ID: 1108347234

View in Genome Browser
Species Human (GRCh38)
Location 13:49558326-49558348
Sequence AACCCTGAACTGGAACAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 1, 2: 15, 3: 84, 4: 249}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108347230_1108347234 1 Left 1108347230 13:49558302-49558324 CCAGAAGAGGCTGTGGCCACATG 0: 1
1: 0
2: 2
3: 16
4: 234
Right 1108347234 13:49558326-49558348 AACCCTGAACTGGAACAAACGGG 0: 1
1: 1
2: 15
3: 84
4: 249
1108347226_1108347234 18 Left 1108347226 13:49558285-49558307 CCTGGTGTCCTGCGCTGCCAGAA 0: 1
1: 0
2: 2
3: 18
4: 152
Right 1108347234 13:49558326-49558348 AACCCTGAACTGGAACAAACGGG 0: 1
1: 1
2: 15
3: 84
4: 249
1108347224_1108347234 22 Left 1108347224 13:49558281-49558303 CCCACCTGGTGTCCTGCGCTGCC 0: 1
1: 0
2: 3
3: 32
4: 263
Right 1108347234 13:49558326-49558348 AACCCTGAACTGGAACAAACGGG 0: 1
1: 1
2: 15
3: 84
4: 249
1108347225_1108347234 21 Left 1108347225 13:49558282-49558304 CCACCTGGTGTCCTGCGCTGCCA 0: 1
1: 0
2: 4
3: 30
4: 240
Right 1108347234 13:49558326-49558348 AACCCTGAACTGGAACAAACGGG 0: 1
1: 1
2: 15
3: 84
4: 249
1108347228_1108347234 10 Left 1108347228 13:49558293-49558315 CCTGCGCTGCCAGAAGAGGCTGT 0: 1
1: 0
2: 3
3: 29
4: 186
Right 1108347234 13:49558326-49558348 AACCCTGAACTGGAACAAACGGG 0: 1
1: 1
2: 15
3: 84
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108347234 Original CRISPR AACCCTGAACTGGAACAAAC GGG Intronic
902131620 1:14266606-14266628 GACCCTGAACTGGAATAAATGGG - Intergenic
904021973 1:27473810-27473832 GACCCTGAACTGGAATAATTAGG - Intronic
905850885 1:41273848-41273870 AAGGCTGAACAGGAACCAACTGG - Intergenic
906860584 1:49354862-49354884 TACCCTGAACTGGAATAAGCTGG - Intronic
906994400 1:50775732-50775754 ATCCTTGAACTGTAACAAAGGGG + Intronic
907983507 1:59507937-59507959 AACAGAGAACTGGAACAGACGGG - Intronic
908565900 1:65355859-65355881 AACCCTGAAATGGAACAGCATGG + Intronic
908589926 1:65619635-65619657 CACCCTGCACTTGAACAAATTGG + Intronic
909467427 1:75988484-75988506 GACCCTGAACTGGAATAAGCAGG + Intergenic
910099246 1:83559046-83559068 AACCCTGAACTTGCAGAATCAGG - Intergenic
910763531 1:90758488-90758510 AACCCTGACCTACAACAGACAGG - Intergenic
911958865 1:104272962-104272984 AACACTTAACTTGAAGAAACAGG - Intergenic
913267722 1:117060816-117060838 AACCCAGAGCTGGAAAACACCGG - Intronic
915564466 1:156706030-156706052 AACCCTGAACTGGATCCAGTGGG + Intergenic
916520534 1:165559868-165559890 AACCCTGAACTGAAATAATTAGG - Intronic
917432961 1:174989917-174989939 AACCCTGAACTCTATCAAAACGG + Intronic
917752241 1:178064566-178064588 CACCCTGAACTGGAATAAGCAGG - Intergenic
918264871 1:182832455-182832477 AACCTTAAAATGGTACAAACTGG - Intergenic
918494237 1:185115400-185115422 TACCCTGAACTGGAATAAGCAGG + Intergenic
918861536 1:189832674-189832696 AACCCTGAACTGGAATAAGAAGG - Intergenic
919353896 1:196496675-196496697 CACCCTGAACTGGAACAAGTGGG - Intronic
921123513 1:212157060-212157082 GATCCTGAACTGGAATAAGCGGG + Intergenic
921617908 1:217293039-217293061 AACCCTGAACTGGAATAAGCAGG + Intergenic
921809147 1:219492004-219492026 AACCCTCACCTGGAACCAAATGG - Intergenic
921856731 1:219994373-219994395 AACCCTGAACTAGAATAAATGGG + Intronic
923275537 1:232392440-232392462 AGCCATGAAATGGAACAAAATGG + Intergenic
923327245 1:232891141-232891163 CACTGTGAACTGGAACAAAATGG - Intergenic
923944122 1:238863331-238863353 AACCCTGAAGTGGAACAAGAGGG + Intergenic
924105827 1:240648237-240648259 AAAGCTCTACTGGAACAAACAGG - Intergenic
924183024 1:241458336-241458358 GACCCTGAACTGGAATGAATGGG - Intergenic
924317243 1:242811118-242811140 AACCCTTAACTGAAATAAGCAGG - Intergenic
924422114 1:243919296-243919318 AATCCTGAACTGGAATAATCAGG - Intergenic
924489302 1:244519700-244519722 AACCCTGAACTGGAATAAGCAGG + Intronic
1062869673 10:889263-889285 TACCCTGAACTGGAATAAGCAGG - Intronic
1065565414 10:27002604-27002626 GACCCTGAACTGGGATAAGCAGG + Intronic
1066195172 10:33092070-33092092 GACTCTGAACTGGAATAAATGGG + Intergenic
1066610591 10:37244098-37244120 AAACCTGAACTGCAATAAGCAGG - Intronic
1069297251 10:66861534-66861556 GACCCTGAACTAGAATAAGCAGG + Intronic
1069334786 10:67335327-67335349 AACCCTGAACAGGAATAAGCAGG + Intronic
1072553449 10:96496355-96496377 AACCCTTAGCTGGAACAAATGGG - Intronic
1072827828 10:98626414-98626436 AACCCTGAACTGGTATAAGCGGG - Intronic
1074660936 10:115656591-115656613 CACCCTGAACTGGAATAAGTTGG + Intronic
1078583746 11:12561829-12561851 GACCCTGAACTGCAATAAATGGG - Intergenic
1079417732 11:20255177-20255199 CACTCTGTACAGGAACAAACTGG + Intergenic
1082675811 11:56100755-56100777 AACTCTGAACCTGAACAAAATGG + Intergenic
1082677179 11:56119500-56119522 AACTCTGAACCTGAACAAAATGG + Intergenic
1082701573 11:56438497-56438519 CGCCCTGAACTGGAATAAGCAGG - Intergenic
1085213457 11:74804293-74804315 AACCCTGAACTGGAATAAATAGG + Intronic
1085561721 11:77477951-77477973 AACCCTGAACTGGAAAAATTGGG - Intergenic
1087550548 11:99641915-99641937 AACCCTCAACTGAACCAAAGAGG - Intronic
1087945079 11:104149710-104149732 ACCCTGGAACTGGAATAAACGGG - Intronic
1088404577 11:109459342-109459364 AACCCTGAACTGGAATAACTGGG + Intergenic
1090714608 11:129419184-129419206 ACCCCTGAACTGGAAAAACTGGG + Intronic
1091680490 12:2523360-2523382 AACCCTGAACTGAAGGAAATCGG - Intronic
1092045389 12:5428901-5428923 AACACTGAACAGAAACAAAACGG - Intergenic
1092681670 12:10989205-10989227 AGCCATGAACAGGAACATACAGG - Intronic
1093656120 12:21695589-21695611 AACCCCGAGCTGGAATAAATGGG + Intronic
1093866632 12:24235003-24235025 AACCCTGCACTACAATAAACTGG + Intergenic
1095658274 12:44697238-44697260 AACCCTGAACTGAAATAAGTGGG - Intronic
1098141621 12:67455567-67455589 GACCCTGAACTGGAATAACTGGG + Intergenic
1098291033 12:68956889-68956911 ATAGGTGAACTGGAACAAACAGG - Intronic
1099277581 12:80597319-80597341 AGCTCTGCATTGGAACAAACTGG - Intronic
1100452025 12:94716404-94716426 AACCCTGAACTGGAATAACTGGG - Intergenic
1101608632 12:106269965-106269987 AACCTTGAACTGGAATAATTGGG - Intronic
1103132709 12:118482822-118482844 GACCCTGAGGTGGAACAAAAGGG + Intergenic
1106577423 13:30988415-30988437 AACCCCAAACTGGCACAAATTGG - Intergenic
1106774560 13:32996390-32996412 AACTCTGAAATGGAATAAGCAGG - Intergenic
1108347234 13:49558326-49558348 AACCCTGAACTGGAACAAACGGG + Intronic
1109613219 13:64793899-64793921 AACCCTGAAATGGAATAATTGGG + Intergenic
1109690271 13:65879187-65879209 AACCCTGAACTGGAGTAACTGGG - Intergenic
1109886151 13:68547711-68547733 GACCCTTAACTGGAATAAGCAGG + Intergenic
1110603822 13:77408274-77408296 AATTCTGAACTGGAATAAGCAGG - Intergenic
1111620501 13:90718687-90718709 CATACTGAACTGGAATAAACGGG - Intergenic
1115405517 14:33011268-33011290 AACCCTGAATTTGAATAAGCGGG - Intronic
1115657068 14:35453491-35453513 GACCCTGAACTAGAATAAGCAGG + Intergenic
1116053240 14:39831302-39831324 AACCCTGAATTGGAATAAGTAGG - Intergenic
1116122176 14:40735003-40735025 AAATCTGAACTGGAATCAACAGG + Intergenic
1116655693 14:47650665-47650687 AACCTTGAACTGGAATAAGCAGG + Intronic
1117387660 14:55232260-55232282 TACCCTGAACTGGAATAAGACGG - Intergenic
1118403155 14:65397716-65397738 GATCCTGAACTGGAATAAATGGG + Intergenic
1120152182 14:81048589-81048611 GACCCTGAGCTGGAATAAGCAGG + Intronic
1122282330 14:100630588-100630610 AACACTGAACTGGGGCAAAATGG + Intergenic
1125155856 15:36584609-36584631 AATCCTAAACTGGAATAAGCGGG - Intronic
1126341755 15:47648452-47648474 AACCCTGAACTGGAATAACTGGG + Intronic
1126907122 15:53379761-53379783 ACCTCTGATCTGGAACATACAGG + Intergenic
1127085453 15:55420442-55420464 TATCCTGAACTGAAACCAACAGG - Intronic
1127253327 15:57265489-57265511 GACCCTGAACTGGAATAATTGGG + Intronic
1127629702 15:60815479-60815501 AGCACTGAACTTGAACAAAGTGG + Intronic
1129494593 15:75966296-75966318 GACTGTGAACTGGAAAAAACTGG + Intronic
1129567194 15:76635139-76635161 GACCCTGAACTGGAATAATTGGG - Intronic
1129800982 15:78414103-78414125 CACCCTGAACTGGAATAAGCAGG - Intergenic
1130851573 15:87799723-87799745 AACCCTGAACCGGAATAATCAGG + Intergenic
1133522895 16:6576180-6576202 AAGCCTGAACTGGAATAAGCAGG - Intronic
1135596263 16:23745678-23745700 ATCCCTGAACTAAAACAAACTGG - Intergenic
1135689282 16:24523125-24523147 GACCGTGAACTGGAATAAACAGG + Intergenic
1137235263 16:46611245-46611267 AACCCTGAACTGGAATAAGCAGG + Intronic
1137344632 16:47644958-47644980 AACACTGAAGAGGAGCAAACTGG + Intronic
1137695658 16:50460539-50460561 CCCCCTGAACTGGCACAAATTGG - Intergenic
1137893891 16:52190383-52190405 AAACCTGGACTGGACCAATCAGG - Intergenic
1138022798 16:53500080-53500102 AACCCTTAACTAGAAAAACCAGG + Intronic
1138955287 16:61964267-61964289 AACCCTGAACTGGAATAATTGGG - Intronic
1139104754 16:63815314-63815336 GACCCTGAACTGAAATAAGCGGG - Intergenic
1144407397 17:14965302-14965324 GACCCTGATCTGCAACTAACTGG - Intergenic
1147933322 17:43996368-43996390 AACTCTGAACTAGAACCACCAGG + Intronic
1148881244 17:50729463-50729485 CACCCTGAACTGGAATAAGGAGG - Intronic
1149692180 17:58587004-58587026 GACCCTGAACTAGAATAAACAGG + Intronic
1149878166 17:60259536-60259558 TAACCTGAACTGGAATAAGCGGG + Intronic
1150930447 17:69579096-69579118 AAACCTGACTTGGAACAGACAGG - Intergenic
1154054888 18:11003558-11003580 AACCCTGAACTAGAATAAGTGGG - Intronic
1154312981 18:13281850-13281872 AACCCTGAAGTTGAAGAATCGGG - Intronic
1155293126 18:24360902-24360924 ACACCTGAACTGGAATAAATGGG + Intronic
1156166164 18:34423825-34423847 GACCCTGAACTGGAAAAAGTGGG + Intergenic
1156886279 18:42139940-42139962 AACCCTGAATTGGACCAATGAGG - Intergenic
1157085524 18:44576762-44576784 AAGGCTGAACTAGAACAAAAAGG - Intergenic
1157396042 18:47342434-47342456 AACCATGATATGGAACAAAATGG + Intergenic
1159302215 18:66588299-66588321 GGCCCTGAACTGGAATAACCAGG + Intronic
1159359653 18:67383357-67383379 AACCCTGAATTGTAATTAACTGG - Intergenic
1159475399 18:68914422-68914444 GACCCTGAACTGGAATAAACAGG + Intronic
1159667916 18:71185926-71185948 GACCCTGAACTGGAATAACTGGG + Intergenic
1160595131 18:79968079-79968101 AACACTGTACTGGAAGAAATGGG + Exonic
1160626572 18:80212310-80212332 AACCATGAACTGGAATAAACAGG + Intronic
1162782583 19:13014239-13014261 ATCCCCAAACTGGCACAAACCGG + Intronic
1163534954 19:17871830-17871852 AGCCCTGGACTGGGACAGACAGG - Intergenic
1164490834 19:28712785-28712807 ATCCCTGAACTGGAATAAGCAGG + Intergenic
1165192481 19:34076561-34076583 AACCCTGAACTGGAATAACTGGG + Intergenic
925995051 2:9285365-9285387 AACACTGAACTGGGACAAAAGGG + Intronic
926005780 2:9372692-9372714 GACCCTGAACTGGAATAAGTGGG - Intronic
926181288 2:10645882-10645904 AGCCCTGAACTGGGACCAACAGG + Intronic
928427902 2:31193754-31193776 AACCATAAAGTGGAAAAAACAGG + Intronic
928556847 2:32435501-32435523 AACATTGAAGTGGAACAAAATGG + Exonic
928946921 2:36779902-36779924 AACCCTACACTGCAAAAAACTGG + Intronic
929902710 2:46019440-46019462 AACCCTGAACTGCAGCAAGTGGG + Intronic
930963642 2:57292227-57292249 AACCCTAAACTGGAATAAGCAGG - Intergenic
931294862 2:60912240-60912262 GACCCTGAACTGGAATAATTGGG + Intronic
931618221 2:64183268-64183290 GACCCTGAACTGGAATATGCAGG - Intergenic
931904531 2:66828215-66828237 AACCCTGACCTAGAAGAAAGAGG - Intergenic
932553652 2:72798409-72798431 AACTCTGATCTGTAACATACTGG + Intronic
935502184 2:103855568-103855590 GACCCTGAACTGGAATAAGCAGG - Intergenic
935974780 2:108567394-108567416 AACCCTGAACTAGAATAAGCAGG + Intronic
936098598 2:109554412-109554434 GACCCTGAACTGGAGTAAGCAGG - Intronic
936109459 2:109653086-109653108 ACCTTTGAAATGGAACAAACTGG - Intergenic
936488641 2:112949772-112949794 GATCCTGAACTGGAACAAGTGGG + Intergenic
938585898 2:132690363-132690385 AACCCTGAGCTGGAATAATTGGG + Intronic
938664344 2:133519044-133519066 AAGCCTGACATGGATCAAACAGG + Intronic
938979831 2:136515654-136515676 AACTCTGAACTGGAATAAATGGG + Intergenic
939148029 2:138440106-138440128 GACCCTGAACTGGAATAATCAGG - Intergenic
940119135 2:150243347-150243369 AGCCCCAAACTGGAACAACCTGG - Intergenic
940691850 2:156928155-156928177 AAACCTGAACTGAAACAATTAGG - Intergenic
941314772 2:163978743-163978765 TACCCTGAACTGGAATAACTGGG + Intergenic
941978736 2:171433025-171433047 GACCCTGAACTGGAATAATTAGG - Intronic
942894601 2:181036692-181036714 TACCCTGAACTGGAATAAGTGGG + Intronic
944179382 2:196871591-196871613 AACCCTGAACTGTTAGAAACAGG + Intronic
944203580 2:197134331-197134353 AACCCTGAACTGTAAATAATTGG - Intronic
944461033 2:199950762-199950784 GACCCTGAACTGAAATAAGCAGG + Intronic
945935938 2:215902682-215902704 GACCCAAAACTGGAACTAACAGG + Intergenic
946073759 2:217056512-217056534 ATCCCTGAACTGGGAGAAATGGG + Intergenic
946777793 2:223161797-223161819 AACCCTGAACTGGAGTAAGCTGG - Intronic
947389449 2:229623927-229623949 ATCCATGAACTGGGACAATCAGG + Intronic
948130686 2:235598294-235598316 CACCCTGAACTGGAATAATTGGG + Intronic
1169490153 20:6064507-6064529 TACCCTGAACTGGAATAAGCAGG - Intergenic
1171093323 20:22306686-22306708 TACCCTGAGCTGGAACAGAGGGG + Intergenic
1173404411 20:42752482-42752504 TGCCCTGAACTGGAACCAAAGGG + Intronic
1173739767 20:45390840-45390862 GACCCTGAAATGGAATAAGCAGG + Intronic
1174144757 20:48444264-48444286 AACTCTGAAATGGAACCAAAAGG + Intergenic
1174423099 20:50413291-50413313 AACCCTTAACTGGCGGAAACAGG + Intergenic
1174914426 20:54639935-54639957 GACCCTGAACTGGAACCACTGGG - Intronic
1175938795 20:62527831-62527853 CACCCTGAACTGGAATAAGTGGG - Intergenic
1176907647 21:14522787-14522809 AACCCTGAGCTGGAATAACTGGG - Intronic
1177032869 21:16004592-16004614 AACCCTGAACTGAAATAAATGGG - Intergenic
1177794739 21:25762170-25762192 AACACTGAACTGAAACTTACTGG - Intronic
1177891633 21:26811291-26811313 AACCCTGCCCAGAAACAAACAGG - Intergenic
1182493031 22:30686557-30686579 AAACCTCAACTGGAATAAGCGGG - Intergenic
1182605763 22:31502054-31502076 GACCCTGAACTGGAATAAGTGGG + Intronic
1182900065 22:33890284-33890306 AACCCTAAGATGGAATAAACAGG - Intronic
1185007851 22:48294451-48294473 GACCTTGAACTGGAATAATCGGG + Intergenic
1185039920 22:48498598-48498620 AACCCTGAACTGGGAGAAATTGG - Intronic
950731656 3:14964862-14964884 CACCCTGAACTGGAATAAGTGGG - Intronic
951133943 3:19081367-19081389 AAACCTTAAGTGGAACAAAATGG - Intergenic
951328653 3:21337957-21337979 AGCCCTGAACTGGAATAATTGGG - Intergenic
951734516 3:25849426-25849448 GACCCTGAACTGGAATAATTGGG + Intergenic
952358205 3:32604304-32604326 AACCCTGTACTTGAATAAGCAGG - Intergenic
952756048 3:36868111-36868133 AACACTGAACTGGAATAACTCGG + Intronic
956578254 3:70780344-70780366 AACCCTGAGCTGGAATAACTGGG - Intergenic
957755298 3:84477363-84477385 AAGCCTGCACTGAAACTAACTGG - Intergenic
958114703 3:89200965-89200987 AGCCCTGAACTGGAATAAGCAGG + Intronic
959066219 3:101659475-101659497 AACCTTCAACTGGACCAACCAGG - Intronic
961964582 3:130889027-130889049 AACCCGGAACTGGAATAATTGGG - Intronic
964807244 3:160624404-160624426 AACCCTGAACTGGAATGAGTGGG - Intergenic
964839568 3:160979250-160979272 AACCCTGAACTGGAATAAGTGGG - Intronic
965545706 3:169914444-169914466 AGCCCAGAACTGTAACACACAGG + Intronic
966612766 3:181884438-181884460 CACCCTGAACTGGAATAAATGGG - Intergenic
967452091 3:189636988-189637010 GACCCTGAACTGGAATAAGCAGG - Intronic
969258068 4:6016042-6016064 GACCCTGAACTGGAACAATTGGG + Intergenic
970225108 4:13849670-13849692 AAACCTGAACTGCTACCAACCGG + Intergenic
970676558 4:18456845-18456867 GACCCTGAACTGGAAGAATTTGG + Intergenic
972268604 4:37486886-37486908 AGCCAGGAACTAGAACAAACAGG - Intronic
972474123 4:39434578-39434600 AGCGCTGAACTGGATTAAACTGG + Exonic
973054876 4:45643343-45643365 AAAGCTGAACTGGAAGAAAATGG - Intergenic
974243827 4:59287683-59287705 AACCCTGAAAAATAACAAACTGG + Intergenic
974569063 4:63620393-63620415 ATCTCAGAACTGGAACTAACTGG - Intergenic
974765388 4:66337733-66337755 AACCCTGAACCGAAATAAACGGG - Intergenic
975440465 4:74404475-74404497 TACCCTGAACTGGAATAAGTGGG + Intergenic
976467677 4:85389232-85389254 AACCCTGCACTGGAATAAGCGGG + Intergenic
976579050 4:86713223-86713245 AACCCGGAATTGCAACATACAGG - Intronic
976736557 4:88315906-88315928 GACCCTGAACTGGAATAAGCAGG + Intergenic
977132921 4:93265950-93265972 AACCCTGAACTAGAATAAGCTGG - Intronic
977343162 4:95786312-95786334 AACCCTGAACTAGAATAGGCAGG - Intergenic
979181247 4:117730441-117730463 GACCCTGAACTGGAATAAATGGG - Intergenic
981305147 4:143239518-143239540 GACCCTGAACTGGAATAAGCAGG - Intergenic
981660853 4:147164761-147164783 AACCCTGAGCTGGAATAACTGGG + Intergenic
981952399 4:150424489-150424511 AACCCTGAAGTGGAATAAATGGG - Intronic
982803879 4:159738747-159738769 AACCTTGAACTGGAATAAGCAGG - Intergenic
983467884 4:168117784-168117806 AACCCTGAAGTGGAATAAGTTGG - Intronic
983864457 4:172748188-172748210 ATCCCTGAACTGGAATAAACAGG - Intronic
984253747 4:177365354-177365376 AACCCAGAACTGGAATAAGTGGG + Intergenic
984308628 4:178028159-178028181 GACCCTGAACTGGAGTAAGCAGG + Intergenic
984432149 4:179663567-179663589 AACCCTGAACTGAAATAAGCAGG - Intergenic
984494329 4:180475383-180475405 AACCCTGAACTGGAATAAGCAGG + Intergenic
984792157 4:183624847-183624869 GACCCTGAGCTGGAATAAGCAGG + Intergenic
984923484 4:184786126-184786148 GACCCTTAACTGGAATAAACAGG + Intronic
985636751 5:1039418-1039440 TACCCTGAACAGGAACATGCGGG + Intergenic
985853459 5:2406171-2406193 AACCCTGAACTGAAATAATTGGG + Intergenic
987620382 5:20332772-20332794 AACCCTGAACTGGCACAATTGGG - Intronic
989250133 5:39303943-39303965 TACCCTGAACTAGAATAAACAGG + Intronic
989718489 5:44494491-44494513 GACCCTAAACTGGAATAAGCAGG - Intergenic
990053738 5:51543329-51543351 AAACCAGAACAGGAAGAAACTGG + Intergenic
990150371 5:52810586-52810608 CAGCCTGAACTGGAAGAAAATGG + Intronic
990412347 5:55553489-55553511 AACCCTGAACTGGAATAAATGGG + Intergenic
990504530 5:56431329-56431351 AACTCTGAACTGAAAGAAGCAGG + Intergenic
990547735 5:56839870-56839892 GACCCTGAACTGGAATAAGTGGG + Intronic
991417559 5:66407894-66407916 ACCTCTGAAATTGAACAAACTGG - Intergenic
991420673 5:66438185-66438207 GACCCTGAACTGAAATAAGCCGG - Intergenic
992285437 5:75230239-75230261 AACCCTGAAGTGGAATAACTGGG + Intronic
992286319 5:75239240-75239262 AACCCTGAACTGGAATGACTAGG - Intergenic
992565114 5:77988392-77988414 AATCCTGAAATGGAGCAAACAGG - Intergenic
993383420 5:87233973-87233995 AACCCTGAACTGGAATAAGCAGG + Intergenic
993689486 5:90981681-90981703 GACCCTGAACTGGAATAAGCAGG + Intronic
993884061 5:93396021-93396043 ACCCCCAAACTGGCACAAACTGG - Intergenic
994816835 5:104595976-104595998 GACCCTGAGGTGGAACAAAAGGG - Intergenic
995105208 5:108369934-108369956 AACCCTGAACTGGAATAACTGGG - Intronic
995634087 5:114165644-114165666 AACCCGGAATTGCAACACACAGG - Intergenic
996252216 5:121349179-121349201 AAACCTGAACTGGAATGAGCAGG + Intergenic
996327236 5:122288623-122288645 GACCCTGAACTGGAATAAGCAGG + Intergenic
997405837 5:133645885-133645907 CACCTTGAACTGGGACTAACTGG + Intergenic
998515500 5:142750062-142750084 AGGCCTGAGCTGGCACAAACAGG + Intergenic
999341286 5:150776020-150776042 AACTCTAAACTGGAATAAGCAGG - Intergenic
1000780375 5:165473020-165473042 AACCATCAACTGTTACAAACTGG + Intergenic
1000790637 5:165602591-165602613 GCCCCTGAACTGGAATAAATGGG + Intergenic
1001207871 5:169781000-169781022 GACCCTGAACTGGAATAAGTGGG - Intronic
1001610813 5:173000164-173000186 AACTTTAAACTAGAACAAACTGG - Intronic
1002827083 6:783605-783627 GACCCTGAACTGGAATAAGCGGG + Intergenic
1003028566 6:2580268-2580290 AACCCAAAATTGGAATAAACTGG + Intergenic
1006214602 6:32429672-32429694 GACCTTGAACTGGAATAAGCAGG - Intergenic
1006827589 6:36947609-36947631 GACCCTGAACTGGAATAATTGGG - Intergenic
1007578902 6:42943881-42943903 ATCATTGAACTGGAACAAACTGG - Intergenic
1007799961 6:44383999-44384021 AACCCTGAACTGGAATAAGCGGG - Intergenic
1008328918 6:50221803-50221825 TACTCAGAACTGGAGCAAACTGG - Intergenic
1009265292 6:61546910-61546932 GACTCTGAACTGGAATAATCTGG - Intergenic
1010203112 6:73299772-73299794 AAACCTGATCTGTATCAAACTGG - Intronic
1010375223 6:75160992-75161014 GACCCTTAACTGGAATAAATGGG - Intronic
1010943406 6:81946951-81946973 AATCCTGAACTGGAAAAAATAGG - Intergenic
1011025130 6:82860462-82860484 AACCCTGAACTGGAGTAAGTGGG - Intergenic
1012310739 6:97721301-97721323 GACCCTGAACTGGAACAAGTGGG - Intergenic
1013456389 6:110333334-110333356 AAGCATTAACTGGAGCAAACTGG - Intronic
1014261158 6:119218837-119218859 AACCTTGAACTGGAATAACTGGG + Intronic
1014596913 6:123355556-123355578 AATCCTGAACAAGATCAAACTGG - Intronic
1016588847 6:145720582-145720604 ATTCCAGAACTGGAACAATCTGG - Intronic
1017165298 6:151402256-151402278 AATCCTGCACTGGAACAGAATGG - Intergenic
1017344279 6:153361731-153361753 AACCCTGAACTGGAATAATTGGG + Intergenic
1017940928 6:159052340-159052362 GACCCTGAACTGGAATGAGCAGG - Intergenic
1018570909 6:165208732-165208754 GACCCTGAATTGGAATAAGCAGG + Intergenic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1019117616 6:169777929-169777951 GACCCTGAACTGGAATAAGCAGG - Intronic
1020380260 7:7537137-7537159 GACCCTGAACTGGAATATGCAGG - Intergenic
1020520409 7:9178953-9178975 AACCTTGAACTGGAATAAGCAGG - Intergenic
1021136604 7:16972021-16972043 CACCCTGAACTGGAATAAGTAGG + Intergenic
1021768376 7:23971811-23971833 AAAGCTGAAATGGAACAAAAAGG + Intergenic
1021816594 7:24453058-24453080 AATCCTGAACTGGAATAAGCAGG + Intergenic
1021938291 7:25653221-25653243 ATCCCTGACATGGAACAAACTGG + Intergenic
1022141685 7:27498642-27498664 CACCCTGAACTGGAATAAGCAGG - Intergenic
1022173759 7:27853542-27853564 GACCCTGAACTGAAATAAGCGGG + Intronic
1022484476 7:30767725-30767747 GATCCTGAACTGGAATAAGCAGG - Intronic
1023384254 7:39639719-39639741 GAGCCTGAACTGGAAAAAGCAGG - Intronic
1023550436 7:41364626-41364648 AACCCTGTGCTGGAACAGCCAGG + Intergenic
1023953431 7:44866628-44866650 AACCCTGAACTGGAATAAATGGG - Intergenic
1024371085 7:48584643-48584665 AACCCTGAACTGGAATAATTGGG + Intronic
1024610381 7:51059127-51059149 GACCCTGAACTGGAAAAACTGGG + Intronic
1025247872 7:57331089-57331111 AACCCTTAACTGGTGGAAACGGG - Intergenic
1026299634 7:69086104-69086126 AACCCTGAACTGGAATGAGTCGG - Intergenic
1028655443 7:93200827-93200849 AAGCCTGAACTAGAATAAGCAGG - Intronic
1029313966 7:99694519-99694541 AACCCTGAAATGTAGAAAACAGG - Intronic
1029871021 7:103692816-103692838 AACCATTAAGTTGAACAAACAGG - Intronic
1029902168 7:104052868-104052890 AACCATGGAATGGAACAGACAGG - Intergenic
1033522135 7:142171389-142171411 AAACATGAACTGGAACACATGGG + Intronic
1033780233 7:144659837-144659859 CACCCTGAACTGAAATAAGCTGG + Intronic
1033870288 7:145746058-145746080 CACCCTGAACTAGAATAAGCAGG - Intergenic
1034948451 7:155279829-155279851 CACCCTGAACTGGAATAAGCAGG + Intergenic
1035069228 7:156128981-156129003 CAACCAGAACTGGAAGAAACGGG - Intergenic
1035129978 7:156642610-156642632 CACCCTGAACTGGAATAAGCAGG - Intronic
1035981180 8:4374174-4374196 AACCCTGGACTGGAACTCAGAGG - Intronic
1036058607 8:5289372-5289394 CACCCTAAACTGGAATAAGCGGG - Intergenic
1037235353 8:16713946-16713968 GACCCTGAACTGGAATAAGCAGG - Intergenic
1040556261 8:48479748-48479770 AACTCTAAACTGGAACACACAGG + Intergenic
1041117867 8:54557831-54557853 GACCCTGAACTGGTACAAGCAGG + Intergenic
1041135374 8:54752563-54752585 AACTCTGAACTGGAATAAGCAGG - Intergenic
1042058224 8:64788622-64788644 GACCCTGAACTGGAATAATTGGG + Intronic
1042097453 8:65232844-65232866 AACCCTGAACGGGAATAATTTGG + Intergenic
1042715694 8:71770105-71770127 ATTCTAGAACTGGAACAAACTGG - Intergenic
1042887189 8:73565029-73565051 AATCCTGAACTGGAATAAGTGGG + Intronic
1043317747 8:78942198-78942220 GACCCTGAACTGGAATAATTGGG + Intergenic
1043562485 8:81510322-81510344 AACCCTCACCTAGAACAAATGGG - Intergenic
1044323885 8:90838438-90838460 AACCCTGAACTGGAGTAAGTGGG - Intronic
1044617396 8:94156402-94156424 AACCCTGAATTTCAAGAAACAGG + Intronic
1045120697 8:99030571-99030593 GACACTGAACTGGAATAAGCAGG + Intronic
1049130529 8:140836040-140836062 GACCCTGAACTGGAATAACTGGG + Intronic
1049169366 8:141149533-141149555 AACCCTGAACTGCAATAAGCAGG - Intronic
1049642086 8:143720369-143720391 GAATCTGAACTGGTACAAACTGG - Intronic
1050307203 9:4316749-4316771 AACCCTGAACTGGAATAAGCTGG + Intronic
1052795506 9:32919896-32919918 CACCCTGAACTGGAATAAGCGGG + Intergenic
1052955339 9:34249605-34249627 CACCCTGAAAAGGAACAAAGAGG - Intronic
1053246373 9:36537887-36537909 AACCTTGAACTGGAATAAGTGGG - Intergenic
1055148494 9:72965406-72965428 AACCCTGAAATGGAATCAGCAGG - Intronic
1056946048 9:90997796-90997818 AACCCTGAACTGGAATAAGCAGG + Intergenic
1057342549 9:94215676-94215698 AACCCTGAACTGGAATAAGCAGG + Intergenic
1057710939 9:97443514-97443536 AAAACTGAACTGAAAAAAACTGG - Intronic
1058547784 9:106079506-106079528 AACCATGAACATGAACAAAATGG + Intergenic
1059605887 9:115835378-115835400 GACCCTGAACTGGAATAATTGGG - Intergenic
1061645012 9:131994003-131994025 GGCCCTGAAATGGAACAAGCAGG + Intronic
1062683171 9:137795295-137795317 AACCCTGACCTGGAATAACTGGG - Intronic
1187716803 X:22110797-22110819 AACCCTGAACTAGAATAACTGGG - Intronic
1187768925 X:22673642-22673664 AAGCCTGAACAAAAACAAACTGG - Intergenic
1187968057 X:24632065-24632087 TACCCTGAACTGGAATAAGCTGG + Intronic
1188852906 X:35153520-35153542 AAACCTGAACTAGAACATATTGG - Intergenic
1189166595 X:38867054-38867076 GACCCTGAACTGGAATAAGTAGG - Intergenic
1189412319 X:40783716-40783738 GACCCTGAACTAGAATAAACAGG - Intergenic
1190072133 X:47288198-47288220 GACCCTGAGATGGAACAAAAAGG + Intergenic
1190364481 X:49678663-49678685 CACCCTGAACTGCAATAAGCAGG - Intergenic
1190538171 X:51449691-51449713 AACCAAGAACTTGAACAAAGGGG + Intergenic
1192573889 X:72227528-72227550 GACCCTGAGGTGGAACAAAAGGG - Intronic
1193184214 X:78493089-78493111 AACCCTAAACTGGAACCAAATGG + Intergenic
1195465112 X:105171633-105171655 AAGCCTGGACAGGAACAAATGGG - Intronic
1195770580 X:108347079-108347101 AACCCTGAGCTGGAATTAGCGGG - Intronic
1195961712 X:110393850-110393872 GACCCTGAACTGGAATCAGCGGG + Intronic
1196365717 X:114921449-114921471 GACCCTGAACTGGAATAATTAGG + Intergenic
1197690484 X:129495210-129495232 AATCCTGAACTGGAATAAGCAGG + Intronic
1197827295 X:130603423-130603445 AACCCTGAACTGGAATAAACCGG + Intergenic
1199224079 X:145352150-145352172 AACCCTGAACTAAAATAATCAGG - Intergenic
1199456419 X:148034218-148034240 AACCCTAAACTGGAATAAGTAGG + Intergenic
1199635330 X:149807522-149807544 AACCCTGATATGGAACAGAAGGG - Intergenic
1201220742 Y:11767628-11767650 AACCCTTAACTGAAATAAGCAGG - Intergenic