ID: 1108357643

View in Genome Browser
Species Human (GRCh38)
Location 13:49642014-49642036
Sequence AGGGCTCATCCAGTTGTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108357643_1108357654 19 Left 1108357643 13:49642014-49642036 CCTAGGACAACTGGATGAGCCCT No data
Right 1108357654 13:49642056-49642078 CAGCTGGGGCAGAAGCCTGAGGG No data
1108357643_1108357648 4 Left 1108357643 13:49642014-49642036 CCTAGGACAACTGGATGAGCCCT No data
Right 1108357648 13:49642041-49642063 ACCAAGAACCCTGTGCAGCTGGG No data
1108357643_1108357650 5 Left 1108357643 13:49642014-49642036 CCTAGGACAACTGGATGAGCCCT No data
Right 1108357650 13:49642042-49642064 CCAAGAACCCTGTGCAGCTGGGG No data
1108357643_1108357653 18 Left 1108357643 13:49642014-49642036 CCTAGGACAACTGGATGAGCCCT No data
Right 1108357653 13:49642055-49642077 GCAGCTGGGGCAGAAGCCTGAGG No data
1108357643_1108357647 3 Left 1108357643 13:49642014-49642036 CCTAGGACAACTGGATGAGCCCT No data
Right 1108357647 13:49642040-49642062 AACCAAGAACCCTGTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108357643 Original CRISPR AGGGCTCATCCAGTTGTCCT AGG (reversed) Intergenic
No off target data available for this crispr