ID: 1108359963

View in Genome Browser
Species Human (GRCh38)
Location 13:49659955-49659977
Sequence CCTGCAGAGGCTGCAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 824
Summary {0: 1, 1: 1, 2: 9, 3: 103, 4: 710}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108359963_1108359970 5 Left 1108359963 13:49659955-49659977 CCAGGGCCTGCAGCCTCTGCAGG 0: 1
1: 1
2: 9
3: 103
4: 710
Right 1108359970 13:49659983-49660005 AAGCCAACCTAGAAGGAGAGTGG 0: 1
1: 0
2: 1
3: 24
4: 239
1108359963_1108359969 -2 Left 1108359963 13:49659955-49659977 CCAGGGCCTGCAGCCTCTGCAGG 0: 1
1: 1
2: 9
3: 103
4: 710
Right 1108359969 13:49659976-49659998 GGGTAGGAAGCCAACCTAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108359963 Original CRISPR CCTGCAGAGGCTGCAGGCCC TGG (reversed) Intergenic
900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG + Intergenic
900237455 1:1599559-1599581 GCGGCAGCGGCTGCAGGCACAGG + Exonic
900237481 1:1599724-1599746 CCTGCAGTGGCGCCTGGCCCCGG - Exonic
900399527 1:2467339-2467361 CCAGCAGAGGCTGCTGGGCCCGG + Intronic
900409158 1:2505039-2505061 GCAGCAGAGACTGCAGGGCCTGG + Exonic
900567612 1:3341321-3341343 CCTTCAGAGGCTGCAGGCCCTGG + Intronic
900625393 1:3606207-3606229 CCAGGAGAGGCTGCTGGTCCTGG - Intronic
900640740 1:3687055-3687077 CAGGCAAAGGCAGCAGGCCCTGG - Intronic
900728436 1:4234817-4234839 CCTGCAGCAGCTCCTGGCCCTGG - Intergenic
900782556 1:4627527-4627549 CCTGCAGAGGCTGCCCCCGCTGG - Intergenic
900791838 1:4685851-4685873 CATCCAGAGGCTGCAGGGCTGGG + Intronic
901050847 1:6425210-6425232 CCTGCAGTGGCTGCTGTCGCAGG + Exonic
901514745 1:9737497-9737519 CCTGCAGAGGCCACAGTCACAGG + Exonic
901551296 1:9997681-9997703 CCTGCGGAGACTGCAGACTCGGG + Intronic
901562531 1:10084047-10084069 ACAGCAGAGGTTGCAGGACCAGG - Intronic
901775791 1:11559756-11559778 CCAGCTGGGGCTGGAGGCCCTGG - Intergenic
901814739 1:11787712-11787734 CCGGGAGAGGCTGGAGGCCTGGG + Exonic
902243992 1:15107288-15107310 CCTGGAGTGGAAGCAGGCCCTGG - Intronic
902255630 1:15187061-15187083 CCTGCAGCTGCTGGAGGGCCCGG - Intronic
902708162 1:18220843-18220865 AGAGCAGAGGCAGCAGGCCCTGG + Intronic
902775279 1:18670717-18670739 CCGGCAGGGGCTGCAGGCCATGG + Intronic
903104716 1:21066253-21066275 TCTGATGAGGCTGCAGGGCCTGG - Intronic
903369967 1:22829224-22829246 CCTGCCAAGGCTCCAGGGCCTGG - Intronic
903775002 1:25787389-25787411 TCTGCAGAGCCTCAAGGCCCCGG + Intergenic
904011837 1:27394296-27394318 CCAGCACAGGCAGCAGCCCCAGG - Exonic
904756581 1:32771577-32771599 CCTGAAGGGCCTGCAGGCTCAGG - Exonic
904947200 1:34208153-34208175 CCTGCTGTGGGTACAGGCCCTGG - Exonic
905172902 1:36119526-36119548 CCTGCAGCGGCAGCAGGGGCTGG - Intronic
906075162 1:43046659-43046681 GCTGCAGTGGCTGCAGGCTGAGG + Intergenic
906246885 1:44282591-44282613 GCTGCTGAGTCTGGAGGCCCAGG - Intronic
906318883 1:44804710-44804732 CCAGCTGAGGCTGCAGGGCCCGG - Exonic
906670355 1:47649693-47649715 ACTGCAGAAGCCCCAGGCCCAGG + Intergenic
906951226 1:50335774-50335796 CCTGCAGAGGGAGGAGGCCTCGG - Intergenic
907028829 1:51150802-51150824 CCTGCAGGAACAGCAGGCCCAGG - Intergenic
907520161 1:55018590-55018612 CTTCCCGAGGCTGCAGGACCAGG - Intergenic
907575845 1:55524910-55524932 CCTGCAAAGGCTAAAAGCCCAGG - Intergenic
908397699 1:63741259-63741281 CCAGCAGTGGCTGCAGGGCATGG - Intergenic
909918884 1:81355720-81355742 AATTCAGAAGCTGCAGGCCCAGG - Intronic
910200677 1:84695384-84695406 CCTGCACAGCCTGCAGAACCGGG - Intergenic
912195640 1:107394107-107394129 CCTGCCCAGGCTGGATGCCCAGG + Intronic
912609131 1:111025277-111025299 CCTGCAGAGGCCGCAGGTCATGG + Intergenic
912686881 1:111774897-111774919 CCGGCTGAGGCTGCGAGCCCTGG + Intronic
913169596 1:116220396-116220418 CCTGCAGAGGCTGCTGAGCGGGG - Intergenic
913532016 1:119740364-119740386 CCTGCAGAGGATGGAGGAGCGGG - Exonic
914345397 1:146794514-146794536 CCTGGAGAAGCTGCGAGCCCTGG + Intergenic
914431711 1:147624792-147624814 CCTGGAGAGCCCACAGGCCCAGG - Exonic
915164471 1:153941014-153941036 CCTGCAGCTGCTGCAGAGCCTGG - Exonic
915568943 1:156733466-156733488 CCTGCAGAAGCTCCTGGTCCAGG - Exonic
915894360 1:159800039-159800061 CCAGAAGAGGCTCCAGGCCCAGG - Intergenic
916505268 1:165422977-165422999 CCTGCAGGGGCTCCTGGCCAAGG - Intronic
916712851 1:167427161-167427183 CCTGCAGGGGCTGTAGGCTTGGG + Exonic
919198692 1:194322856-194322878 CCTGCAATGGCTGCAGGTTCTGG + Intergenic
919486855 1:198157105-198157127 CCGGCGGACGCTGCAGGCGCGGG - Exonic
919743830 1:200996297-200996319 CCTGCAGCTTCTGCAGGTCCCGG + Exonic
919796193 1:201322865-201322887 CCTGCAGAGGCAGGGGGCCCAGG - Intronic
919805741 1:201380103-201380125 CCTGCTGAGGCTGCAGCTGCAGG + Intronic
919897456 1:202018235-202018257 CCTGCAGAGGCCACCTGCCCAGG - Intergenic
920173737 1:204087422-204087444 CATGCACAGGGAGCAGGCCCTGG - Intronic
920180220 1:204127837-204127859 CCTGCAGGAGCTTCAGGCCTGGG + Intergenic
920347142 1:205313764-205313786 CCCTCAGAGGCTGCAGGGCTAGG + Intronic
920456945 1:206108851-206108873 CTGGGAGAGGCTGCAGGCCAAGG - Intergenic
920631722 1:207659250-207659272 CCTGCATGGTCTGCAGCCCCAGG + Intronic
920851720 1:209632602-209632624 CCTGCAGAGGCCCCAGGCTTGGG + Exonic
921189736 1:212699277-212699299 CCTGGAGGGGCTACAGGCGCGGG + Intronic
921355530 1:214281308-214281330 GCTGCAGAGCCCGCAGCCCCCGG - Exonic
922790070 1:228306397-228306419 GCTGCAGAGTCTGCAGGCGGAGG + Exonic
922875547 1:228937202-228937224 CCTGCAGAGGTACCAAGCCCGGG + Intergenic
922881569 1:228985121-228985143 CCAGCAGCTGGTGCAGGCCCTGG - Intergenic
923051502 1:230393946-230393968 CCTGCAGAGGATGCCAGGCCGGG - Intronic
923194444 1:231651700-231651722 TCTACAGAGGCAGCAGGCCTTGG + Intronic
923573803 1:235140391-235140413 CCTGCAGGCCCTGCCGGCCCCGG + Intronic
923680041 1:236111718-236111740 CCTCCAGGAGCTGCAGGCGCTGG - Intergenic
924672949 1:246147752-246147774 CCTGCTGCGGCTGCAGACCTGGG + Intronic
1062785226 10:259325-259347 CCAGCTGAGACTGCAGCCCCTGG + Intergenic
1062856364 10:781364-781386 CCCACAGAGGCCCCAGGCCCAGG - Intergenic
1062961853 10:1578217-1578239 CGTGCAGAGGCAGGAGGGCCAGG + Intronic
1063124800 10:3128673-3128695 GGCGCAGAGGCTGAAGGCCCTGG - Intronic
1063391640 10:5653304-5653326 CCTGCATATTCTGCAGGCACAGG + Intronic
1063425198 10:5945324-5945346 CCTGCAGCCACTGCAGCCCCGGG + Intronic
1063432308 10:6001018-6001040 CCTTCAGAGCCTGCAGACTCAGG - Intergenic
1063432320 10:6001207-6001229 CCTTCAGAGCCTGCAGACTCAGG - Intergenic
1064299870 10:14114010-14114032 CCTACTGAGACTGCAGGCCAAGG - Intronic
1064300963 10:14122465-14122487 CCTGCACAGCCTGCAGACCCAGG - Intronic
1065976459 10:30846747-30846769 CCTGCTGTGGCTGCAGATCCAGG + Intronic
1067289330 10:44929884-44929906 CCAGCAGGGGCTCCAGGCTCAGG - Intronic
1067372702 10:45699928-45699950 CCCGCAGCAGCTGCTGGCCCAGG - Intergenic
1067387075 10:45826196-45826218 CCCGCAGCAGCTGCTGGCCCAGG + Exonic
1067419053 10:46131055-46131077 CCCGCAGCAGCTGCTGGCCCAGG - Intergenic
1067504404 10:46837644-46837666 CCCGCAGCAGCTGCTGGCCCAGG - Intergenic
1067560504 10:47301351-47301373 CCTGCAGAAGCTCCAGGCACTGG + Intronic
1067561608 10:47308568-47308590 CCTGCAGATGCTGTAGGTACAGG + Intronic
1067590182 10:47502349-47502371 CCCGCAGCAGCTGCTGGCCCAGG + Exonic
1067876187 10:50009883-50009905 CCCGCAGCAGCTGCTGGCCCAGG - Exonic
1068670316 10:59715905-59715927 CCTTCAGGGGCTGCTAGCCCAGG - Intronic
1068771670 10:60828424-60828446 CCTGTAGAGGCTGCTGCCCATGG - Intergenic
1068934080 10:62619223-62619245 TTTGCAGAGGCTGCAAGTCCAGG - Intronic
1068939004 10:62662599-62662621 GCTGAAGGAGCTGCAGGCCCAGG + Intronic
1070547833 10:77466311-77466333 CCAGCAGATGATGCAGGCCTGGG - Intronic
1070556495 10:77531893-77531915 CCTGCAGAGTCAGCAGCCCCAGG + Intronic
1070595489 10:77830070-77830092 GCTGCTGAGACTGCAGGCCTTGG + Intronic
1070757907 10:79004971-79004993 CCTGCCCAGGCTGGAAGCCCAGG - Intergenic
1071372672 10:84968512-84968534 CCAGCAGAGGATACAGGCTCTGG - Intergenic
1072720145 10:97775269-97775291 CCTGCCCAGGCTGCAGAACCAGG - Intergenic
1073051143 10:100668160-100668182 CCTGGAGATGCTGCCGGCTCAGG - Intergenic
1073060367 10:100730104-100730126 CGCGCTGAGGCCGCAGGCCCAGG - Intergenic
1073253127 10:102133808-102133830 CCTGCCGGGGCTGGAGGCCCGGG + Intronic
1073511865 10:104047480-104047502 CGTGCAGTGGCTGTAGGCCCTGG - Intronic
1073945062 10:108740876-108740898 CCAGCAGAGGCTGCAGTAGCAGG - Intergenic
1074417799 10:113282721-113282743 CTTGCAAAGTTTGCAGGCCCCGG + Intergenic
1074917605 10:117972347-117972369 GCTGCAGGGACTGCAGGCCCTGG + Intergenic
1075092340 10:119450853-119450875 TCAGCAAAGGTTGCAGGCCCTGG + Intronic
1075132192 10:119749217-119749239 CCAGCAGAGGCTCCAGACCTGGG - Intronic
1075440577 10:122476630-122476652 AATGCAAGGGCTGCAGGCCCAGG - Intronic
1075444611 10:122504739-122504761 CTGGCAGGGGCTGCTGGCCCAGG + Intronic
1075516499 10:123112868-123112890 CCAGCAGAGGCTGCAGAGGCTGG + Intergenic
1075639837 10:124056662-124056684 CATGCACAGGAGGCAGGCCCCGG + Intronic
1075719279 10:124575542-124575564 CCAGGAGAGGCTGCAGGACATGG - Intronic
1075967915 10:126628765-126628787 TCTGCAGAAGCTGCAGGGACTGG - Intronic
1076367786 10:129933595-129933617 CCTGCAGAGGCTGCTGGGCTGGG - Intronic
1076409394 10:130234991-130235013 CATGCAGTGGCTGGAGGCCATGG - Intergenic
1076427112 10:130374790-130374812 CCAGCATAGGCTGCAGGTTCCGG - Intergenic
1076759570 10:132595236-132595258 CCTGCAGAAACTGCATGCCCTGG - Intronic
1076762012 10:132610615-132610637 CCAGCATAGGCTGCAGACCCTGG - Intronic
1076792462 10:132784670-132784692 GGTGCGGAGGCTGCGGGCCCCGG - Intergenic
1077027244 11:446371-446393 CCTGCAGGGGCTTCAGGCTGGGG - Intergenic
1077151526 11:1075095-1075117 TCTGCTGAGGCTCCTGGCCCGGG + Intergenic
1077162527 11:1120245-1120267 CATGCCCAGGCTGCAGCCCCAGG - Intergenic
1077305391 11:1866619-1866641 CCAGCAGAGCCTGGAAGCCCAGG - Exonic
1077315822 11:1918992-1919014 CCTGCAATGGCAGCAGCCCCGGG + Intergenic
1077377211 11:2210687-2210709 CCAGCCGAGGCTGCTGGCCCTGG + Intergenic
1077384313 11:2261816-2261838 CATGGAGGGGCTGCAGTCCCCGG - Intergenic
1077453156 11:2662951-2662973 GCTGCAAAGGCAGGAGGCCCAGG - Intronic
1077798365 11:5514768-5514790 CCTGCAGAGGCTACAATCCCCGG - Exonic
1078084982 11:8228530-8228552 GCTGCAGAGGGCGCAGGCTCTGG + Intronic
1078119340 11:8490449-8490471 TCTACAGAGGCAGCAGGCCTTGG - Intronic
1079151823 11:17906589-17906611 CCTGCAGAGGCTGCAGAAGGCGG - Intronic
1079710984 11:23681065-23681087 AGGGCAGAGGCTGCAGGCCTAGG + Intergenic
1081666278 11:44918820-44918842 CCTGAAGAAGCTACAGGACCGGG - Intronic
1082106720 11:48229007-48229029 GCTGCTGGTGCTGCAGGCCCAGG + Intergenic
1082792436 11:57355747-57355769 CCTGCAAAGGGTGCAGGCCTGGG - Intronic
1082809123 11:57467958-57467980 ACTGCAGCCGCTCCAGGCCCTGG - Exonic
1083233004 11:61334936-61334958 ACTCAAGAGGCTGCAGCCCCAGG - Intronic
1083292876 11:61699585-61699607 CCAGCAGAGACTCCAGGCCTAGG + Intronic
1083357181 11:62075515-62075537 CCTGCACAGGCTACAGGCTGTGG - Intergenic
1083856615 11:65396240-65396262 AGTGCAGAGGCTGCCGGCTCAGG + Intronic
1083899628 11:65637280-65637302 CCTGCAGGCAGTGCAGGCCCAGG - Exonic
1084104988 11:66975339-66975361 GCTCCGGAGGCTGCAGGCACAGG - Exonic
1084454127 11:69257677-69257699 CATGCAGAGGCTCCAGGAACAGG - Intergenic
1084598468 11:70131147-70131169 GCTGCAGAGGCTGCTGCCTCAGG + Intronic
1084748847 11:71190582-71190604 CCTGCAGAGGCCTCATGCCTTGG - Intronic
1084770716 11:71341363-71341385 CCTGCAGAGTTTGTAAGCCCAGG - Intergenic
1084797634 11:71519056-71519078 CCCGAGGAGGCTGCAGGCCCGGG - Intronic
1085276518 11:75303598-75303620 CCTGCAGAAGGTACAGGCCCCGG + Intronic
1085464932 11:76716841-76716863 CCAGCAGATGCATCAGGCCCAGG - Intergenic
1085824194 11:79825971-79825993 CCTCCAGAACCAGCAGGCCCGGG - Intergenic
1086487689 11:87326134-87326156 TCTGCAGAGGCAGCAGGCTGGGG - Intergenic
1087292738 11:96338317-96338339 GCTGCAGAGTCTGCAGGAACAGG - Intronic
1087327852 11:96745322-96745344 CCTGCAGATGTGGCAGTCCCAGG - Intergenic
1089163119 11:116454836-116454858 CCTGCAGAGGTAGAAGTCCCTGG - Intergenic
1089336248 11:117725770-117725792 CCTGCAGAGGAAACAGGCCATGG + Intronic
1089492821 11:118894393-118894415 CCTGGCGAGGCTGAAGGCCGTGG + Exonic
1089616514 11:119697914-119697936 GCTGCAGAGGCTGAAGCCCTCGG + Intronic
1089645798 11:119877910-119877932 CCAGCAGAGTCTGCAGCCCGAGG - Intergenic
1089654248 11:119935486-119935508 CAGGCAGAGGTTGCAGACCCTGG - Intergenic
1090137106 11:124209999-124210021 TCTGCTGTGGCTGCAGGCCCAGG - Intergenic
1090351992 11:126113693-126113715 CCAGCAGAGGATGGAAGCCCTGG - Intergenic
1091297808 11:134486221-134486243 CCTTCAGAGGGTGCAGCCCGAGG + Intergenic
1091369479 11:135046621-135046643 CCTGGGGAGCCTCCAGGCCCTGG - Intergenic
1091453354 12:587275-587297 CCTCCACAGGAAGCAGGCCCAGG + Intronic
1091588897 12:1831434-1831456 CCTGCAGCTGCTGCAGGTCGGGG + Exonic
1091596643 12:1883058-1883080 GCTGGGGAGGGTGCAGGCCCTGG - Intronic
1091634438 12:2186396-2186418 CCTGAAGCGGCTGCGGGCCATGG + Intronic
1091723139 12:2827633-2827655 AAAGCAGAGTCTGCAGGCCCAGG + Exonic
1091979866 12:4856093-4856115 CACGCAGAGGCTGGACGCCCTGG + Intergenic
1092814476 12:12301039-12301061 CCAGCAGATGCTGGAAGCCCAGG + Intergenic
1094025844 12:25958975-25958997 CCCGCACCGGCTGGAGGCCCCGG - Intergenic
1096100531 12:48968237-48968259 CTTGCCCAGGCTGCAGGCCGTGG + Exonic
1096152940 12:49325863-49325885 CCCCCAGAGGCTACAGGCTCTGG + Exonic
1096673628 12:53214795-53214817 GGAGCAGGGGCTGCAGGCCCTGG - Intronic
1096847741 12:54417421-54417443 CTGGCAGAGGCTCCAGGCCAGGG + Intronic
1096904884 12:54926440-54926462 CCAGCATAGGCTGGAGGCCTAGG + Intergenic
1097226081 12:57477557-57477579 GCTGCAGAGGCTGGATGCCTGGG - Exonic
1098358772 12:69635243-69635265 GCTACAGAGGCTGCAGGCCCAGG - Intergenic
1098856077 12:75654619-75654641 CCAGCAGAAGCAGCAGGGCCTGG + Intergenic
1099285149 12:80707914-80707936 AGTGTGGAGGCTGCAGGCCCGGG - Exonic
1100362995 12:93895047-93895069 ACTTCAGAGGCTGCAGGGCTTGG - Intergenic
1100376425 12:94020053-94020075 CCTGCAGAAGCTGGATGGCCAGG + Intergenic
1102514612 12:113437950-113437972 CCTGCGGAGGCTCCAGGCCGAGG + Exonic
1102965430 12:117121622-117121644 CCCGCAGATCCTGCAGCCCCCGG - Intergenic
1103560912 12:121793048-121793070 CCTGCCAAGGCTGCAGGGCGGGG + Intronic
1103786357 12:123436186-123436208 CCTGGAGATGCTGGAGGCGCTGG - Exonic
1103944471 12:124518392-124518414 CCTGCAGGGCCTCCAGGGCCGGG - Intronic
1104153857 12:126111245-126111267 CCTGCATATGCTTCAGGCCTGGG - Intergenic
1104633043 12:130420771-130420793 CCTGGCAAGACTGCAGGCCCAGG + Intronic
1104946703 12:132417849-132417871 CCCGCAGGCTCTGCAGGCCCTGG - Intergenic
1105014463 12:132777679-132777701 GGTGCAGAAGCTGCAGGCCGAGG - Exonic
1105074288 12:133262042-133262064 CCAGAAGAGGCTGGAGGCCCAGG + Intergenic
1105741437 13:23327730-23327752 GCTGCAGAGGCTCCAGGGACAGG - Intergenic
1105888477 13:24663283-24663305 CCTGGTGAGGCTACAGTCCCAGG - Intergenic
1105888919 13:24668108-24668130 ACAGGAGAGGCTGGAGGCCCAGG + Intergenic
1106404787 13:29464062-29464084 CCTGCAGACTCTGGAGGTCCTGG + Intronic
1107141004 13:36998868-36998890 ACTGCAGCGGCTGCAGGTCCCGG + Intronic
1107385528 13:39904495-39904517 CCTGAAGAGGCTCCATGCTCTGG + Intergenic
1107751174 13:43568971-43568993 CCTACACATGCTGCAAGCCCTGG - Intronic
1108247488 13:48532688-48532710 CCTGCCCAGGCCGCCGGCCCAGG - Intronic
1108249499 13:48550782-48550804 CCTGCCGAGGCTGAGGACCCAGG + Intergenic
1108359963 13:49659955-49659977 CCTGCAGAGGCTGCAGGCCCTGG - Intergenic
1108615490 13:52128618-52128640 CCAGGAGAGGCTGCAGACACCGG + Intronic
1108676156 13:52739398-52739420 CCGGTAGAGGGTGCAGGTCCTGG - Intronic
1108736043 13:53284197-53284219 GCTCCAGAGGCTGCATGTCCTGG + Intergenic
1112024971 13:95403663-95403685 CCTGCACAGCCTGCAGAACCAGG - Intergenic
1112327314 13:98450619-98450641 CCTCCCCAGGCTGCAGGCTCTGG + Intronic
1112567229 13:100561973-100561995 GCGGCAGAGTCTGCATGCCCCGG + Intronic
1113848438 13:113404940-113404962 CCTGCAGATGCTGCTGACCTTGG + Intergenic
1113868672 13:113545155-113545177 CCTGCACAGGCACCAGGCCATGG - Intronic
1113971549 13:114195118-114195140 CCTGGGCATGCTGCAGGCCCAGG + Intergenic
1114155549 14:20099336-20099358 CCTGCTGCAGCTGCTGGCCCAGG - Intergenic
1114528946 14:23383278-23383300 CCTGCTGCGGCTACAGGACCTGG - Exonic
1114534466 14:23414060-23414082 CCTGCTGCGGCTGCAGGACCTGG - Exonic
1114683401 14:24506091-24506113 TCTGAAGTGGCTGCAGGCCTGGG + Exonic
1114980623 14:28158619-28158641 CCAGCCACGGCTGCAGGCCCCGG - Intergenic
1117285579 14:54282980-54283002 CCAGCCAAGCCTGCAGGCCCTGG - Intergenic
1117420872 14:55543704-55543726 GCAGCAGAGGCTGTTGGCCCTGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119036064 14:71231342-71231364 CCTGCCGTGGCTACAGACCCAGG + Intergenic
1119206905 14:72801199-72801221 GCTACAGAGGATGCAGGCACTGG + Intronic
1119477640 14:74940318-74940340 CCTGCAGAGTCCCCAGGCCTCGG + Intergenic
1119620100 14:76125482-76125504 CCTGTAGAGGCTGCCGGCTTTGG + Intergenic
1119642485 14:76325647-76325669 CCTGAGGAGGCTGCAGACCTAGG + Intronic
1119667948 14:76498431-76498453 CCTGGAGATGCTGGAGGCCAAGG + Exonic
1119740592 14:77011593-77011615 CCAGGAGAGGCTGAAGACCCTGG - Intergenic
1119777690 14:77258794-77258816 CCGGCAGGGGCTGCAGGGGCTGG - Exonic
1119851032 14:77866909-77866931 CCTGCGGGGGCTGCAGGCACAGG - Intronic
1121328847 14:93037030-93037052 TCAGAAGAGCCTGCAGGCCCAGG + Intronic
1121433502 14:93903678-93903700 ACTGCAGAGTCTGGAGCCCCCGG - Intergenic
1121450043 14:94001278-94001300 CCTCCAGAGACTCCAGGCTCCGG - Intergenic
1121580630 14:95027021-95027043 TCTGCAGAGGTTGCAGGGCCTGG + Intergenic
1122204742 14:100142888-100142910 CCTGCTGTGGGTGCAGCCCCAGG + Intronic
1122352328 14:101103351-101103373 GGGGCCGAGGCTGCAGGCCCAGG + Intergenic
1122491054 14:102116570-102116592 GCAGCAGAGGCTCCAGGCCTGGG - Intronic
1122799682 14:104223367-104223389 CCTGCAGAGGCGGGAGGGCAGGG - Intergenic
1122824290 14:104362188-104362210 ACAGCAGGGGATGCAGGCCCTGG - Intergenic
1122838133 14:104441347-104441369 CCTGCCGGGGGTGGAGGCCCTGG + Intergenic
1122877720 14:104676640-104676662 GCTACAGTGGCTGCAGGTCCAGG - Intergenic
1122946373 14:105012364-105012386 CCTGCAGAGGGCGCAGGGCGGGG + Intronic
1123940954 15:25216453-25216475 CCTGGTGCTGCTGCAGGCCCTGG + Intergenic
1123943524 15:25228020-25228042 CCTGGTGGTGCTGCAGGCCCTGG + Intergenic
1124041923 15:26113465-26113487 CATGCTGAGGCTCCAGGCCAGGG - Intergenic
1124237703 15:28004205-28004227 ACAGCAGAAGCTGCCGGCCCTGG + Intronic
1124917261 15:33987891-33987913 CCTGCTGGGTCTGCATGCCCTGG + Intronic
1124962728 15:34410410-34410432 TCTGCAGAGTCCGCAGGCCCTGG - Intronic
1124979354 15:34556632-34556654 TCTGCAGAGTCCGCAGGCCCTGG - Intronic
1125327627 15:38553088-38553110 CCTTCAGAGGTGGCATGCCCAGG + Intronic
1125727458 15:41875341-41875363 CCTCCAGAGGCTGCAGAGCCAGG + Intronic
1126362561 15:47861324-47861346 CATTCACAGGCTGCAGCCCCTGG + Intergenic
1127547950 15:60006587-60006609 CTTCCAGAGGCTCCAGGCGCTGG + Exonic
1128646303 15:69381089-69381111 CCTGCCCAGTCCGCAGGCCCAGG - Intronic
1128668278 15:69554525-69554547 CCTTAACAGGCTGCAGGCCAAGG - Intergenic
1129263931 15:74383864-74383886 CCTCCAGGTGGTGCAGGCCCGGG - Intergenic
1129329787 15:74821118-74821140 CCCGCAGAGCCTGCAGGATCCGG - Exonic
1129936669 15:79456720-79456742 CCTGGACAGGTTGCAGGCCCTGG + Exonic
1130162322 15:81414003-81414025 CCAGCAGAGGCAGCCGGCTCCGG - Intergenic
1130283400 15:82536506-82536528 CCAGCAGGGGCTGAAGACCCAGG + Intergenic
1130303816 15:82699710-82699732 GCTTCGGTGGCTGCAGGCCCAGG - Intronic
1130651871 15:85766610-85766632 ACTGCAGGGTCTGCAGGGCCTGG + Intronic
1131395786 15:92084901-92084923 CCTGCAGAAGCCGCAGGGCCAGG + Intronic
1132287922 15:100679199-100679221 ACTACAGAGGCAGCAGGCCTTGG + Intergenic
1132331007 15:101012653-101012675 CCTGCACAGGCTTCAGCCCCCGG + Intronic
1132481053 16:166255-166277 CGTGAAGAGCCTGCAGGACCAGG - Exonic
1132590435 16:724070-724092 CCCCCAGAAGCTCCAGGCCCGGG - Intronic
1132601331 16:774464-774486 ACTGGAGGGGCTACAGGCCCTGG - Exonic
1132715541 16:1288355-1288377 CCTGCTGAAGCTGGAGGCCCCGG - Intergenic
1132878296 16:2149821-2149843 CCCGCTGAGCCTGCAGGCCTGGG + Intronic
1132891793 16:2208338-2208360 CGTGCAGGGCCTGCTGGCCCGGG + Intronic
1132931847 16:2462671-2462693 GCTGGAGGGGCTGCAGGCCATGG + Exonic
1133008822 16:2898919-2898941 CAGGCAGAGGCTTCTGGCCCTGG + Intronic
1133280904 16:4664799-4664821 CCTGCACGGCCTGCACGCCCAGG - Intronic
1133301969 16:4787953-4787975 CCAGCAGAGCCTGGAGGGCCAGG + Intronic
1133397559 16:5460495-5460517 CCTGCAGAGGCTCAGGGCCCAGG + Intergenic
1133831069 16:9324174-9324196 GCTGCAGAGGTTGCAGCCACTGG - Intergenic
1134090715 16:11390356-11390378 CATGCGGCGGCTGCAGGCCTGGG - Exonic
1134235498 16:12462187-12462209 CCAGCCCAGGCTGCAGGGCCAGG - Intronic
1135056999 16:19240093-19240115 CCTTCAGAGGGCCCAGGCCCAGG - Intronic
1135132209 16:19862243-19862265 CCTGCAGAGGCTGCGTGGCTTGG - Intronic
1135147053 16:19971851-19971873 CCTGCAGAGGCTGAATGAGCTGG - Intergenic
1135309689 16:21395824-21395846 CAGGCAGAGCCTGCAGTCCCAGG + Intergenic
1135404780 16:22190351-22190373 CGTGCAGAGGCTGCAGGCCTAGG - Exonic
1135771939 16:25224463-25224485 CCTGACGACGCTGCTGGCCCTGG + Exonic
1135846164 16:25920511-25920533 ACTTCAGAGGCTGAAGTCCCTGG - Intronic
1135974882 16:27101993-27102015 CCTGTGGAAGCTGCAAGCCCCGG - Intergenic
1136074683 16:27808824-27808846 CCCGCAGAGGCTGCTCGCTCTGG - Intronic
1136149267 16:28336137-28336159 CAGGCAGAGCCTGCAGTCCCAGG + Intergenic
1136306433 16:29374948-29374970 CAGGCAGAGCCTGCAGTCCCAGG + Intergenic
1136359021 16:29765744-29765766 ACAGCTGGGGCTGCAGGCCCTGG - Intergenic
1136414533 16:30095544-30095566 CCCGGAGAGGCTGCTGGCTCTGG - Exonic
1137456836 16:48623989-48624011 CCTCCGGAGGTGGCAGGCCCAGG - Intergenic
1137566910 16:49539093-49539115 CCTTCAGTGGCAGCAGGCACAGG + Intronic
1137671819 16:50283713-50283735 CCTGAGGAGACTGCAGTCCCAGG - Intronic
1137728596 16:50673576-50673598 CCTGCAGCGCCTGCAGGCCCGGG - Exonic
1138598349 16:58041317-58041339 CCAGCAGAGGCTCCAGGCCCTGG - Intronic
1139157021 16:64455855-64455877 CCTCCTGAGTCTGCAGGCACCGG - Intergenic
1139706949 16:68747342-68747364 GCTGCAGAGGCAGCTGGGCCAGG + Intronic
1139971846 16:70781286-70781308 CCTGTAGAGTCTGCAGAACCGGG + Intronic
1139988590 16:70920749-70920771 CCTGGAGAAGCTGCGAGCCCTGG - Exonic
1140111946 16:72012160-72012182 TCTGCAGGGGCTGCTGGACCCGG + Exonic
1140909379 16:79437923-79437945 TCTGCAGGGGCTGCTGGCCTGGG + Intergenic
1141090031 16:81123818-81123840 CCTGCAGGGGCTCCATGTCCCGG + Intergenic
1141097155 16:81170999-81171021 CGTGCAGAGGGTGCAGGAGCTGG - Intergenic
1141435565 16:83997918-83997940 CCTGCACAGCCTCCAGGGCCTGG - Intronic
1141466204 16:84207309-84207331 CCAGCACAGGCTACTGGCCCTGG - Intergenic
1141601425 16:85128877-85128899 CCTGGAGGGGCTGAAGGGCCTGG - Intergenic
1141636055 16:85314463-85314485 CCTGGTGAGGCTGCAGGGCTTGG + Intergenic
1142110034 16:88326481-88326503 GCAGCAGAAGCTGCAGTCCCTGG - Intergenic
1142224495 16:88870984-88871006 CCTGCACAGCCTGCAGACCCAGG + Intergenic
1142304356 16:89277293-89277315 CCTGCTGTAGCTGCCGGCCCTGG - Intronic
1142339248 16:89509727-89509749 CCTGCAGAAGCTTCAGGCCATGG + Intronic
1142523467 17:520995-521017 CCTGAAGAGCCTACAGGTCCTGG + Intronic
1142583993 17:959360-959382 CGCGCAGAGGCTGCCTGCCCCGG + Intronic
1143190061 17:5034269-5034291 CCTGTGGAGGCAGCTGGCCCCGG - Exonic
1143367889 17:6420369-6420391 TGTGCTGAGGCTGCAGGACCTGG + Intronic
1143664290 17:8347382-8347404 CCGGCCGACCCTGCAGGCCCCGG - Intergenic
1143720085 17:8803249-8803271 CCTGCAGGGACAGCAGGCCCAGG - Exonic
1143879327 17:10017850-10017872 CCCACAGAGGCTCCAGGCCAGGG - Intronic
1144527184 17:16000007-16000029 CCAGCAGCGGCAGCAGGCCTGGG - Exonic
1144713026 17:17414830-17414852 CCTCCACAGTCTGCAGGACCTGG - Intergenic
1144730150 17:17521353-17521375 CCTGCACAGCCTGCATCCCCAGG + Intronic
1144872861 17:18381390-18381412 CCTGCTGGTGCTGCAGGGCCTGG - Exonic
1145005661 17:19336311-19336333 CCTTCAGACGGTGCAGGGCCTGG + Exonic
1145103562 17:20096721-20096743 CCGGAAGAGGCTGCAGGCAGAGG - Exonic
1145240990 17:21241030-21241052 CCTGCAGAGGCCCCGGGCCCAGG - Exonic
1146506938 17:33413895-33413917 CCTGCAGAGCTTGCATGCCAGGG - Intronic
1146659894 17:34658792-34658814 GATGCAGAGGCTACAGGGCCAGG - Intergenic
1147254841 17:39175380-39175402 CCTGCAGGGTCTCCAAGCCCTGG + Exonic
1147545805 17:41400785-41400807 CCTGCACTGGCTGCAGGTCATGG + Intergenic
1147582917 17:41636993-41637015 GCTGCCGGGGCTGCAGGCCTGGG - Intergenic
1147947167 17:44086701-44086723 CCTGCAAAGGCTGCAGCGGCTGG + Exonic
1148073715 17:44923247-44923269 AGTGCAGAGGCAGCAGGCACAGG - Intergenic
1148088739 17:45009945-45009967 CCTGGAGTGGCGGCAGGGCCTGG + Intergenic
1148870823 17:50658018-50658040 AGGGCAGGGGCTGCAGGCCCAGG + Intronic
1149019164 17:51943576-51943598 CCTGCAGTGGCTGCACTGCCTGG + Intronic
1149658439 17:58322534-58322556 CCTGGAGCAGCTCCAGGCCCAGG + Intronic
1150137639 17:62704309-62704331 GCTGCGGAGGCTGGAGGCCCGGG + Intronic
1150228061 17:63534489-63534511 CCTGCCAAGGCTGCACCCCCAGG + Intronic
1150284956 17:63949336-63949358 CTTGCAGGGGCTGCAGGCCTGGG + Intronic
1150983358 17:70168990-70169012 CCCGCGGAGGCTGCAGCGCCCGG - Intronic
1151319527 17:73344058-73344080 TCTGCAGGGGCTGCAGCCTCTGG + Intronic
1151529581 17:74695841-74695863 CCTCCAGGGGCTGCAGTACCTGG + Exonic
1151551178 17:74823354-74823376 CCGGAGGAGACTGCAGGCCCTGG + Intronic
1151659545 17:75511690-75511712 CCTGCGCAGGCTGTAGGCTCAGG - Intronic
1151665449 17:75542911-75542933 CCTGCAGTGACTCCAGGCCAGGG - Intronic
1151697637 17:75725982-75726004 CCTGAGGAGGCAGCAGGCCAGGG + Intronic
1151700390 17:75739787-75739809 ACGGCAGAGGCTGGAGGCTCTGG + Intronic
1151748387 17:76023609-76023631 CCTGCTGGTGCTGCAGGGCCTGG + Exonic
1151757387 17:76082612-76082634 CCTGGAGAGGCTGCACCCCATGG + Exonic
1152127955 17:78458735-78458757 CCTGCAGCGGCAGCAGGGCTGGG + Intronic
1152147035 17:78574603-78574625 TCTGCAGCTGCTGCTGGCCCAGG + Intronic
1152149549 17:78590324-78590346 GATGCAGAGGCTGTTGGCCCAGG - Intergenic
1152177515 17:78797560-78797582 CTGGCAGAGGCTGCTGCCCCTGG - Exonic
1152183550 17:78840421-78840443 CCTGCACAGACAGCGGGCCCCGG + Exonic
1152222191 17:79075001-79075023 GCTGCAGGGGCTGGCGGCCCCGG + Exonic
1152376006 17:79919363-79919385 CCTGCCTAGGGTGCAGGCCTGGG - Intergenic
1152676749 17:81645219-81645241 CCTGCTGGGGCTGCTGGCCCTGG + Exonic
1152887239 17:82859672-82859694 CCAGCAGAGGCTGGAGGCCAGGG + Intronic
1152926028 17:83088168-83088190 CCTGCAGAGGCGGCTGGTGCAGG - Intronic
1152941905 17:83177222-83177244 CCTGCAGAGCCTGCTGGAGCCGG + Intergenic
1153027021 18:681310-681332 GCTGCAGAGCCTGCAGGTCCAGG - Intronic
1153139480 18:1954937-1954959 CCAGCTGTGGCTGCAGACCCAGG - Intergenic
1153304140 18:3617058-3617080 CCTGGAGAGACTGCAAGCTCAGG + Intronic
1153468615 18:5417376-5417398 CCTGCAGAGGAAACTGGCCCTGG - Intronic
1153818085 18:8808224-8808246 GCTGCTGATGCTGCAGGCCGGGG - Intronic
1154016203 18:10620053-10620075 CCAGCAGAGGGTGCAAGCACTGG + Intergenic
1154107438 18:11534536-11534558 CCTGCAGAGACTGCAGGAGAAGG - Intergenic
1154218374 18:12431880-12431902 CCTGCTGGGGCTGGAGGCCATGG + Exonic
1154279374 18:12989253-12989275 CCTGCAGAGGCCCCATGACCAGG - Intergenic
1155414496 18:25582259-25582281 CCTGCAGTGGTTACAGGCTCTGG - Intergenic
1155819080 18:30352540-30352562 CCAGCTGAGGCTCCAGACCCAGG + Intergenic
1155972329 18:32093188-32093210 CCTGCGGCGTCTTCAGGCCCCGG + Intronic
1156445399 18:37233054-37233076 CCTGCATAGACTGCAGTCCTTGG + Intergenic
1157323723 18:46654403-46654425 CCTGCACAGGCTTCCAGCCCCGG - Intronic
1157512810 18:48290683-48290705 CAGGAAGAGGATGCAGGCCCAGG - Intronic
1158766709 18:60458954-60458976 TGTGCAGAGGCTGCAACCCCTGG - Intergenic
1158960533 18:62584307-62584329 CCTGCAGAGAATGCGGGCCTTGG + Intronic
1159914935 18:74180410-74180432 CCTCTGGAGGCTGCAGGCCGGGG - Intergenic
1159954231 18:74508042-74508064 CCTGCTGAGGCTGCGGGACCTGG + Intronic
1160517489 18:79486609-79486631 CCTGCTGTGGCAGCAGGGCCGGG - Exonic
1160621475 18:80174181-80174203 CCTGGAGAGGATACAGGGCCTGG - Intronic
1160986130 19:1839781-1839803 CCTGCAGAAGCAGCAGTGCCTGG + Intronic
1161060401 19:2211815-2211837 CCTGCAGGAGCTGCTGGGCCAGG + Exonic
1161124086 19:2546300-2546322 CCTGGAGAGGCTGCAGGTGCAGG - Intronic
1161126714 19:2561950-2561972 CCAGCAGAGGCAGCTGCCCCGGG + Intronic
1161383019 19:3976522-3976544 CCTGCAGCGCCTGCCGCCCCGGG - Exonic
1161466222 19:4432137-4432159 CCTGGAGACCCTGCCGGCCCAGG + Exonic
1161592372 19:5134620-5134642 CCTGGGGAGGCTGCATGCCCAGG - Intronic
1162021606 19:7870684-7870706 CCTGCAGAGGAGGCAAGGCCAGG + Exonic
1162116142 19:8430651-8430673 CCTGCAGTGGCTGAAGGACCCGG + Exonic
1162387003 19:10365672-10365694 CCACCTGAGGCTGCTGGCCCAGG - Exonic
1162925608 19:13929478-13929500 ACTGGGGAGTCTGCAGGCCCAGG + Intronic
1162997158 19:14343439-14343461 CCTGTGGATGCTCCAGGCCCAGG - Intergenic
1163126023 19:15244561-15244583 TCAGCAGATGCAGCAGGCCCCGG - Exonic
1163425152 19:17236740-17236762 CCTGCAGAGGCTACAGTGCAGGG + Intronic
1163650511 19:18515189-18515211 CCTGCAGAGACTGCCAGCTCGGG + Intronic
1163835622 19:19571701-19571723 CCTGCACAAGCTGCAGCTCCAGG - Intronic
1164697908 19:30260748-30260770 CCTGCAAAGGCTTCAGCCCCCGG + Intronic
1164756250 19:30691934-30691956 CGGGCAGAGGCTGCAGGCAGGGG - Intronic
1165049856 19:33134552-33134574 CCTGCAGGGGCGGCAGGGGCTGG + Intronic
1165171355 19:33894245-33894267 ACTGCAGAGGCTGGGGGCCGTGG - Intergenic
1165244959 19:34493485-34493507 CCCACAGATCCTGCAGGCCCTGG + Exonic
1165289931 19:34874817-34874839 GCTGCAGAGTCTGCAGGCCCTGG + Intergenic
1166098101 19:40554251-40554273 TCTGCAGCTGCTCCAGGCCCCGG - Exonic
1166232566 19:41433717-41433739 TCTGAAGAGGCTGGAGGCCTGGG - Intronic
1166412016 19:42561712-42561734 CCTGCAGAGGGCGCATCCCCTGG - Intergenic
1166499679 19:43331363-43331385 CCCGCAGAGGATGCATCCCCTGG - Intergenic
1167146001 19:47681078-47681100 CCTGCGGCTGCTGGAGGCCCAGG - Exonic
1167299893 19:48672304-48672326 TCACCAGAGGCTGCTGGCCCTGG - Intronic
1167367843 19:49064270-49064292 CCTGGAGTGGCTGCCTGCCCTGG + Intronic
1167476914 19:49706514-49706536 CCTGCAGAGTCTGTAGACCAGGG + Intronic
1167483796 19:49748373-49748395 CCTGCAGAGACTGCACGTGCTGG + Exonic
1167636282 19:50658009-50658031 CCTGGAGGTGCTGCAAGCCCTGG + Exonic
1167792945 19:51692149-51692171 TCTGCAGAGACTCCAGGCCCAGG - Intergenic
1168276962 19:55284100-55284122 CCGGCGGATGCTGCAGGCCGAGG - Intronic
1168332394 19:55578202-55578224 GCTGCAGGCACTGCAGGCCCAGG - Exonic
1168667649 19:58216872-58216894 GCGTCAAAGGCTGCAGGCCCTGG + Intergenic
1168689576 19:58368669-58368691 CCAGGAGAGGCTGCAGGCGACGG - Exonic
1168722179 19:58560171-58560193 GAAGCAAAGGCTGCAGGCCCTGG - Intergenic
925118382 2:1398924-1398946 CCTGAGGAAGCTCCAGGCCCAGG + Intronic
925296943 2:2783557-2783579 ACTGGAGAAGCAGCAGGCCCAGG + Intergenic
925390410 2:3490364-3490386 CCTGCAGAGGCCGGGAGCCCTGG - Intergenic
925434497 2:3825226-3825248 ACTGCAGAAGCTGCAGGTACAGG - Intronic
925676848 2:6371597-6371619 CCTGGAGAGGATGAAGGCCTGGG + Intergenic
925723536 2:6851508-6851530 GTTGCAGAGGCTGCAGGGCCGGG - Exonic
925893766 2:8456410-8456432 CTTGGTGAGGCTGCAGGCCTGGG - Intergenic
925905044 2:8535211-8535233 GCTGCAGTGGCTCCAGGCCTGGG - Intergenic
926054427 2:9766170-9766192 CGACCTGAGGCTGCAGGCCCAGG + Intergenic
926115536 2:10210661-10210683 CCCGCAAAGCCTGCAGGCCAGGG + Exonic
927141875 2:20136357-20136379 GCTGCAGAGGCCGCAGGGCCTGG + Intergenic
927154041 2:20211710-20211732 GCAGCACAGGCTGCAGGGCCTGG + Intronic
927634145 2:24799739-24799761 GCTGCAGAGCGTGCAGGCCCAGG + Exonic
928085516 2:28344144-28344166 GTTGCAGAGGCGGCTGGCCCGGG - Intergenic
928086035 2:28346961-28346983 CCTGCAGAGGCTGCAGGAAGAGG + Intergenic
928172249 2:29011303-29011325 CCTGCAGAGGCTCTTGGCCCAGG - Intronic
928292948 2:30056006-30056028 GCAGGAGAGGCGGCAGGCCCGGG - Intergenic
928401783 2:30984272-30984294 GCTGAACAGGCTGCTGGCCCGGG - Intronic
928419673 2:31128619-31128641 CCAGCAAACCCTGCAGGCCCAGG + Intronic
930099457 2:47591695-47591717 CTTGCAGAGGCAGTAGGCTCAGG - Intergenic
930695876 2:54411301-54411323 CAGGTAGAGGCTGCTGGCCCAGG + Intergenic
930701112 2:54457751-54457773 CCAGCAGAAGCTGCAGGACAAGG - Intronic
930712217 2:54559646-54559668 CCTGCCCAGCCAGCAGGCCCTGG + Intronic
930720286 2:54631467-54631489 GCGGCAGCGGCTGCAGGCCCTGG + Exonic
930873864 2:56192632-56192654 CCTGCAGAAGCTGAAAGACCTGG + Exonic
931006089 2:57850793-57850815 GCAGCAGAGGCTCCAGGCCTGGG + Intergenic
931429546 2:62197194-62197216 CCTGCCGGGGCTGCGGGCGCGGG + Intronic
931643897 2:64404479-64404501 CCGGCACAGGCTGCAGGCCAAGG + Intergenic
932105129 2:68935378-68935400 CCTGGAGGAGCTGCAGGCCCTGG - Intergenic
932452211 2:71818713-71818735 CCAGAAGAAGCTTCAGGCCCAGG + Intergenic
932739821 2:74282920-74282942 CGGGCAGTGGCTTCAGGCCCTGG + Intronic
933416393 2:81991969-81991991 CCTGGAGAGGCTACAGTCACAGG - Intergenic
934770134 2:96902565-96902587 CCTCCAGAGCCCGCAGGCCATGG + Intronic
935076316 2:99748051-99748073 CCTTCAAAAGCTGCAGCCCCAGG - Intronic
935341319 2:102062117-102062139 CCTGGAGAAGCTGAAGTCCCAGG - Intergenic
935573613 2:104687466-104687488 GGTGCAGAGGCTGCAATCCCTGG + Intergenic
935584396 2:104787779-104787801 ACTGCCGAGGCTGCTGGTCCAGG - Intergenic
935649720 2:105371940-105371962 CCTGCAGAGGCTGGAAACTCGGG - Intronic
936088153 2:109483778-109483800 CCTCCCCAGGCTGCAGGCGCTGG + Intronic
937310521 2:120900022-120900044 CATGCAGAGGCTGCCGGCCGGGG + Intronic
937523041 2:122734840-122734862 TCTCCAGAGGCAGCAGGCCAGGG + Intergenic
938102252 2:128505104-128505126 CCTGCACAGTTTGCAGGGCCAGG - Intergenic
938158132 2:128958743-128958765 GCTGCAGAGATGGCAGGCCCTGG + Intergenic
938187109 2:129241182-129241204 CTTGCAGAGGCAGCAGGCACAGG - Intergenic
939925751 2:148172209-148172231 CCAGCAGTGGCTGTAGACCCTGG + Intronic
940612288 2:156006779-156006801 ACTTCTGAGCCTGCAGGCCCGGG + Intergenic
941376017 2:164731873-164731895 GCATCAGAGGCTGCAGGCCTGGG - Intronic
942210563 2:173665205-173665227 CCTGCAGAAGCTGATGTCCCAGG + Intergenic
942585167 2:177466844-177466866 CCAGCTGTGGCTGCAGACCCAGG - Intronic
946410486 2:219513009-219513031 CAGGCAGAGGCTGCGGGGCCAGG + Intergenic
947590690 2:231383399-231383421 CATGCAGGGGCTGTAGGCCAGGG - Intergenic
947952743 2:234161983-234162005 CTTGGAGAGGCTTCAGGCTCTGG - Intergenic
947985303 2:234442457-234442479 ACAGCAGAGACTGCAGGCCCAGG - Intergenic
948036105 2:234859365-234859387 CATGCTGAGGCTGCAGGTCAGGG - Intergenic
948272363 2:236684331-236684353 CCTGCAGATGGTGCAGTCTCGGG + Intergenic
948542471 2:238700424-238700446 CCTGATGAGGGTGCAGGCACCGG + Intergenic
948764473 2:240212419-240212441 CTGGCTGAGGCTCCAGGCCCTGG - Intergenic
948766857 2:240226904-240226926 GGTGCAGGAGCTGCAGGCCCGGG - Intergenic
948783700 2:240340198-240340220 CCTGCGGCGGCAGCAGGGCCCGG + Intergenic
948806952 2:240457121-240457143 TCCGCAGGGGCTGCAGGTCCAGG - Intronic
948849852 2:240700216-240700238 TGTGCAGAGGCTGCAGGCACTGG - Intergenic
948909211 2:240994578-240994600 CCTGCAAAGGGTGCTGCCCCCGG - Intergenic
948909535 2:240996180-240996202 TCTGCACAGGGTGCAGGCCGAGG + Intergenic
949007038 2:241655660-241655682 CCTGCAGAGGTGGAAGGGCCCGG - Intronic
949036364 2:241817296-241817318 CCTTCCGAGGCTGCAGGGCCAGG + Exonic
949037294 2:241821704-241821726 CCTGTAGAGCCTGCAGAACCGGG + Intergenic
1168753223 20:298046-298068 CCGGCGGCGGCGGCAGGCCCGGG + Exonic
1168789917 20:569040-569062 TCTTCAGAGGCTGCAGACACAGG - Intergenic
1168959716 20:1860541-1860563 CCTGCTGAACATGCAGGCCCAGG + Intergenic
1168973263 20:1945497-1945519 CCTGCGGGGGCAGAAGGCCCAGG - Intergenic
1169303649 20:4469493-4469515 CCTCCCCAGGCTCCAGGCCCAGG + Intergenic
1170161677 20:13319801-13319823 CCTGATGCTGCTGCAGGCCCAGG - Intergenic
1170221449 20:13946687-13946709 CCAGCTGCGGCTGCAGACCCAGG + Intronic
1170759763 20:19239364-19239386 CCTGGAGAGGCTGCTGGCAGTGG - Intronic
1170962031 20:21034080-21034102 CCTGAAGTGGCTGCAGGGCCTGG - Intergenic
1170969734 20:21105442-21105464 CCCTCTGAGGCTGCAGCCCCCGG + Intergenic
1171033979 20:21702206-21702228 CCCGCAGGGGCCGCAGGGCCGGG - Intergenic
1171417213 20:24991139-24991161 CCCTCAGGGGCTGTAGGCCCTGG + Intronic
1171419518 20:25008561-25008583 CCCTCAGAGGCGGCAGGGCCAGG - Intronic
1172082970 20:32357537-32357559 CCTGGAGAGAATTCAGGCCCTGG - Intergenic
1173247823 20:41348455-41348477 CCAGCAGTGGCTACAGGGCCAGG + Intronic
1173255933 20:41394370-41394392 CCTGCAGAAGAGGCAGACCCAGG - Intergenic
1173649212 20:44652138-44652160 CCTGCAGGTTCTGCAGGCCACGG - Intronic
1173921631 20:46750522-46750544 CCTCCAGAGGCAGCTGGCCTGGG - Intergenic
1174192234 20:48748777-48748799 CGTGGGGAGGCCGCAGGCCCAGG + Intronic
1174412200 20:50343542-50343564 CCTCCAGGGTCTGCAGGACCAGG + Intergenic
1174715030 20:52748407-52748429 CCAGGAGAGGCTGATGGCCCTGG - Intergenic
1175166053 20:57045473-57045495 GCTGCTGATGCTGCAGGCCCGGG - Intergenic
1175246229 20:57583747-57583769 CCTGCTGTGGCTCCAGGCCCTGG + Intergenic
1175250714 20:57608831-57608853 CCTCCAGTGCCTGAAGGCCCAGG - Intronic
1175315800 20:58045741-58045763 CCTGCAGGGGCTGCATCCTCTGG - Intergenic
1175466070 20:59191961-59191983 CCTGCAGCGGCAGCAGGCGACGG + Exonic
1175522692 20:59612240-59612262 ACTGCAGCGTCTGCAGGGCCGGG + Intronic
1175787868 20:61723434-61723456 CCGGAGGAGGCTGCAGGCCCTGG - Intronic
1175945285 20:62555721-62555743 CCTGCAGCGGCTGGAGGCCTTGG + Intronic
1176074665 20:63242970-63242992 CCTGCACAGGCTGGAGGACCCGG - Intronic
1176104478 20:63379468-63379490 CCAGCTGTGGCTGCAGACCCAGG + Intergenic
1176105139 20:63382353-63382375 ACTCCAGAGGCTGTAGGGCCAGG - Intergenic
1176118484 20:63443718-63443740 CCAGCAGAGGCTCCACGCCAGGG + Intronic
1176123366 20:63464216-63464238 CCAGCACAAGCTGCTGGCCCTGG + Intronic
1176146159 20:63566453-63566475 CCTGAAGACGCAGCAGGGCCGGG + Exonic
1176258642 20:64167240-64167262 CGAGCAGCGGCTGGAGGCCCCGG - Intronic
1177736170 21:25092751-25092773 GCAGCAGAGGCTCCAGGCCTGGG + Intergenic
1178492874 21:33064525-33064547 CCTGCAGAGGCAGAAGGTTCTGG - Intergenic
1178493742 21:33070472-33070494 CCGGCCGAGCCTCCAGGCCCCGG + Exonic
1178809607 21:35869345-35869367 CCTGCAGAGGCAGTAGGGCAGGG - Intronic
1179174927 21:39001271-39001293 CCTGCAAAGGGTGTAGGCCTGGG - Intergenic
1179635105 21:42703707-42703729 CCGGCAAAGGCTGCTGGCCTTGG + Intronic
1179814173 21:43893247-43893269 CTAGCAGAGGCTGCTGGCTCAGG - Intronic
1179815071 21:43900463-43900485 CCTGCAGAGTCTCCAGCCACAGG + Intronic
1179889037 21:44326609-44326631 CATGCACAGGCTGCAGGGTCGGG + Intronic
1179983345 21:44907679-44907701 CCTGTAGAGGCAGCAGGCTCGGG - Intronic
1179994037 21:44965806-44965828 CCTTCACAGGCTGCAGACCCAGG - Intronic
1180031563 21:45212327-45212349 TCTGTAGAGGCGGCAGCCCCAGG - Intronic
1180086709 21:45510847-45510869 TCTGCAGAGGCTGCCTGGCCAGG + Intronic
1180219694 21:46350715-46350737 CCTGCAGAGAGTCCAGGCCGGGG + Intronic
1180500098 22:15922887-15922909 CCTGAAGAGGCTGAAGGCCAGGG + Intergenic
1180614629 22:17119579-17119601 CCTCCAGGGCCTCCAGGCCCCGG + Exonic
1180924483 22:19544359-19544381 CCGGGAAGGGCTGCAGGCCCTGG - Intergenic
1180946122 22:19694534-19694556 CCAATGGAGGCTGCAGGCCCCGG - Intergenic
1180951931 22:19724365-19724387 CCTGCGGAGGCTGCGGGCCCGGG + Exonic
1181263948 22:21619270-21619292 CCTCTAGAGGCAGCAGGCCCTGG - Intronic
1181478171 22:23181134-23181156 CCTGCAGACGTTGCTGGCCAAGG + Exonic
1181486956 22:23237582-23237604 CCTGCAGAGTTTGCAGCCCCAGG + Intronic
1181645834 22:24231504-24231526 CCAGCTGACGCTGCAGGACCTGG - Exonic
1181898414 22:26131628-26131650 CTTGCAGAGGAGGCAGGGCCGGG + Intergenic
1182128295 22:27832505-27832527 GCTGCAGAACTTGCAGGCCCAGG - Intergenic
1182147501 22:28005690-28005712 CCTGCAGAGGCAGGAGGCCTTGG - Intronic
1183033946 22:35126656-35126678 CCTGCAGAGGTGGCTGCCCCAGG - Intergenic
1183080315 22:35451895-35451917 CCTGCAGAAGCCACAGGGCCTGG - Intergenic
1183082481 22:35465361-35465383 CCTGTGAAAGCTGCAGGCCCTGG - Intergenic
1183082867 22:35468014-35468036 CCTGTGAAAGCTGCAGGCCCGGG - Intergenic
1183197144 22:36361305-36361327 CCTGCAGATGGGGCAGGCTCTGG - Intronic
1183616702 22:38950198-38950220 TCTGCAGAGCCTGAAGCCCCTGG + Intergenic
1183723233 22:39574300-39574322 CCAGCAGCGGCTGCAGCCACCGG - Intronic
1184455882 22:44609197-44609219 CCTCCCCAGGATGCAGGCCCAGG - Intergenic
1184679335 22:46061822-46061844 TCTGCAGCGGCTCCGGGCCCAGG + Intronic
1184737843 22:46409638-46409660 CCACCAGAGGCTGCCGGACCTGG + Intronic
1184863659 22:47190906-47190928 TCTGTCGAGGCTGAAGGCCCAGG + Intergenic
1184867657 22:47210348-47210370 GTTTCAGAGCCTGCAGGCCCCGG - Intergenic
1185088128 22:48751731-48751753 CTGGCAGAGGCTGCCGGCCCGGG - Intronic
1185141163 22:49102071-49102093 CCTGCAGAGGAGACAGGCACAGG + Intergenic
1185301519 22:50083621-50083643 CAGGCAGGGGCTCCAGGCCCAGG + Intronic
949980536 3:9499676-9499698 CTTTCAGAGGCTGGAGGCCCGGG - Exonic
950026830 3:9825854-9825876 CCTGCAGCAGCTGCAGGCCGTGG + Exonic
950443330 3:13022438-13022460 ACAGCAGTGGCTGCAGGCCAGGG + Intronic
950446591 3:13042300-13042322 CATGCAGGGGCTGTAGGCACAGG + Intronic
950496975 3:13339718-13339740 CCTGCAGTGACTGCAGACCCAGG + Intronic
950709794 3:14805971-14805993 GCTGAAGAGGCTGCAGGGCCAGG + Intergenic
950864219 3:16175818-16175840 GCTGCTGACGCTGCTGGCCCAGG - Intronic
952736422 3:36695797-36695819 CCTGGATAGACTGCTGGCCCAGG + Intergenic
954583886 3:51718289-51718311 ACTGCAGAGGCTCCTGGCCAAGG - Exonic
954801427 3:53189237-53189259 CCTGGAGAAGGTGGAGGCCCTGG + Exonic
954813266 3:53260979-53261001 CATGCAGAGTCTGCAGGGACAGG + Intergenic
954915863 3:54148324-54148346 CCAGTACAGGCTGCAGACCCAGG + Intronic
954994325 3:54867678-54867700 CCTGCACTGGCTTCATGCCCAGG + Intronic
955526831 3:59829768-59829790 GATACAGAGGCTGCAGGCCCAGG + Intronic
956469764 3:69554501-69554523 CCCACAGAGGGTGCAAGCCCCGG - Intergenic
958638605 3:96777124-96777146 AGTGCGGAGGCTGCGGGCCCAGG + Intergenic
959455349 3:106553118-106553140 CCTGCAGAGACTACATGCCATGG + Intergenic
959825920 3:110795560-110795582 ACTGCTGATGCTGCAGGTCCAGG + Intergenic
960005320 3:112775564-112775586 CCTTCAGTGGCTCAAGGCCCTGG + Intronic
960047575 3:113212265-113212287 CCCGTAGCGGCTGCAGCCCCCGG - Intronic
960055102 3:113271352-113271374 AGTGCAGAGAGTGCAGGCCCAGG - Intronic
960669192 3:120140347-120140369 CCGGCCGGCGCTGCAGGCCCCGG + Intergenic
960687226 3:120306828-120306850 TCTGCAGAGACTGCGGGCCTCGG - Intergenic
961167320 3:124772415-124772437 CCAGCAGCCGCTGCAGGCGCAGG + Intronic
961384794 3:126517451-126517473 CCCGCACAGGCTGGAGCCCCTGG + Intronic
961533108 3:127551991-127552013 CCAGGAGAGGCTGCATTCCCTGG + Intergenic
961649676 3:128411108-128411130 CCTTCAAAGGCTGCGCGCCCTGG - Intergenic
961682410 3:128608068-128608090 CCTGGAGCACCTGCAGGCCCTGG - Intergenic
961723657 3:128911873-128911895 CCTGCAGAGGTCTCAGGCCTTGG + Intronic
961741710 3:129037096-129037118 CCTGCAGAGGCTCCGGGACCTGG + Exonic
962134393 3:132719054-132719076 ACTTCAGAGGCTACAGGCTCAGG - Exonic
962611087 3:137076755-137076777 TCTGCAGAGGTGGCAGGCCAGGG + Intergenic
962918906 3:139934516-139934538 CCTGCTGAGGCTGCAGTGGCGGG - Intergenic
963051444 3:141147191-141147213 CCTGCAGGCGCTGGCGGCCCAGG - Exonic
963444279 3:145383570-145383592 CCTAGAGAGGCTGAAGTCCCTGG + Intergenic
964674494 3:159262572-159262594 CCTGCAGCGGCAGGAGCCCCTGG + Exonic
967016691 3:185488712-185488734 CCTCCAGTGACTGCAGGCCAAGG + Exonic
967340366 3:188390553-188390575 CCAGCAGTGGCTGCAGGCCAGGG - Intronic
968468406 4:764690-764712 TCTGCAGGGGGTGCAGGCGCAGG - Intronic
968701030 4:2058573-2058595 CCTGCAGACGCCGCAGGCTGGGG - Intergenic
968753500 4:2402396-2402418 CAAGCAGAGGCTGCAGGACATGG - Intronic
968756134 4:2417520-2417542 CCCGCCGAGGCTGCTGGCCACGG + Intronic
968797360 4:2716415-2716437 CCAGGAGACGCTGCTGGCCCAGG - Intronic
968894089 4:3388654-3388676 GCAGCAGGGGCTGCAGGCGCTGG - Intronic
969508882 4:7605844-7605866 CCAGCAGAGGCTGCAGCCAGTGG + Intronic
969606012 4:8202652-8202674 CTTGCAGAGGCGACAGCCCCTGG - Intronic
969630610 4:8333734-8333756 CCTGCAGCAGCGGCAGGCTCTGG + Intergenic
969840470 4:9877958-9877980 ACTGCATTGGCTGCTGGCCCCGG - Intronic
969869716 4:10097071-10097093 CCCTCAGATGCTGCTGGCCCCGG + Intronic
970542731 4:17095893-17095915 CCTGGATGGGCTGCAGGGCCAGG - Intergenic
971254617 4:25002769-25002791 CCAGCACAGGCTGTAGGCCCAGG - Exonic
973981813 4:56314249-56314271 GGAGCAGAGGCTGCAGGCGCTGG + Exonic
974260474 4:59518740-59518762 CCAGCAGTGGCCGCAGGGCCCGG + Intergenic
975281475 4:72568070-72568092 TGGGCAGAGGCTGCAGGCGCCGG - Intronic
975395539 4:73869697-73869719 CCTGCAGGGTCTGCAAGCACTGG - Exonic
975401451 4:73944085-73944107 CCTGCAGGGTCTGCAAGCACTGG + Intergenic
975409950 4:74038363-74038385 CCTGCAGTGTCTGCAAGCACTGG + Exonic
975415335 4:74098872-74098894 CCTGCAGGGTCTGCAAGCACTGG + Exonic
977709024 4:100103253-100103275 ACTGGAGAAGCTGCAGACCCAGG - Intergenic
980889344 4:138797379-138797401 AATGCAGAGGCTGCAGCCCCAGG + Intergenic
981490945 4:145338667-145338689 CCAGCAGAGGCTACTGTCCCTGG - Intergenic
982202568 4:152974710-152974732 GCTGCAGAGGCTGAAGGAGCAGG + Exonic
985394298 4:189525609-189525631 GCTTCAGAGGGTGCAAGCCCAGG + Intergenic
985638186 5:1050519-1050541 CGTGCAGAGGCTGCAGCCCAGGG + Exonic
985692869 5:1323276-1323298 GCAGCAGAGGCTGGAGGCTCCGG + Intronic
985723058 5:1500894-1500916 CATGCAGAGGCAGCTGGACCTGG - Intronic
985839974 5:2298789-2298811 CCTGCAGAGTCTGAAAACCCTGG + Intergenic
985850314 5:2383775-2383797 CCAGCTGAGGTTGCAGGCTCTGG + Intergenic
986004908 5:3659482-3659504 CCTTCAGAGGCTGCCGGGCTGGG - Intergenic
986014852 5:3748830-3748852 CAGGCAGAGGATGCAGGCTCTGG - Intergenic
986132230 5:4942358-4942380 GCTGCCCAGGCTGCAGGGCCTGG + Intergenic
986335142 5:6749119-6749141 CCTGCAGCGGCTGCTGAGCCAGG - Intronic
986540577 5:8840413-8840435 CCAGCAGAGGGAGCAGGCTCCGG - Intergenic
987056009 5:14192414-14192436 CCTGTAGTGGATGCACGCCCAGG + Intronic
987422374 5:17735637-17735659 CCTACATAGGTTGCAAGCCCAGG + Intergenic
988547911 5:32174714-32174736 CCTGCCGATCCTGCAGACCCCGG - Intergenic
989477949 5:41895632-41895654 CATGCAGAGGATTCAGGCTCTGG + Intergenic
992157730 5:73971536-73971558 CCTGCGCAGGCTGCAGGCTCAGG - Intergenic
992769801 5:80035959-80035981 CCGGCACAGGGTGCAGGACCCGG - Intronic
994209441 5:97072125-97072147 CCTGTGGAGGATGCAGGCCTGGG - Intergenic
994853905 5:105091605-105091627 CTTCCAGGGGCTGCTGGCCCTGG - Intergenic
997732379 5:136191138-136191160 TCTTCAGGGGCTTCAGGCCCAGG + Intergenic
998530453 5:142879823-142879845 CCTGCTTAGGCTGCAAGTCCTGG - Intronic
998546345 5:143031182-143031204 CCTGAAGAAGCTGGAGGGCCAGG + Intronic
998689034 5:144566667-144566689 CCAGCAGAGGCAGCAGACCCTGG + Intergenic
999188510 5:149730427-149730449 CCGGCTGGGGCTGCGGGCCCGGG + Intronic
999310812 5:150550745-150550767 CCTGCTGAGGCTGTGGGCCATGG + Intronic
999368041 5:151035602-151035624 AGTGGAGAAGCTGCAGGCCCAGG - Exonic
999372371 5:151063840-151063862 GCTTCTGAGGCTCCAGGCCCTGG + Intronic
999926390 5:156383358-156383380 CATGCACATGCTGCACGCCCGGG - Intronic
1000091230 5:157931313-157931335 GCTGCAGGGGCTGCAGAGCCTGG + Intergenic
1001756696 5:174175799-174175821 CCTGCAGCAGCTCCAGGCCTGGG + Intronic
1001778117 5:174344409-174344431 CCTGCACAGGCAGGAAGCCCAGG - Intergenic
1002000509 5:176194166-176194188 GCTGCAGAAACAGCAGGCCCAGG + Intergenic
1002046117 5:176542803-176542825 CCTGGAGCGGCTGCAGGTCCGGG - Intronic
1002181327 5:177432592-177432614 CCATGAGAGGCTGCAGGCCAGGG - Intronic
1002253827 5:177944815-177944837 GCTGCAGAAACAGCAGGCCCAGG - Intergenic
1002270849 5:178070959-178070981 CCTGCAGACCCTGGGGGCCCTGG + Intergenic
1002296416 5:178233512-178233534 CCTGCACCTGCTGCAGTCCCAGG - Intergenic
1002298942 5:178246888-178246910 CCTGGTGGGGCTGCAGGCTCGGG + Intronic
1002351665 5:178588283-178588305 CCAGCAGTGGCTGCCTGCCCAGG + Intronic
1002431177 5:179204836-179204858 CCTGCAGAGGCGGCGGGGCGTGG - Intronic
1003325397 6:5086406-5086428 CGTCCTCAGGCTGCAGGCCCGGG - Exonic
1004170429 6:13291656-13291678 CCTGCTGATGCTGCTGGTCCAGG + Intronic
1004267287 6:14159821-14159843 CCTGCACAGCCTGCAGAACCAGG + Intergenic
1004516101 6:16323571-16323593 TCTGCAGAGGCTGCCAGGCCTGG + Intronic
1004634580 6:17454454-17454476 GGAGCAGAGGCTGCAGGCCGAGG - Intronic
1005775708 6:29129450-29129472 CCAGCTGTGGCTGCAGACCCGGG + Intergenic
1005889737 6:30127321-30127343 CCGGCACTGGCTGCTGGCCCAGG + Intergenic
1005997695 6:30941340-30941362 ACTGTAGAGGCTGCCAGCCCTGG + Intronic
1006171104 6:32093536-32093558 CCTTCCGAGGCTTTAGGCCCAGG + Intronic
1006176386 6:32124618-32124640 ACTGCAGGGGCTACAGGGCCAGG - Intronic
1006428476 6:33980652-33980674 GAGGCAGGGGCTGCAGGCCCCGG + Intergenic
1006834741 6:36991002-36991024 CCAGCAGAAGCTGGAGGTCCAGG - Intergenic
1007380643 6:41488272-41488294 CTTGGAGAGGCTGCAGGGGCAGG - Intergenic
1007760109 6:44128273-44128295 GCTGGAGAGGCGGCCGGCCCCGG + Intronic
1008410649 6:51174699-51174721 CCTGAAGAGGCTGCAGGCTCTGG + Intergenic
1009407112 6:63326715-63326737 CCGGCAGGCGCTGCTGGCCCTGG - Intergenic
1009413397 6:63392287-63392309 CCTGCAGCAGAGGCAGGCCCAGG - Intergenic
1011304180 6:85908640-85908662 TCTACAGAGGCAGCAGGCCTTGG + Intergenic
1011318608 6:86065113-86065135 CCAGCAGAGGCTGCAGAACAAGG + Intergenic
1011416211 6:87122616-87122638 CCTGGAGATGCTGCTGGCGCTGG - Intergenic
1011930277 6:92701935-92701957 TCTGCAGAGCCTGCAGGGGCTGG - Intergenic
1012235611 6:96811058-96811080 TCTGCAGATTCTGCAGGACCTGG + Intronic
1013086897 6:106864504-106864526 CCTGCTGTGGCTCCAGACCCAGG - Intergenic
1014740977 6:125147389-125147411 CCAGCAGCTCCTGCAGGCCCTGG + Intronic
1015624348 6:135164973-135164995 TCTGCAGAGGCTGCATCACCTGG - Intergenic
1016034874 6:139374801-139374823 GCTGCAGAGGCTGCGGGGCCCGG + Intergenic
1016979745 6:149843410-149843432 CCTGCTGAGACGGCAGGGCCTGG - Intronic
1017117955 6:150996632-150996654 CCTGCTGAGCCTACAGCCCCAGG + Intronic
1017711009 6:157167991-157168013 CCTTCAGAGACTGCAGGGCGTGG + Intronic
1017776623 6:157685930-157685952 TCTGGAGGGGCTGCAGGCCCAGG + Intergenic
1018705527 6:166461030-166461052 CCTGCAGTAGCTGTGGGCCCTGG - Intronic
1018744935 6:166754665-166754687 CCTGGAGAGGCTGCTCCCCCAGG - Intronic
1018774220 6:166998873-166998895 CCTGCAGCCCCTGCAGCCCCGGG - Intergenic
1018987440 6:168648538-168648560 GCTGCAGAGGCTGCTGGCCGCGG - Intronic
1019155718 6:170037650-170037672 TGGGCAGAGGCTGCAGGTCCTGG - Intergenic
1019279117 7:191504-191526 GCTGGCGAGGCTGCTGGCCCAGG + Intergenic
1019290087 7:246059-246081 CCTGCACTGGCTGGGGGCCCCGG - Intronic
1019400949 7:853522-853544 GCTACAGAAGCTGCAGGCTCGGG + Exonic
1019430724 7:997747-997769 CCTGGAGGGGCTGCAGGGCCGGG - Exonic
1019525530 7:1478813-1478835 CCTGCAGATGCTGCAGTGGCTGG - Exonic
1019670974 7:2278177-2278199 CCTGCAGGAGCTGCTGGCCAGGG - Exonic
1020082722 7:5295518-5295540 TCTGCAGGGGCTGGAGGCCAGGG - Intronic
1020703891 7:11518003-11518025 CCTGCAGAGACAGAAGGACCTGG + Intronic
1021759715 7:23891870-23891892 ACTTCAGAGGCTGCTGGCCTAGG - Intergenic
1021911441 7:25389337-25389359 GCTGATGAGGATGCAGGCCCAGG + Intergenic
1022131519 7:27409262-27409284 ACTGCACTGGCTGCAAGCCCTGG + Intergenic
1022524690 7:31029381-31029403 CCTCCAGAGCCTGCAAGTCCTGG - Intergenic
1023035369 7:36126891-36126913 CCTGCAGATGCTTCAGGGTCTGG + Intergenic
1023863604 7:44228760-44228782 GCAGCAGAGGCGGCAGGCCTGGG + Intronic
1023985101 7:45089389-45089411 CAAGCAGAGGGTGCAGGGCCTGG + Intergenic
1023998548 7:45176791-45176813 CCTGCAGTGGCCTCAGCCCCTGG + Intronic
1024048673 7:45602359-45602381 CCTGGACAGGCTGCAGGCAGCGG - Intronic
1025025560 7:55513621-55513643 TCTAAAGATGCTGCAGGCCCAGG + Intronic
1026529162 7:71182372-71182394 CCTGTGGACGCTGCTGGCCCAGG + Intronic
1029046865 7:97639253-97639275 CCAGCTGAGACTGCAGGCTCTGG + Intergenic
1029366575 7:100120197-100120219 TCTGCAGAGGCTGCAGGAGCCGG + Intronic
1030484617 7:110149664-110149686 CCAGCAGTGGCTGCAGACCCAGG - Intergenic
1030884164 7:114918826-114918848 CCTGCATAGGCTGCTGGACATGG - Intergenic
1031340444 7:120593927-120593949 CCAGCAGAGGCAGCAGGACATGG - Intronic
1031810824 7:126366625-126366647 CCTGCAAAGGCACCAGGCCAGGG + Intergenic
1032075104 7:128832398-128832420 CCTGCTGAGGATGCCGGCCCAGG - Intronic
1033608912 7:142946980-142947002 ACTGCAGAGGCAGGAGGCCATGG + Intronic
1033980794 7:147162956-147162978 CCTGGAGAAGCTGCTGGTCCAGG - Intronic
1034355121 7:150445258-150445280 CCTGCAGGAGCTCCAGGCCCAGG - Intergenic
1034845441 7:154440257-154440279 ACTGCAGAGACTGCAGGCGTGGG - Intronic
1035228309 7:157445621-157445643 CCAGCAGAGGCCTCAGGACCAGG - Intergenic
1035295679 7:157865766-157865788 CCTCCTGGGGCTGCAGCCCCAGG + Intronic
1035302806 7:157908062-157908084 CCTGGTGAGGCTGCAGGTTCTGG + Intronic
1035318381 7:158012545-158012567 CCAGCAGAGGCAGCAGTCCAGGG - Intronic
1035337361 7:158138465-158138487 CCTGCAGAGGCAGCCGGCTGAGG - Exonic
1035381744 7:158445147-158445169 TCTCCAGAGGGGGCAGGCCCTGG + Intronic
1035496613 7:159333287-159333309 CCAGAAGAGGCTGGAGGCCCAGG + Intergenic
1035651518 8:1269308-1269330 CCTGCAGAGGCTCCTGGTACGGG + Intergenic
1035676088 8:1456711-1456733 CCAGCAAACGCTGAAGGCCCCGG + Intergenic
1036204399 8:6794490-6794512 CCCGCAGAGGCTGAACCCCCTGG + Intergenic
1036398283 8:8386636-8386658 CCTCCAAAGTCTCCAGGCCCCGG + Intergenic
1036693938 8:10962445-10962467 CCTCCCTAGGCTGCAGCCCCGGG - Intronic
1036771741 8:11583152-11583174 CCTGCAGATGCTCCAGGGTCAGG + Intergenic
1037581863 8:20250069-20250091 GCTGCAGGAGCTGCGGGCCCAGG - Exonic
1038613815 8:29075408-29075430 GCTGCACAGGCTGGAGGGCCAGG + Intronic
1039211436 8:35219806-35219828 CCTGCATCAGCTGCAGGCCATGG - Intergenic
1040504472 8:48034929-48034951 CCTGGAGAGGCTGCAGGGAGGGG - Intronic
1040567701 8:48582237-48582259 CCTGGCGAGGCTGCATCCCCAGG - Intergenic
1041467708 8:58173718-58173740 GCTGCAGATGCTGCGGGTCCAGG - Intronic
1041713270 8:60911816-60911838 TCTGCAGGGGCTGCTGGCTCTGG - Intergenic
1044819283 8:96145014-96145036 TCGGCCGAGGCTGCGGGCCCGGG - Exonic
1046115517 8:109779119-109779141 GCTGCAGAGGTTGCTGTCCCTGG + Intergenic
1048348855 8:133599615-133599637 CCCTCAGAGGCTGCAGGGCTGGG + Intergenic
1048456875 8:134586539-134586561 CCAGCAGAGGCTGGAGACCATGG - Intronic
1049098632 8:140563704-140563726 AGAGCAGAGGCAGCAGGCCCTGG - Intronic
1049221589 8:141431131-141431153 CCAGCAGGGGCTCCAGGCCTTGG + Exonic
1049229847 8:141476279-141476301 CCTGCAGAGGCAGGTGGGCCAGG - Intergenic
1049288078 8:141787327-141787349 CCTGAAGGGCCTGCAAGCCCAGG + Intergenic
1049542933 8:143216550-143216572 CCTGCAGAGGAAGCAGGACTGGG + Intergenic
1049654814 8:143792836-143792858 TCCGGGGAGGCTGCAGGCCCAGG + Exonic
1049682235 8:143924552-143924574 CAAGCAGAGGCTGGAGGCCGAGG - Exonic
1049682928 8:143927751-143927773 CCAACAGAAGCTGCGGGCCCAGG - Exonic
1049687147 8:143943558-143943580 CCCGCACAGGCTGCAGGCTGAGG + Intronic
1049778168 8:144415833-144415855 GCTGCAGAGGATGCAGGCCCGGG - Exonic
1049783621 8:144440159-144440181 GCAGCTGAGGCTGCAGCCCCAGG - Exonic
1049974302 9:846965-846987 CCTGAGAAGGCAGCAGGCCCAGG + Exonic
1050343273 9:4662303-4662325 GCGGAAGAGGCTGCAGGGCCGGG + Exonic
1050362479 9:4843779-4843801 CCAGCAGTGGCTGCAGGCAGTGG - Intronic
1050483884 9:6114226-6114248 ACTGCAGAGGCTGTGGACCCAGG + Intergenic
1053297490 9:36925205-36925227 CCAGGAGGTGCTGCAGGCCCAGG + Intronic
1053473438 9:38363769-38363791 CCTCCAGAGGGTGCCAGCCCTGG - Intergenic
1053617250 9:39781266-39781288 CCTGGTGCGGCTGCAGACCCAGG + Intergenic
1053875432 9:42540629-42540651 CCTGGTGCGGCTGCAGACCCAGG + Intergenic
1054236268 9:62561095-62561117 CCTGGTGCGGCTGCAGACCCAGG - Intergenic
1054266916 9:62926171-62926193 CCTGGTGCGGCTGCAGACCCAGG - Intergenic
1054550409 9:66595625-66595647 CCTGGTGCGGCTGCAGACCCAGG - Intergenic
1056578000 9:87870612-87870634 CCTGCAAGGGCTGCAGGCTCAGG - Intergenic
1056809729 9:89754884-89754906 CTAACAGAGGCTGAAGGCCCAGG + Intergenic
1058415616 9:104785572-104785594 CCTGGACAGGCTTCAGGTCCGGG + Exonic
1058884690 9:109314360-109314382 CCTGCAGTGGATGAAGGCACAGG - Intronic
1059352726 9:113677059-113677081 CCTGCAGGGGCTGAGGGCCGTGG - Intergenic
1059418273 9:114175338-114175360 CCCGCTCAGGCTTCAGGCCCTGG + Intronic
1060054007 9:120397896-120397918 GATGCAGATGCTGCAGGTCCAGG + Intronic
1060588104 9:124799413-124799435 TCTGCAGCAGCTGGAGGCCCAGG - Exonic
1061163499 9:128909579-128909601 CCTGGAGAGACTGCATGGCCAGG + Intronic
1061478552 9:130884991-130885013 CCTGCAGAGGCTGCTGGTGGGGG - Exonic
1061479890 9:130892436-130892458 CCGGGAGTGGCTGCAGGCCCGGG - Intergenic
1061763999 9:132869944-132869966 CCTGGAGAGGCAGCAGGCGATGG - Intronic
1061823994 9:133246683-133246705 CCTGCTGAGGCTGCAGAGCAGGG + Intergenic
1061925033 9:133801832-133801854 CCTGCAGCTGCTGGAGGCCCCGG - Intronic
1062024087 9:134332500-134332522 CCTCCACAGGCAGCAGGACCAGG - Intronic
1062121095 9:134834444-134834466 ACTGCAGTGGGTGCTGGCCCAGG + Intronic
1062158613 9:135067614-135067636 CCTGCAGCTTCTGGAGGCCCTGG - Intergenic
1062332961 9:136052586-136052608 TCTGCCCAGGCGGCAGGCCCGGG + Intronic
1062418142 9:136464011-136464033 CCTGCAGAAGCTGCAGGAAGAGG + Intronic
1062463336 9:136670975-136670997 AGTGCAGAGGCTGCAGTCCAGGG + Exonic
1062542014 9:137045761-137045783 CCTGCAGGGCCTGCGGGCCTGGG + Intronic
1062559837 9:137136601-137136623 CCTGCAGAGGATGTAGAGCCGGG + Intergenic
1062578185 9:137218158-137218180 CCTGCACAGGCTGCTGGGCTCGG + Intergenic
1062627322 9:137449194-137449216 GCCGCAGAGGCTGCAGTCCCTGG - Exonic
1062652917 9:137587479-137587501 CCTCCAGAGGCTGCCGGTCCTGG + Intronic
1062658465 9:137615901-137615923 CCTGCAGACGTTCCAGCCCCAGG + Exonic
1062679685 9:137772037-137772059 CCTGCAGAGCCTGTGGGCACTGG + Intronic
1186479240 X:9883540-9883562 GCTACAGACGCTGCCGGCCCAGG + Intronic
1186785198 X:12950645-12950667 ACTGCACAGGCTGCACACCCTGG + Intergenic
1187257674 X:17656758-17656780 TCTGCAGGGGCTGCAGCGCCTGG + Intronic
1189216776 X:39332025-39332047 TTAGCAGAGGCTGAAGGCCCAGG - Intergenic
1189284958 X:39845565-39845587 CCAGGAGAGCCTGCAGACCCAGG + Intergenic
1189463316 X:41259748-41259770 CCTGCTGGGGATGCAGGACCAGG - Intergenic
1192270586 X:69575544-69575566 CCATCACAGGCTGGAGGCCCAGG - Intergenic
1195086296 X:101417540-101417562 CATTCACAGGCTGCAGGCACAGG - Intergenic
1198973728 X:142311194-142311216 CCTGGAAAAGCTGCAGGCCATGG - Intergenic
1200033232 X:153312767-153312789 CGTGCAGGGACTGCAGGCCTGGG + Intergenic
1200086816 X:153611150-153611172 GCTGGAGGGGCTGCAGACCCAGG - Intergenic
1200119539 X:153783841-153783863 CCTGCAGAGGCTGGAGGCCATGG + Exonic
1200292499 X:154886378-154886400 GCGGCAGCGGCTGCAGGCCTGGG + Exonic
1200339343 X:155382118-155382140 GCGGCAGCGGCTGCAGGCCTGGG + Exonic
1200347127 X:155458575-155458597 GCGGCAGCGGCTGCAGGCCTGGG - Exonic
1201755532 Y:17482289-17482311 CCTCCAGAAACTGCAGGCACAGG - Intergenic
1201846020 Y:18423696-18423718 CCTCCAGAAACTGCAGGCACAGG + Intergenic