ID: 1108344095

View in Genome Browser
Species Human (GRCh38)
Location 13:49527308-49527330
Sequence AGTCAAACAGCATTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 128, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108344089_1108344095 6 Left 1108344089 13:49527279-49527301 CCACACACAGCTGGGCAGGCCGG 0: 1
1: 1
2: 2
3: 33
4: 259
Right 1108344095 13:49527308-49527330 AGTCAAACAGCATTGGTGGATGG 0: 1
1: 0
2: 2
3: 128
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108344095 Original CRISPR AGTCAAACAGCATTGGTGGA TGG Intronic
904149279 1:28423860-28423882 ATTCAAACAGAATTGGGAGAAGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907846465 1:58212872-58212894 AGACAAACAGAGCTGGTGGAGGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
909332105 1:74425831-74425853 AGTCACACAGCATTGACGAAGGG + Intronic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910258259 1:85271448-85271470 AGTGAATCAGTCTTGGTGGAAGG + Intronic
910391756 1:86752813-86752835 ATTCAAACAGCCTGGGTAGAAGG - Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
911157279 1:94648909-94648931 AGTCAAACAGCTTTTGTGTCTGG - Intergenic
911328688 1:96499792-96499814 AGTAAAGAAGCATTGCTGGAGGG - Intergenic
912137833 1:106683028-106683050 AGTCAAAGAACATTGGGGCACGG - Intergenic
914825495 1:151135918-151135940 AGGTAAACCGCATTGGTGGGAGG - Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917472539 1:175337852-175337874 AGTCTAACAACAGTTGTGGAAGG - Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920477668 1:206292362-206292384 AGTCACACAGCAAGGGTAGAAGG + Intronic
920595824 1:207268936-207268958 AGCAAATCAGCATTGATGGATGG - Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921279921 1:213556524-213556546 AGAAGAACAGAATTGGTGGATGG + Intergenic
921496433 1:215847668-215847690 AGTTAAACAGCATTAGTCCAAGG + Intronic
921937292 1:220806861-220806883 AGTCAAACAGGGTGGGTGGAGGG + Intronic
922489365 1:226003284-226003306 AATGAAACAGCATTGTTTGATGG - Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923731736 1:236557810-236557832 AGTCAAAAAGCAGTGGGTGAAGG - Intronic
1062955771 10:1539401-1539423 AGGCACACAGCACTGGTCGATGG - Intronic
1063257160 10:4340881-4340903 AGTCCAGCAGCACTGGTGGTGGG + Intergenic
1064550175 10:16492590-16492612 AGTAAAACAGCATGGCTGGCAGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1065937882 10:30536964-30536986 GGTCTTACAGCATTGTTGGAGGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1070170664 10:73930346-73930368 AGTCAAGCAGTAGGGGTGGAAGG + Intergenic
1070400944 10:76053090-76053112 TATCAAACAGCAATGGTTGAAGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1071651919 10:87400314-87400336 AATCACACAGCATTGGTGATGGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1072967228 10:99984166-99984188 AATGAAACTGCACTGGTGGAGGG + Intronic
1073597440 10:104815061-104815083 AGACAAACAGCACTGATGGAAGG + Intronic
1074799696 10:116987127-116987149 AGCCTAACAGACTTGGTGGAAGG + Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075623022 10:123941472-123941494 AGTCATACAGGAGTGGTGGTGGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080721560 11:34854231-34854253 AGTGAAACAGAATGGGTGGAGGG + Intronic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081243428 11:40734555-40734577 ATTGAAATGGCATTGGTGGAGGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1087305480 11:96484646-96484668 AGTCAAAAAGCAGAGGAGGAGGG - Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088635849 11:111819866-111819888 AGTCAAAAAGTATTTGCGGAAGG + Intronic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1090304049 11:125674995-125675017 AGTCATACAGCAATGGTTGATGG - Intronic
1090428679 11:126628233-126628255 AGTCTGACAGGATTGGTGGGTGG - Intronic
1092776278 12:11947415-11947437 AGTCAAACAGCTTGTGTGGTGGG + Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095275028 12:40271478-40271500 AGTAAAAAAGCATAGGTGGTAGG + Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1095938706 12:47711850-47711872 AGTCAGACAGTATTTGTTGAGGG + Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096686777 12:53293197-53293219 AGGAAAACACCATTGGTGGTGGG - Intronic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099149113 12:79086712-79086734 TGTCAAATATCATTGGTGCAAGG + Intronic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1102199894 12:111049968-111049990 GGTCCAACAGCATAGGTGGGTGG - Intronic
1102221932 12:111200736-111200758 AGTCCAGCAGAATTGGTGGGGGG + Intronic
1102462427 12:113108141-113108163 GGTCAAACAGCTTTGGGGTAAGG + Exonic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1105249030 13:18679564-18679586 ACTAAAACAGTTTTGGTGGAGGG + Intergenic
1108344095 13:49527308-49527330 AGTCAAACAGCATTGGTGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109493252 13:63131717-63131739 AGTCAAATAGAACTGGTGGAAGG - Intergenic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110027078 13:70553889-70553911 AGTCAGTCAGCATTGCTAGAAGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112897833 13:104322978-104323000 AGCCAAATAGCATTGGCAGATGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114390319 14:22301150-22301172 AGGCAAAAAGCAATGTTGGATGG + Intergenic
1114404098 14:22438883-22438905 ACAAAAACAGCATTGGTGAAAGG + Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116805495 14:49490449-49490471 AGTGAAAAAGAATAGGTGGATGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117812312 14:59560756-59560778 ACTCTAACAGCATGGGTAGATGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1123999441 15:25742526-25742548 AGTCAAAAAGCCTCGGTAGATGG + Intronic
1124031461 15:26016168-26016190 ACTCCACCATCATTGGTGGAGGG + Intergenic
1124814473 15:32975341-32975363 AATCAATAAGCATTTGTGGATGG - Intronic
1124897267 15:33788774-33788796 AGTCAGGCAGTATTGGTTGAAGG - Intronic
1125584311 15:40809478-40809500 AGACAAAGAGCATTGGGGAAAGG + Intronic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127280656 15:57488635-57488657 AGTCAAGCTGCATTAGTTGACGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128395589 15:67222283-67222305 AGTCAGGCAGCATGGGTGGAGGG - Intronic
1129232347 15:74203795-74203817 AGTCCAAGAGCATTTGGGGATGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129960765 15:79682046-79682068 AGTCATCCAGCACTGGGGGATGG + Intergenic
1130931650 15:88432699-88432721 GTTCAAACAGCCTTGCTGGATGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131743058 15:95415415-95415437 ACTCAAACATCAGTGCTGGAGGG - Intergenic
1131771000 15:95737142-95737164 AGCCCAAAAGGATTGGTGGAGGG + Intergenic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1138365481 16:56472895-56472917 AGCAAAACTGCTTTGGTGGAAGG - Intronic
1139106134 16:63828988-63829010 AGTAAAACAACAATTGTGGATGG - Intergenic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1143434790 17:6915360-6915382 AGTCAGACAGCTTTGGTGCATGG + Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148863852 17:50618557-50618579 TGTCACAGAGCATTGGAGGATGG - Intronic
1149173955 17:53846828-53846850 AGTCAAAGAGCCTCGCTGGATGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149813526 17:59701534-59701556 GGTCAATCAGTATTTGTGGAAGG - Intronic
1150355930 17:64484643-64484665 AGTCAAACAGGATTTGCTGATGG + Intronic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152101339 17:78303572-78303594 AGTCACACGGCATTTGTGCACGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157815229 18:50725240-50725262 AGGCAGACAGCCTTGATGGATGG - Intronic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1159546627 18:69847103-69847125 AGTTAAACAGAATTGTTAGAGGG - Exonic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165926091 19:39327208-39327230 AGGAAAACAGCACTAGTGGAGGG + Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
927196316 2:20549860-20549882 AACCAAATACCATTGGTGGAAGG - Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929536824 2:42789000-42789022 AGTCAGACAGCATGGGTGAGTGG - Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934696009 2:96400611-96400633 TGTCCACCAGCATTGGTGGGGGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937187525 2:120058562-120058584 GATCAAAAAGGATTGGTGGAGGG + Intronic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937857804 2:126685294-126685316 AGCCAGACAGCAATGGGGGAAGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943734014 2:191333959-191333981 AGTCAAATAGGATGGGGGGAGGG - Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945095230 2:206212918-206212940 AGTCAAACATCATTTGTGGAAGG - Intronic
948087529 2:235263983-235264005 TGTCACACAGCCCTGGTGGATGG - Intergenic
948145000 2:235702128-235702150 AGCCAAACAGAATTGGGGGCTGG + Intronic
1168890270 20:1291172-1291194 AGGCAACCAGCATAGGTTGAGGG - Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172342710 20:34171179-34171201 AATCAAACATGATTTGTGGATGG - Intergenic
1172399504 20:34637626-34637648 AGTCAAAAAGCATTTGTGAAGGG + Intronic
1172487451 20:35306916-35306938 AGTCACACAGTAGAGGTGGAAGG + Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173373974 20:42466339-42466361 AATTAAAAAGCATAGGTGGAAGG + Intronic
1173516767 20:43669827-43669849 TATCAAACAGCATTGGAGGCTGG + Intronic
1174305714 20:49612984-49613006 AGTCTCACACCATTGCTGGAAGG - Intergenic
1177112877 21:17049558-17049580 AGCCACCCAGTATTGGTGGAAGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177722162 21:24920914-24920936 AGACCAACAGCATAGGTGAAGGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178397806 21:32258150-32258172 ACTCAGAAAGCATTGGGGGAGGG + Intergenic
1178772581 21:35519459-35519481 AGTCAAAGAGCTTTGGGGCAAGG + Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1183121159 22:35731327-35731349 AGTTATACAGAATTGTTGGATGG + Intergenic
1185038820 22:48493920-48493942 AGTGAAAGAGCAGGGGTGGAAGG - Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950396085 3:12735089-12735111 AGTCACACAGCTTTAGTGGCTGG - Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952726751 3:36594679-36594701 AGACACACAGCATTGGGGAAAGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
955087754 3:55719857-55719879 ATGCAAACATCATTGTTGGATGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955563002 3:60213254-60213276 AGACAAACAGAATTGGGAGACGG - Intronic
955747997 3:62158956-62158978 ATATAAACAGCGTTGGTGGAAGG + Intronic
956061743 3:65355370-65355392 AGGCAATGAGCCTTGGTGGAAGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
959122703 3:102252064-102252086 TGTCAAACAACTTTGTTGGATGG - Intronic
959135065 3:102408170-102408192 AGGAAAACAACATTGGTGTAAGG - Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959361291 3:105395999-105396021 AGTCAACTAACATTGGAGGAGGG + Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960088077 3:113611844-113611866 AGCCAAATAGCAATGGTGAAGGG - Intronic
960287605 3:115847163-115847185 AATCAAACAGCTTTGGTGAGTGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
965059351 3:163763971-163763993 AGTCAAAAACCACTGGTGAAGGG + Intergenic
966058280 3:175723775-175723797 AGTCAATCAGTCTTGATGGAAGG - Intronic
966786856 3:183630244-183630266 AGTTGAAAAGCATTGGTGAATGG - Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969552552 4:7880636-7880658 AGTCACAAAGCATTGGTAAAGGG + Intronic
969912526 4:10458973-10458995 AGTCACACAGAATTGATGTAAGG + Intergenic
970824756 4:20256112-20256134 ATACAAACAGAATTGTTGGAAGG + Intronic
971435339 4:26616263-26616285 AGTCAAATAGCATTGGATCAGGG + Intronic
972225020 4:37002400-37002422 AATCATACAGTATTGGTGTAAGG - Intergenic
972532651 4:39975484-39975506 AATCAATCAGAATTGGTGGGAGG - Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975613838 4:76226673-76226695 ACTTAAACAGTATTGGTAGAAGG - Intronic
977174016 4:93797559-93797581 ACTCAAAAAGCATTTGTGGTAGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979741623 4:124158331-124158353 AGTGAAGCAGCATTCATGGATGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
986266645 5:6196790-6196812 ACTCAAACAGCGTTGGAGGCTGG - Intergenic
986578201 5:9234705-9234727 ACTCAAACCGCATTTGTGAATGG - Intronic
987144670 5:14980772-14980794 AGTCCAACAGCAATTGTGGAGGG - Intergenic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988939282 5:36126504-36126526 GGTCAGACAGCATTCGTGAAGGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
993959654 5:94281452-94281474 ATTCAGACTGCATTGGTGCAGGG - Intronic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG + Intergenic
999707629 5:154288175-154288197 GCTCAAACAGCAATGTTGGAAGG - Intronic
1000393672 5:160750595-160750617 AGCCAAACAGTGATGGTGGAGGG - Intronic
1001200110 5:169708234-169708256 AGTCAAACAGCCACGCTGGATGG + Exonic
1002053554 5:176585613-176585635 AGTCACACAGCAATAGTGGTGGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004304292 6:14486681-14486703 CGTAAAACAGCACTGGTAGATGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005533559 6:26732860-26732882 GGACCAACAGCATTGTTGGAGGG + Intergenic
1005535091 6:26746816-26746838 GGACCAACAGCATTGTTGGAGGG - Intergenic
1005537236 6:26768794-26768816 GGACCAACAGCATTGTTGGAGGG - Intergenic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008591141 6:52994976-52994998 AGTCTGAATGCATTGGTGGAAGG - Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015012163 6:128362747-128362769 AATAAAATAGCATTGGTGAATGG + Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1015732698 6:136364362-136364384 GCTGGAACAGCATTGGTGGAGGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016485610 6:144534899-144534921 AGTAAAACAGCAGAGGTGGGAGG + Intronic
1017193315 6:151676123-151676145 AGTCAAAGAGCAAAGGTGCAGGG + Intronic
1018237033 6:161736591-161736613 TGTCAACCAGGATTGTTGGAAGG + Intronic
1018614150 6:165670096-165670118 AGCCACACACCAATGGTGGACGG + Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023215383 7:37856958-37856980 AGTGAGACAGAATTGGAGGAAGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030189617 7:106797097-106797119 AGTCAGAAAGCATTGGTATATGG + Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1033556919 7:142496181-142496203 AGGCAATAAGCAATGGTGGAGGG - Intergenic
1033559265 7:142515630-142515652 AGACAATAAGCAATGGTGGAGGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037761080 8:21742113-21742135 AGCCAAACAGGCTTGATGGAGGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1041096069 8:54351456-54351478 AAGCAAACAGTATGGGTGGAGGG - Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1044381508 8:91539581-91539603 AAACAAACAGCACTGGGGGATGG - Intergenic
1044711533 8:95063304-95063326 AGGAAAACAGTATTTGTGGAGGG - Intronic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045909823 8:107393951-107393973 AGTCAAAATGCATTAGTGGCAGG - Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1051320395 9:15898004-15898026 AGTCTTACAGCATTATTGGAAGG + Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1059067999 9:111105344-111105366 TGACAATCAGTATTGGTGGAGGG - Intergenic
1061900485 9:133669681-133669703 AGTCACACGGCAGAGGTGGAAGG - Intronic
1186045753 X:5534958-5534980 ACTCAAACAGCATACGTGGAAGG + Intergenic
1186158373 X:6749900-6749922 AGGCAAAAATCATTGCTGGAAGG - Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189954702 X:46265321-46265343 GCTCAAAGAGCAGTGGTGGAGGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191593312 X:62912931-62912953 ACTCAACCAGCACTGATGGATGG - Intergenic
1192176562 X:68889860-68889882 AGTTAGAAAGCATTGGTTGATGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196008787 X:110864242-110864264 AGGCCATCAGCATTGTTGGAGGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198080306 X:133233560-133233582 ATTCAAGCAGGGTTGGTGGATGG - Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1201905226 Y:19080314-19080336 TGGCAAAGAGCATTGCTGGATGG - Intergenic