGG + Intronic
1138451968 16:57098421-57098443 TTGCTGCACCAGCTCCTGCCAGG - Intronic
1140562883 16:76004570-76004592 AAGGTTTGCCAACTCCTCCCTGG + Intergenic
1142469521 17:155621-155643 AAGGGTCGCCAGCTCCTGCCTGG + Intronic
1142862250 17:2769775-2769797 AAGCTTTTCCATCTACTGCCAGG + Intergenic
1144675369 17:17158355-17158377 CAGCATTGCCAGCTTCTGCCTGG + Intronic
1146762668 17:35492201-35492223 AAGGTTTATCAGCTTCTGCAAGG + Intronic
1146961765 17:36986306-36986328 AAGCTTGACAAACTCCTCCCCGG - Intronic
1148453679 17:47798573-47798595 AAGCTGAACCAGCTCCTAACTGG + Intergenic
1150717314 17:67583033-67583055 AAGTTTTAACAACTCATGCCTGG + Intronic
1155918242 18:31577201-31577223 AAGCTTTGCCATCTCCTAGCTGG - Intergenic
1158697849 18:59718612-59718634 CAGCTCTCACAGCTCCTGCCTGG - Intergenic
1158829279 18:61260087-61260109 AAGCCTTAGCAGGTCCTGGCAGG - Intergenic
1159375222 18:67584390-67584412 CATTATTACCAGCTCCTGCCTGG + Intergenic
1159411510 18:68081894-68081916 ACGGTTTACCAACTCCTGCTGGG + Intergenic
1161978731 19:7619823-7619845 CAGCTCTGCCAGCTCCTCCCGGG + Exonic
1163647883 19:18500497-18500519 AAGCTGTGCCAGGTCCTGCCTGG - Intronic
1164623498 19:29711867-29711889 CAGCTCTACCTGCTCCAGCCAGG + Intronic
1166131710 19:40749666-40749688 CAGCTTTACCATCCCCTCCCTGG - Exonic
1167000312 19:46741875-46741897 AAGCTTCAGCAGCTGCTGGCAGG + Intronic
1167470349 19:49672294-49672316 ACACTTGACCAGCTCCTGCCAGG - Intronic
925368010 2:3324364-3324386 TGGCTTTCCCAGCTCCTCCCGGG + Intronic
927920247 2:26966794-26966816 CACCTTTACCATCTCTTGCCTGG - Intergenic
929462616 2:42114533-42114555 AAGCTCTACCAGGTCCTCTCTGG - Intergenic
932628199 2:73315744-73315766 AAGGTATTCCAGCTTCTGCCTGG + Intergenic
936664673 2:114580610-114580632 TTACTTTGCCAGCTCCTGCCTGG + Intronic
939388761 2:141538388-141538410 AAGCTTTAACTGCTCTTTCCTGG + Intronic
940639846 2:156334031-156334053 AAGCCCTCCCAGCTCCGGCCGGG - Intronic
943096668 2:183437228-183437250 AAGCTGCACCACCTCTTGCCTGG - Intergenic
945810369 2:214542469-214542491 AAGCTTCTCCTGCTGCTGCCTGG + Intronic
947870854 2:233437141-233437163 AAGCATGACTGGCTCCTGCCGGG + Intronic
1169105520 20:2991056-2991078 AAGATTTACCACATCCTGCCAGG + Intronic
1173474107 20:43346571-43346593 AATCTTTGCCAGGTCCTGCAGGG + Intergenic
1174149492 20:48476141-48476163 AAGCAGCACCAGCTCCTCCCTGG + Intergenic
1178678737 21:34653731-34653753 AATCTGAACGAGCTCCTGCCTGG - Intergenic
1178862146 21:36298390-36298412 CTGCTAAACCAGCTCCTGCCAGG + Intergenic
1180761876 22:18216788-18216810 GAGTTTTGCCACCTCCTGCCTGG - Intergenic
1180773791 22:18407822-18407844 GAGTTTTGCCACCTCCTGCCTGG + Intergenic
1180805143 22:18657366-18657388 GAGTTTTGCCACCTCCTGCCTGG + Intergenic
1180805603 22:18712042-18712064 GAGTTTTGCCACCTCCTGCCTGG - Intergenic
1181069850 22:20326537-20326559 GAGTTTTGCCACCTCCTGCCTGG + Intergenic
1181107918 22:20585619-20585641 AAGCTTCACCAGAACCTCCCTGG + Intronic
1181192893 22:21154747-21154769 GAGTTTTGCCACCTCCTGCCTGG + Intergenic
1181216549 22:21337827-21337849 GAGTTTTGCCACCTCCTGCCTGG - Intergenic
1183402569 22:37613282-37613304 GAGGTGTACCAGCTCCAGCCTGG + Intronic
1203235623 22_KI270731v1_random:148796-148818 GAGTTTTGCCACCTCCTGCCTGG + Intergenic
950162113 3:10768141-10768163 AAGCTTTAAAAGCTGTTGCCTGG + Intergenic
950530755 3:13551090-13551112 ATGCCTTCTCAGCTCCTGCCTGG + Intronic
950721880 3:14889058-14889080 TAGCTGCACCAGCTCCTGCAGGG + Intronic
953386615 3:42509896-42509918 AGGCTTCATCAGTTCCTGCCTGG + Intronic
953423507 3:42773127-42773149 GGGCTTTCCCAGCTCCGGCCCGG + Intronic
956653090 3:71523184-71523206 AAACATTGCCAGCCCCTGCCAGG + Intronic
962310990 3:134326831-134326853 ATGTTATACCAGCTCCTGCCCGG - Intergenic
965216816 3:165874517-165874539 AAGCCTACCCAGCTCCTGGCTGG + Intergenic
965648244 3:170908002-170908024 AAACTTTTCCAGCTACTGCTTGG + Intronic
967744504 3:193039970-193039992 ATACTTTCCCAGCTCCTACCAGG + Intergenic
969247178 4:5943096-5943118 AAGTTTTCCAAGATCCTGCCTGG - Intronic
969289470 4:6229485-6229507 CAGCATTATCAGCTCCTGCCAGG - Intergenic
969889099 4:10243219-10243241 AAGCTTTGCCAGCTTCTGTGGGG + Intergenic
977259810 4:94784960-94784982 AAGCTTCACCAGCAGCTGCTTGG + Intronic
982405185 4:155011699-155011721 AAACTTTACCAGCTCACCCCTGG + Intergenic
984490370 4:180426989-180427011 AAGCTGCACCACCTCCTGGCTGG + Intergenic
987051792 5:14153255-14153277 AATCTTTAACAGCAGCTGCCAGG + Intronic
989398218 5:40981279-40981301 GAGCTGTAGAAGCTCCTGCCTGG - Intronic
989526547 5:42460013-42460035 AACTTTTACCAGCTCCTCACAGG - Intronic
996605257 5:125313701-125313723 CAGCTGCTCCAGCTCCTGCCTGG - Intergenic
997159288 5:131590103-131590125 AAACTTTACCTGCTCAGGCCAGG + Intronic
997349335 5:133219235-133219257 AACCTTCTCCAGCTCCTGCTTGG + Intronic
997425443 5:133799691-133799713 AGGCGTTACCAGCTGCAGCCTGG - Intergenic
997658077 5:135569911-135569933 GAGCTGTTCCTGCTCCTGCCAGG - Intergenic
999117440 5:149176179-149176201 AGGCTTTACCTGCCCATGCCAGG + Intronic
1000005158 5:157176356-157176378 TAGCTGTTCCAGCTCCTGTCGGG - Intronic
1000219107 5:159194769-159194791 AAGCTGAACCAGATGCTGCCTGG + Exonic
1001289557 5:170447125-170447147 GAGCTTTCCCAGCTCCTACTGGG - Intronic
1006149634 6:31979806-31979828 AAGCTTTTACACTTCCTGCCAGG - Intronic
1007421231 6:41720932-41720954 AAGCATGGGCAGCTCCTGCCAGG + Intronic
1007642801 6:43356109-43356131 CAGCAGTACCAGCTCCAGCCAGG - Exonic
1007778148 6:44235373-44235395 TTGCTTTACCACCTCCTGCCTGG + Intergenic
1012945991 6:105466315-105466337 AAGCTTTTCCAGCTTCTATCTGG + Intergenic
1013557981 6:111276637-111276659 AAGCTGTACCTGCTACTGCAAGG - Intergenic
1017009784 6:150055458-150055480 CAGCATCACCAGCTCCTCCCTGG + Intergenic
1018391153 6:163343008-163343030 AACCGGTACCAGCTCCTGCTGGG + Intergenic
1018736571 6:166691094-166691116 AAGCGTTGCCAACTCATGCCGGG + Intronic
1022514386 7:30966040-30966062 CAGCTCTGCCATCTCCTGCCTGG - Intronic
1023601696 7:41887114-41887136 AAGCTAGACTAGCCCCTGCCGGG + Intergenic
1024621126 7:51158686-51158708 ATTCTTTTCCAGCTCCTCCCTGG - Intronic
1028993506 7:97075584-97075606 AAGTCTAACCAGCTCCTGGCTGG + Intergenic
1030321350 7:108171605-108171627 AAGCTTTTCCTGATCCTGCTTGG + Intronic
1031371405 7:120971396-120971418 AACCTTTACCACCTCCTCACAGG + Intronic
1031809525 7:126348251-126348273 AACCTTTGCCAGCTCCTCACAGG + Intergenic
1034116334 7:148587058-148587080 AAGCAGTAACAGCCCCTGCCTGG - Intergenic
1034508708 7:151518087-151518109 CAGCTTTAACAGCTGCAGCCAGG - Intronic
1035169983 7:157011627-157011649 AGCCTTTCCCCGCTCCTGCCCGG - Intergenic
1037293852 8:17380422-17380444 AAACTTTCCCAGATCCTGCAGGG + Intronic
1041691862 8:60694986-60695008 AAGCTCTACCACCTCCTGGTTGG - Intronic
1044165755 8:88982014-88982036 AACCTTTACCACCTCATGTCAGG + Intergenic
1044251566 8:90008918-90008940 AAGCATCACCATCTCTTGCCTGG + Intronic
1048588332 8:135796920-135796942 AATCTTTACAAGCGCCTGCCTGG + Intergenic
1050786146 9:9404326-9404348 AACCACTACCAGCTCTTGCCTGG - Intronic
1051782267 9:20702640-20702662 AAGCTTTGACAGTACCTGCCTGG + Intronic
1053391850 9:37741544-37741566 CAGCTCTCCCAGCTCCTGGCAGG - Intronic
1053529014 9:38859803-38859825 AAGCTGTACCAGCTCTTTCATGG - Intergenic
1054201242 9:62084238-62084260 AAGCTGTACCAGCTCTTTCATGG - Intergenic
1054637117 9:67504126-67504148 AAGCTGTACCAGCTCTTTCATGG + Intergenic
1057138759 9:92714166-92714188 AAGCTTTCCCAGCACCGGGCTGG + Exonic
1057989843 9:99757359-99757381 AAGATTTATCATCTCCTGCGGGG - Intergenic
1060993346 9:127861591-127861613 AAGCTTCTTCAGCACCTGCCAGG - Intergenic
1062474942 9:136722216-136722238 AAACAGTACCAGCTCCCGCCGGG - Exonic
1186247427 X:7629129-7629151 AAGCTTTAGTAGCCCCTGCATGG - Intergenic
1186261794 X:7787921-7787943 AAGCTTTACCCCTTCCAGCCTGG - Intergenic
1190404308 X:50071146-50071168 AAGCCTTTCCAGCTCCTGACTGG + Intronic
1192429619 X:71103300-71103322 CAGGTTTACTAGCACCTGCCAGG + Exonic
1192808743 X:74531768-74531790 AAGCTTTCCCAGATCCTGGGAGG - Exonic
1200049099 X:153419281-153419303 AAGCTGCCCCAGCTCCTCCCGGG - Intronic
1200108478 X:153726904-153726926 AACCTTTCCCAGCGCCTGTCTGG - Intronic