ID: 1108348613

View in Genome Browser
Species Human (GRCh38)
Location 13:49569969-49569991
Sequence CTTACAAAACAGATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 324}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108348608_1108348613 0 Left 1108348608 13:49569946-49569968 CCCTCAAACGACCTCTTGTGCCT 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG 0: 1
1: 0
2: 1
3: 26
4: 324
1108348607_1108348613 1 Left 1108348607 13:49569945-49569967 CCCCTCAAACGACCTCTTGTGCC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG 0: 1
1: 0
2: 1
3: 26
4: 324
1108348609_1108348613 -1 Left 1108348609 13:49569947-49569969 CCTCAAACGACCTCTTGTGCCTC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG 0: 1
1: 0
2: 1
3: 26
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108348613 Original CRISPR CTTACAAAACAGATGGAGAA AGG Intronic
900302246 1:1983639-1983661 CTTACAGAAGAGCTGCAGAATGG - Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
903416489 1:23186889-23186911 CTTAAAAAAAAAATAGAGAAAGG + Intergenic
904420349 1:30387100-30387122 CTTACATCACACATGGGGAAGGG - Intergenic
904967554 1:34389085-34389107 CTAACAAAACTGATAAAGAAAGG - Intergenic
905262470 1:36729538-36729560 CTTCCTAAACACATGTAGAATGG - Intergenic
906508797 1:46399201-46399223 AAAACAAAACAGATGGAGGAGGG + Intronic
906541514 1:46590156-46590178 ATTCCAAAACAAATGGAGAACGG + Intronic
906699158 1:47845004-47845026 CTTCCAAGACAGGTGGAGACAGG + Intronic
907230855 1:52996863-52996885 GTTGCAAAAAAGATGGAGGAGGG - Intronic
907261761 1:53223550-53223572 CTTAACAAAGAGATGGAAAAAGG + Intergenic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
908662637 1:66453473-66453495 CTGTCAAAACTGATTGAGAATGG + Intergenic
908778885 1:67670104-67670126 CTTTCAAATCAGATGGATGAAGG + Intergenic
910332921 1:86096657-86096679 CTTATAAGACAGAGAGAGAAAGG - Intronic
910609192 1:89122185-89122207 CTTACAGAAAAGATGTACAATGG + Intronic
912222797 1:107697402-107697424 CGTATAAAACAGAAGGGGAATGG + Intronic
912482655 1:109995792-109995814 GTAAGAGAACAGATGGAGAATGG + Intronic
912972397 1:114296050-114296072 TTTACAAAACAGAAAGATAAGGG + Intergenic
913111908 1:115664528-115664550 CTCCCAAAAATGATGGAGAAAGG + Intronic
914434021 1:147644326-147644348 ATTACAAAAAAGAAGAAGAATGG + Exonic
915113332 1:153578849-153578871 CAAACAAAACAAATAGAGAAAGG + Intergenic
917915693 1:179699174-179699196 CTGACAAAAGCAATGGAGAAAGG + Intergenic
919429890 1:197479456-197479478 CTATCAAAAGAGATGGAGAGGGG - Intergenic
921410340 1:214829732-214829754 CTTATAAAAGAGATTGAGGAGGG - Intergenic
921744858 1:218728508-218728530 TTTAAAAAATAGAGGGAGAAGGG + Intergenic
923059184 1:230454948-230454970 CTTTCAAAGGAGATGGAAAAAGG - Intergenic
923250920 1:232179043-232179065 CTTCTAAAACAGATAAAGAAGGG + Intergenic
924652709 1:245944868-245944890 CTGACAAAAGCAATGGAGAAAGG + Intronic
1064967437 10:21029573-21029595 CTGACAAAACAGATACAGACTGG + Intronic
1065203342 10:23334886-23334908 CTTTCAAAAAAGATGGAAATAGG + Intronic
1065608445 10:27445839-27445861 CTTACAAAAATGCTGGAGACGGG - Intergenic
1066493020 10:35912884-35912906 TTTAAAAAACAGATGGAGATGGG + Intergenic
1068345619 10:55774519-55774541 CTGACAAAAGAAATGGGGAAAGG + Intergenic
1069614021 10:69794949-69794971 TTTAAAAAACAGATGCAGAGAGG + Intergenic
1070247032 10:74742531-74742553 CTTGCAAAGCAGAAGGAAAAAGG + Intergenic
1073794708 10:106975033-106975055 CTTACAACACAGAAGGCCAAAGG + Intronic
1073926552 10:108522697-108522719 ATTACAGTACAGATGGAGAGAGG - Intergenic
1074863006 10:117527069-117527091 CTTAGGAAACAGACAGAGAAAGG + Intergenic
1075716150 10:124556833-124556855 CATACAAAAAAGACTGAGAAAGG - Intronic
1079119099 11:17666941-17666963 CTTAAAAAACAGAAAAAGAAGGG + Intergenic
1081029574 11:38061701-38061723 CTGACAAAGCAGATGGAGTTGGG - Intergenic
1081429732 11:42963271-42963293 CTTACAAGACAGAGAGAAAATGG + Intergenic
1081742684 11:45451829-45451851 GCTCCAAAATAGATGGAGAATGG - Intergenic
1085558058 11:77443449-77443471 CTTACATTACAGTTGGATAAGGG - Intronic
1086175983 11:83891538-83891560 TTTATAAAACAGCTGGAAAAGGG + Intronic
1086820594 11:91432200-91432222 CCTAAAAAACACAGGGAGAATGG - Intergenic
1087237792 11:95739377-95739399 ATTAAAAGACAGATGGTGAAGGG - Intergenic
1087264545 11:96045949-96045971 CTAACAAAACAGAAGGCCAAGGG - Intronic
1087370363 11:97276409-97276431 CTGACAAAAGCAATGGAGAAAGG + Intergenic
1087712963 11:101575560-101575582 CCTACAAAGCACTTGGAGAAGGG + Intronic
1089126936 11:116183100-116183122 CTTACAAAACAGATGGGTCTGGG + Intergenic
1089367089 11:117927483-117927505 CTTGGAAAAGAGGTGGAGAAGGG - Intronic
1091541068 12:1463129-1463151 CCGAGAAAACAAATGGAGAAAGG - Intronic
1091701992 12:2669540-2669562 CTCACAAAACAGAAGGAGACGGG + Intronic
1092243255 12:6848575-6848597 CTTATAAAGCAGCTGGATAAAGG + Intronic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1092990216 12:13890166-13890188 GTTTCAACACAGATGAAGAATGG + Intronic
1093015258 12:14148712-14148734 ATTACAAATCAGATGGAAAAAGG + Intergenic
1093602056 12:21039333-21039355 CTTAAAAGGGAGATGGAGAAAGG - Intronic
1094200510 12:27790644-27790666 CTTGAAAAAGAGATGGACAATGG - Intronic
1094347946 12:29491611-29491633 CTTAGAAAAAATATGGATAATGG + Intronic
1094480203 12:30875424-30875446 ATTTAAAAACAGATGGGGAAAGG - Intergenic
1096644410 12:53022535-53022557 CTGACAAAACAGATACAGACTGG + Exonic
1097653569 12:62333661-62333683 ATTAAGAAACAGATGTAGAATGG + Intronic
1097930766 12:65182879-65182901 CTTACAAACTAGCTGAAGAACGG - Intronic
1098022770 12:66172852-66172874 CTTACAAAACACATGTTCAAAGG - Intergenic
1098130239 12:67342596-67342618 CTCAAAAAACACATGGGGAAGGG - Intergenic
1098669338 12:73205872-73205894 CTTACATAAAAGATGGAGGGAGG - Intergenic
1100938624 12:99699963-99699985 CTTACAAAATAGACTGAGAAAGG - Intronic
1101687385 12:107038480-107038502 CTTATAAAAGAAATGGAGGAAGG + Intronic
1102388965 12:112534498-112534520 TTTACAAAGCAGAGGGAGACAGG - Intergenic
1104147397 12:126048519-126048541 CTTACAACATAGATGAAGCAAGG + Intergenic
1104380323 12:128301688-128301710 CTTGGCAAACAGATGCAGAATGG + Intronic
1106008056 13:25789957-25789979 CTGGCAAAAGAAATGGAGAAAGG + Intronic
1107634108 13:42374645-42374667 CTTACAAAACAACTTGACAAAGG - Intergenic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1109990267 13:70045864-70045886 TTGACAAAACAGATAGAGGAAGG - Intronic
1110421331 13:75312886-75312908 CTTTCAACAGTGATGGAGAAGGG - Exonic
1110552573 13:76825559-76825581 CTCAGAAATCAGATGAAGAAGGG - Intergenic
1110969737 13:81746468-81746490 CTTACAAAGCAGAGGGATATTGG - Intergenic
1111171884 13:84537695-84537717 ATGACGAAACAGTTGGAGAAGGG - Intergenic
1111667881 13:91292861-91292883 CTTACAAAACAGGTGGTGGCTGG + Intergenic
1112514894 13:100044813-100044835 CTTAAAAAAAAGAGAGAGAAGGG + Intergenic
1113011736 13:105775271-105775293 CTTACAAAACAAGTAGAGCACGG - Intergenic
1114012513 14:18385218-18385240 ATTCCAAAACGGAGGGAGAAGGG - Intergenic
1114896658 14:26999199-26999221 CTTACAAAACACATTAAGTAGGG + Intergenic
1116182766 14:41556177-41556199 CTTACTAAACAGATTGGGGATGG + Intergenic
1116236793 14:42288827-42288849 GTTACAGAACAGATGGATGAGGG - Intergenic
1116360230 14:43985225-43985247 CTTAACAAACAAAAGGAGAAAGG - Intergenic
1116519321 14:45830903-45830925 CTTATAAATCAAAGGGAGAAAGG + Intergenic
1118476652 14:66123679-66123701 CTTCCAAAACAAATAGAGGACGG + Intergenic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1118508220 14:66440320-66440342 CTTCTAAAACACATGGAGATAGG + Intergenic
1118879533 14:69814433-69814455 CTGGCAAAACAGATAGAAAAAGG + Intergenic
1118949129 14:70418165-70418187 TTTACCAAACAGAAGGAGATAGG + Intergenic
1119109558 14:71958778-71958800 CTTACAAATCATCTGGAAAATGG + Intronic
1119210505 14:72828165-72828187 AGTAGAAAACAAATGGAGAAAGG - Intronic
1119294692 14:73523306-73523328 CTTGAAAAACAGATGGAAAGGGG + Intronic
1119772359 14:77228190-77228212 CTTACAAGAAAGATGGAGAAAGG + Intronic
1120930712 14:89845600-89845622 CTTACAAGAGAGCTGAAGAATGG - Intronic
1121164034 14:91774685-91774707 CTTACAACACAACAGGAGAAAGG + Intronic
1123679762 15:22753504-22753526 GCTACAAAACAGATGAAAAAAGG - Intergenic
1124331977 15:28827979-28828001 GCTACAAAACAGATGAAAAAAGG - Intergenic
1124468421 15:29961540-29961562 GTTACAAAGCAGGTGGAGAGAGG - Intronic
1124621167 15:31274896-31274918 CTCCCAGAACAGCTGGAGAAGGG + Intergenic
1125038411 15:35154149-35154171 ATTACAAAACAGCTGGAAGAGGG + Intergenic
1125438854 15:39679180-39679202 CTTTTAAGAAAGATGGAGAATGG + Intronic
1126336101 15:47587867-47587889 CTGACAATGCAAATGGAGAAAGG - Intronic
1126402159 15:48283172-48283194 CTTAAAAAACAGAGCAAGAATGG - Intronic
1127528637 15:59819427-59819449 CTAACAAAACCTATGGAGCAGGG + Intergenic
1128672856 15:69587245-69587267 CTTACAGACAAGATGGAGAGAGG - Intergenic
1128672934 15:69587763-69587785 CTTACAGACAAGATGGAGAGAGG - Intergenic
1130675343 15:85947280-85947302 CCAACATAACAGATGGAGAGGGG - Intergenic
1133419157 16:5630934-5630956 ATTCCAAAACAGCTGCAGAATGG + Intergenic
1133544046 16:6787911-6787933 ATTACTAAACAGCTGGTGAAAGG + Intronic
1134326681 16:13214128-13214150 CCAACAAAGCATATGGAGAAGGG - Intronic
1136177336 16:28526452-28526474 ATTACAAAACACATGAAGAGGGG - Intergenic
1136230132 16:28880855-28880877 GCCCCAAAACAGATGGAGAAAGG - Intronic
1139069769 16:63365827-63365849 TTTACAAAATAAAGGGAGAAAGG + Intergenic
1141793152 16:86250140-86250162 CTTACCATACAGGTGGAGATGGG - Intergenic
1143709449 17:8724262-8724284 CCTACCACACTGATGGAGAAAGG - Intergenic
1148447731 17:47749157-47749179 ATTAGAAAACATATGAAGAAAGG - Intergenic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153187859 18:2504947-2504969 TTGACAAAACAAAAGGAGAATGG + Intergenic
1153906365 18:9665245-9665267 GTTTCTAAACAGCTGGAGAAAGG + Intergenic
1154498435 18:14979652-14979674 CTGCCAAAACAGATGGTCAAAGG - Intergenic
1156422563 18:36971178-36971200 CTGACAAAAGCAATGGAGAAAGG + Intronic
1158278773 18:55797821-55797843 TTTAAAAAACAGATGGAGCAAGG - Intergenic
1159206178 18:65255817-65255839 CTTCAAGAACAGATAGAGAAAGG - Intergenic
1160002587 18:75040860-75040882 GTGACAAAGCACATGGAGAACGG + Intronic
1160098773 18:75901316-75901338 ATTAAAAACCAGATGGTGAAAGG + Intergenic
1160431708 18:78817302-78817324 CCAGCACAACAGATGGAGAATGG - Intergenic
1161512644 19:4679946-4679968 CCTGGAAAACAGATGGGGAAGGG + Exonic
1162052958 19:8046230-8046252 CTCAGAAAACAGATGTGGAAAGG + Intronic
1162096713 19:8314399-8314421 CCTACAAAACAGATGAAGTCCGG - Intronic
1162609774 19:11739884-11739906 CTTCATAAACATATGGAGAAAGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166194521 19:41197208-41197230 ATTACAAAACAGAAGGAGCCTGG + Intronic
1166214323 19:41325612-41325634 CTGAGAACAGAGATGGAGAATGG - Intronic
926622956 2:15063741-15063763 CTTACAAAACATATGCAAGAAGG + Intergenic
926838468 2:17051232-17051254 CTCACAAGACAGAGTGAGAAAGG + Intergenic
928036948 2:27833394-27833416 ATTAAAAAAAAGATTGAGAAAGG + Intronic
930301191 2:49618101-49618123 CTGACAAAACAGATGAAGACAGG + Intergenic
930344423 2:50161254-50161276 CTTATAAAACAGGTAGAGCAGGG + Intronic
932646260 2:73506051-73506073 CTGACAAAAGCAATGGAGAAAGG - Intronic
932873832 2:75430414-75430436 CTTACAAAACAAGAGCAGAAGGG - Intergenic
933239805 2:79907672-79907694 CTTAGAAAACGGATGAAAAAGGG - Intronic
933301518 2:80546085-80546107 CTTACAAGGCAGCTGGAGGAGGG + Intronic
933583215 2:84150704-84150726 CTAAAAAAACAGAAGGTGAATGG + Intergenic
933822812 2:86129823-86129845 CATACAAAACAGGTAGGGAAAGG + Intronic
934021152 2:87954250-87954272 CGTATAAAATAAATGGAGAAAGG - Intergenic
934107144 2:88705440-88705462 CTGACAAAAGCGATGGGGAAAGG + Intronic
934865799 2:97809344-97809366 CTTCCAACAGAGATGGAGAAGGG - Intronic
935623389 2:105147751-105147773 CTTACAAAATGGATGGATAATGG + Intergenic
935976722 2:108585675-108585697 CTTGCAAAAGAGATGGTGATGGG + Intronic
938392913 2:130918888-130918910 CAAACAATACAGATGTAGAAAGG + Intronic
939400452 2:141685636-141685658 CTTACAACAGGGATGTAGAAAGG + Intronic
940890958 2:159034717-159034739 CTTACATAACAGAGGAAGATGGG - Intronic
942384838 2:175431740-175431762 CTTGAAAAACAGATGAAGAGTGG + Intergenic
943095307 2:183421306-183421328 CTGACAAAAGCAATGGAGAAAGG + Intergenic
943122842 2:183758498-183758520 CTTGCTAAACAAATGCAGAATGG + Intergenic
944396019 2:199267038-199267060 CTGGCAAAGCAGATGGGGAAGGG + Intergenic
945086150 2:206134651-206134673 GATACAAAACAAATGGAAAAAGG + Intronic
945136835 2:206638666-206638688 CCTTGAAAACAGAGGGAGAAAGG - Intergenic
946268020 2:218565385-218565407 CCTATAAAACAAATGGACAAAGG + Intronic
946291381 2:218748047-218748069 GTAACAGAGCAGATGGAGAAGGG - Intronic
948192853 2:236073489-236073511 CTTGCAAAACAGCTGGGGACTGG + Intronic
948310574 2:236982668-236982690 GGTACAAGACAGCTGGAGAAGGG + Intergenic
948635080 2:239329578-239329600 ATCACAAAACAAATGGAGCACGG - Intronic
1168871362 20:1131293-1131315 CTTAAAAAACAAATAGAGACAGG - Intronic
1169342541 20:4807393-4807415 TTTACAAAACATATGGTAAAGGG + Intronic
1169753035 20:9014906-9014928 CTGACAAAACAGATGAACAAAGG + Intergenic
1170044913 20:12074822-12074844 CTTACAAATAAGATGAAAAAGGG + Intergenic
1170503993 20:17005019-17005041 TTTAAATAGCAGATGGAGAAAGG - Intergenic
1170978639 20:21190023-21190045 CACACAAAACAGTTGTAGAAAGG - Intronic
1170987717 20:21273759-21273781 CTTAGAAAAAAGAAGGCGAAAGG + Intergenic
1171775892 20:29367319-29367341 CTGACAAAAAAAATGGGGAAAGG - Intergenic
1172560016 20:35879273-35879295 CTTACAATACAGCTGCATAATGG + Intronic
1173944849 20:46942440-46942462 CTTAGAGAAAAGATGGGGAATGG + Intronic
1174849806 20:53982149-53982171 CTTACACAACAGAATCAGAAAGG - Intronic
1175002718 20:55646960-55646982 CTTATAAAACAAATGGTGACAGG - Intergenic
1176524994 21:7859386-7859408 CTTACAAATGAGATGGAGCAGGG - Intergenic
1177760105 21:25393579-25393601 CTTCCAAAACAGCTGGAAGATGG + Intergenic
1177952771 21:27559541-27559563 CTTAGAAAACTGATGTAGGAAGG + Intergenic
1178400320 21:32279605-32279627 CTTACAAAAAAGAAGAAAAAGGG - Intergenic
1178659014 21:34489399-34489421 CTTACAAATGAGATGGAGCAGGG - Intergenic
1180437004 22:15316027-15316049 ATTCCAAAACGGAGGGAGAAGGG - Intergenic
1182838329 22:33362849-33362871 CTTCCAAAACAATTGGAGGACGG - Intronic
1184730866 22:46370209-46370231 GCTCCAAAACAGATGGAGGACGG + Intronic
949252334 3:2001601-2001623 GATACAAAACAAAGGGAGAATGG - Intergenic
950174266 3:10861569-10861591 CTTAAAAAAATCATGGAGAAAGG + Intronic
950467136 3:13162244-13162266 CTTGGAAGACAGAGGGAGAAGGG + Intergenic
951621718 3:24609091-24609113 CTTCCAAAAGATATGGAAAATGG + Intergenic
952029724 3:29126908-29126930 CTTAGAAAACTGATGAAAAATGG + Intergenic
952358948 3:32610692-32610714 GTTACAAACCATATGAAGAATGG + Intergenic
952521907 3:34169379-34169401 CTTACATAACAGAAGGTGGAAGG + Intergenic
955302223 3:57791552-57791574 CTTGAAAAACAGTTTGAGAAGGG + Intronic
955868692 3:63413921-63413943 CTAAGAAAATAAATGGAGAAAGG - Intronic
957162642 3:76629966-76629988 ATGTCAAAAGAGATGGAGAAAGG - Intronic
958576838 3:95960960-95960982 CTAACAACCCAGATAGAGAAAGG + Intergenic
959933194 3:112004199-112004221 CTTGGAAAACAGAAGGTGAATGG + Intronic
960430856 3:117566948-117566970 CTTACATATCTGATGGGGAAGGG + Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961057486 3:123801354-123801376 CTTAAAATACACAAGGAGAAAGG + Intronic
961395202 3:126582186-126582208 CTTACAACATAGATGGAAAATGG + Intronic
961989891 3:131177464-131177486 CTACCAAAACAGATATAGAATGG + Intronic
962194581 3:133350597-133350619 TCTAGAAAACAAATGGAGAAAGG + Intronic
962628092 3:137247530-137247552 ATTACAAAACAGCTGGAAGAGGG - Intergenic
963382343 3:144547481-144547503 CTTATAAAACACATGGAGGTAGG - Intergenic
963445664 3:145403924-145403946 CATACGAAAAAGATGGAGACAGG + Intergenic
964210220 3:154218367-154218389 TTTACAAAACAGATCGTTAATGG + Intronic
964501925 3:157357469-157357491 CTTACAATGCAGATGGACAAAGG - Intronic
965411588 3:168338406-168338428 GTGACAAAACAGGTTGAGAAAGG - Intergenic
966475648 3:180342407-180342429 CTTACCCCACAGATGGAGAAGGG - Intergenic
974270267 4:59641921-59641943 TTTACAAAACAGGTGGCTAATGG + Intergenic
974962706 4:68723567-68723589 CTGACAAAAAAAATGGGGAAAGG + Intergenic
976870281 4:89784193-89784215 AATAGAAAACAGATGAAGAAAGG + Intronic
978281716 4:107024691-107024713 CTTTGCAAAGAGATGGAGAAAGG + Intronic
978364490 4:107967139-107967161 TTTACATAGCAGATGGGGAAAGG - Intergenic
978822817 4:112985461-112985483 CCCACAAAAGAGATGCAGAAGGG - Intronic
979798018 4:124871474-124871496 CTTCCAAAACAGATGCATGATGG - Intergenic
981758258 4:148165042-148165064 CTTACCAAACAGATAGATGAGGG + Intronic
982502941 4:156181029-156181051 CTTATAAATCAGAAGGAAAAGGG + Intergenic
984936620 4:184895412-184895434 TTTACAAAACAGATTAAGCACGG + Intergenic
984987099 4:185341928-185341950 CTTACAAAAAGCATGGTGAATGG - Intronic
986034725 5:3926651-3926673 CTGACAAAGAAGATGGAAAAGGG - Intergenic
986390729 5:7285299-7285321 GCTACAAAACAGATGAAAAAAGG - Intergenic
987557439 5:19472615-19472637 CATACAAAACTGATGGAGCATGG - Intergenic
987692125 5:21280914-21280936 CTTAAAAAAGAGAAGGAAAAAGG + Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988318143 5:29658381-29658403 TTTACAAAAGACATGAAGAAAGG - Intergenic
988469196 5:31522091-31522113 CTTACAAAACTGACAGAGATCGG + Intronic
990306075 5:54495026-54495048 CTTTCTCAACAGATGGAGTAGGG + Intergenic
990500508 5:56391593-56391615 CTTACAAAAGAGATCTTGAAAGG + Intergenic
991256298 5:64618690-64618712 CTTACAAAAGGGAGGCAGAAAGG - Intergenic
991557881 5:67915808-67915830 CACATAAAACAGATGGAAAATGG - Intergenic
993643953 5:90439974-90439996 CTTAAAAAAGAAAAGGAGAATGG + Intergenic
993972462 5:94436384-94436406 CTGACAAAAGCAATGGAGAAAGG - Intronic
994154192 5:96484393-96484415 ATTTAAAAACAGATGTAGAAGGG - Intergenic
994723664 5:103409592-103409614 AGTAGAAAACAGATGGAAAAAGG + Intergenic
994988452 5:106967802-106967824 CTCAGAAAACAGATGGAATATGG + Intergenic
995216273 5:109598582-109598604 GTTACAAAACAGCTGGTGCAAGG - Intergenic
995924396 5:117353328-117353350 TTGACAAAACAGAAGAAGAAGGG + Intergenic
997210105 5:132072182-132072204 CTTGCAAAAAAGGTGGAGAAAGG + Intergenic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
998779351 5:145639340-145639362 CTTGAAAACCAGAGGGAGAAGGG + Intronic
999008399 5:148007036-148007058 CTTGCTAAACAAAGGGAGAAAGG - Intergenic
999912114 5:156213573-156213595 CTTTCAAAAAAGCTGAAGAAGGG + Intronic
1001571700 5:172734389-172734411 CTAAGAAAACAGATGAAGAGGGG + Intergenic
1002942144 6:1726685-1726707 CTTGCAAAACAGATCTAGAAAGG - Intronic
1004833690 6:19506498-19506520 CTTACAAAAGCAATGGGGAAAGG - Intergenic
1004946885 6:20624979-20625001 CTCAGAAAACAGATGAAGAGAGG - Intronic
1005965749 6:30725241-30725263 GTTGCAAAAAAGATGGAGGAGGG - Exonic
1006150109 6:31982549-31982571 CTTACAAGACAGATGGGAACAGG - Intronic
1006156410 6:32015287-32015309 CTTACAAGACAGATGGGAACAGG - Intronic
1006755814 6:36414361-36414383 ATTACAAATCACATGGAGGAGGG + Intronic
1007215206 6:40231950-40231972 CTCACAAAGAAGATGGAAAAGGG + Intergenic
1007291825 6:40793365-40793387 ATTAGAAAGCAGATGGAGCAGGG + Intergenic
1007838823 6:44698782-44698804 CTTACATAGTAGATGGAGCAGGG - Intergenic
1007861095 6:44909677-44909699 CTCACATTACAGATGGAGAGAGG + Intronic
1008070808 6:47097095-47097117 CTTAGAGAGCAGATGCAGAATGG - Intergenic
1008229426 6:48966146-48966168 TTTACGTAACAGGTGGAGAAGGG + Intergenic
1008622191 6:53281518-53281540 ATTCAAAAACAGATGAAGAAGGG - Intronic
1009423838 6:63492303-63492325 CTTATATAACAGCTGCAGAAAGG - Intergenic
1011388070 6:86818995-86819017 CTTCCAAACCAAATGGAGAAAGG - Intergenic
1012420681 6:99061591-99061613 TTTAAAAACCAGATGGAGGAAGG - Intergenic
1013688536 6:112613222-112613244 TTTAAAAAACAGAGGCAGAAAGG - Intergenic
1015095536 6:129410504-129410526 CTAACTAAACAAATTGAGAAAGG - Intronic
1016899901 6:149091077-149091099 CTATCAAGACAGATGGAGTAAGG + Intergenic
1017161472 6:151369674-151369696 CTTAAAAAACAGGTGGAGGCTGG + Intronic
1017983296 6:159421439-159421461 CTTCCACCACCGATGGAGAATGG - Intergenic
1018449330 6:163892487-163892509 CTTACAATGCAGTTGGAGAAAGG - Intergenic
1018498553 6:164377541-164377563 ATTTCAAAACAGATGCGGAAGGG - Intergenic
1019081528 6:169434344-169434366 CTGACAAAAGCGATGGGGAAAGG - Intergenic
1020713454 7:11638007-11638029 CCCACACAACAGATGGAAAATGG - Intronic
1021426622 7:20507109-20507131 CCTACAAATCAGCTGAAGAAAGG - Intergenic
1021705351 7:23362344-23362366 CTTACAAAACAGATTGCTCAAGG + Intronic
1021839340 7:24709844-24709866 ATAACAAAACAGATGCAGAACGG + Intronic
1022195920 7:28067252-28067274 CTCACAACACTGATGGAGCAAGG - Intronic
1022360786 7:29655227-29655249 TTTACAAAACAGATGCATTAGGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024759416 7:52576598-52576620 CACAGAAAACAGATCGAGAAAGG - Intergenic
1024775052 7:52774284-52774306 CTTAAAAAACAGAGGGAAAAAGG + Intergenic
1025725595 7:64055589-64055611 CTTACATAACTGACCGAGAATGG - Intronic
1026208062 7:68276459-68276481 CATACAAAGTGGATGGAGAATGG - Intergenic
1027619404 7:80464992-80465014 CTTGCAAAATAAATGGAGGAAGG + Intronic
1028002992 7:85524813-85524835 CTTTCAAAACAGATAGTAAAAGG - Intergenic
1028049977 7:86173383-86173405 CTTAGAAAACATATGTCGAAAGG + Intergenic
1028869654 7:95755450-95755472 ATTACAAAGCCAATGGAGAATGG - Intergenic
1029958811 7:104668323-104668345 CTGACAAAACAGATACAGACTGG + Intronic
1032349832 7:131150886-131150908 CTTTCAAAATAAATGAAGAAGGG + Intronic
1032454568 7:132063730-132063752 TTTGCAAGACAGATGGAAAAAGG + Intergenic
1033803157 7:144924917-144924939 GTTACAAAAGTGATAGAGAAGGG + Intergenic
1033869711 7:145736658-145736680 CTTATAAAAGTGATGAAGAAGGG - Intergenic
1034132061 7:148728220-148728242 CGGACAACACTGATGGAGAAAGG + Intronic
1034290017 7:149922993-149923015 TTTACAAATCAGATGCTGAAAGG + Intergenic
1034397300 7:150836813-150836835 CTTACTAAGGAGATGGAGCAAGG + Intronic
1034442653 7:151094457-151094479 CTTACGTATCAGATGAAGAAGGG - Intronic
1034516782 7:151587314-151587336 ATAAACAAACAGATGGAGAAGGG + Intronic
1034713820 7:153220638-153220660 CTTGCAAAATAGGTGGAGAGAGG + Intergenic
1034745753 7:153522498-153522520 CTTATAAAGCAGAGGGAGATCGG + Intergenic
1034920795 7:155079802-155079824 TGGACCAAACAGATGGAGAAGGG + Intronic
1035308725 7:157951780-157951802 CAAACAAATCAGATGGAGCAGGG - Intronic
1036298628 8:7555535-7555557 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036299933 8:7563185-7563207 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036584325 8:10109002-10109024 TGTACTGAACAGATGGAGAAGGG + Intronic
1038048336 8:23786327-23786349 ATTAAAAAAAAGATGAAGAAGGG + Intergenic
1041049867 8:53923988-53924010 ATTCCAAAACATATGAAGAAAGG - Intronic
1041903883 8:63010555-63010577 TTTACAAAACTGAAAGAGAAAGG + Intergenic
1042092159 8:65170312-65170334 CTAACAAAACACCTGGAGGAGGG - Intergenic
1042212368 8:66393346-66393368 TTTGCAATACAGATGGAGAGAGG - Intergenic
1043178866 8:77058113-77058135 CTTACAAAATAAGTGGGGAAAGG - Intergenic
1044245682 8:89942149-89942171 CTTACAACACAGAAGGAGCTAGG + Intronic
1047659356 8:127015981-127016003 TATAAAAAACAGATTGAGAAAGG - Intergenic
1048409035 8:134152479-134152501 CTTACTAAACAAATAGAAAAGGG - Intergenic
1050290729 9:4151663-4151685 CTTAGAACAAAGATGAAGAAAGG - Intronic
1050447299 9:5739079-5739101 CTTGCAAAACAGATTTACAAGGG - Intronic
1050917270 9:11152923-11152945 CTTCCAAAAAAAATGGAAAAAGG + Intergenic
1051281770 9:15448422-15448444 CTCACAAAACGGATGAAGTAGGG - Intronic
1051351311 9:16200366-16200388 CTTACAAGCCTCATGGAGAAAGG + Intergenic
1051777548 9:20652325-20652347 CTTAAAAAAAAAATGGAGAGAGG - Intergenic
1051777737 9:20654656-20654678 CTTATAAAACAGTGGCAGAATGG + Intergenic
1051978913 9:22989286-22989308 CTTACTAAACAGATGTAAAGTGG - Intergenic
1052216368 9:25971691-25971713 CTGAGAAAACAGAGGCAGAAGGG - Intergenic
1052656304 9:31366146-31366168 AATAAAAATCAGATGGAGAAAGG + Intergenic
1052721114 9:32172012-32172034 CTTACAAAATAGATGGAAGGCGG + Intergenic
1054821408 9:69524691-69524713 ATTACAAAAATTATGGAGAAGGG + Intronic
1058161006 9:101570782-101570804 CTTACAAAACAGATACATTAAGG + Exonic
1058350654 9:104017769-104017791 CTTACAATGCAGGTGGAGCATGG + Intergenic
1058398332 9:104582466-104582488 TTTTAAAAACACATGGAGAATGG + Intergenic
1058909109 9:109504905-109504927 CTTACAAAACCCAGGGAAAATGG + Intergenic
1059207926 9:112483985-112484007 CTTAAAAAACACATGCACAAAGG - Intronic
1059635478 9:116166213-116166235 CTTCCAAAACAGAAGGGGAAGGG + Intronic
1059943518 9:119381948-119381970 CTAAGAAAACACAGGGAGAAAGG - Intergenic
1060141207 9:121211888-121211910 CTTTAAAAACAGCTGGATAAGGG + Intronic
1060682991 9:125582273-125582295 CTCACCAAACAGATGAAGGAAGG - Intronic
1187942578 X:24396282-24396304 CTTACAATACAAAAGAAGAAAGG - Intergenic
1190526976 X:51338270-51338292 CTTAAAGAACAGAAGTAGAAGGG - Intergenic
1191652056 X:63549982-63550004 CTGACAAAAGCAATGGAGAAAGG - Intergenic
1191653246 X:63565034-63565056 CTGACAAAAGCAATGGAGAAAGG - Intergenic
1191904654 X:66075760-66075782 CTGACAAAACAGATACAGACTGG - Intergenic
1195232569 X:102865445-102865467 CTTACAGGACAGAGGCAGAAGGG + Intergenic
1195857326 X:109345322-109345344 CTTGGATAACAGATGAAGAATGG - Intergenic
1196800793 X:119541549-119541571 ATTACTGAAAAGATGGAGAATGG - Intronic
1198226880 X:134653335-134653357 GTTAAAAACCAAATGGAGAAGGG - Intronic
1198729777 X:139716878-139716900 ATCACAAAAGAGATGGAGACAGG + Intergenic
1199123373 X:144084879-144084901 CGTATAAAATAAATGGAGAAAGG + Intergenic
1199556568 X:149115344-149115366 CTGACAAAACAAATGGGGAAAGG + Intergenic
1199855281 X:151754396-151754418 CTTACAAAAGAGAGAGAAAAGGG - Intergenic