ID: 1108360783

View in Genome Browser
Species Human (GRCh38)
Location 13:49666333-49666355
Sequence ATGTGGAAGCAGAGTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 712
Summary {0: 1, 1: 2, 2: 3, 3: 68, 4: 638}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108360772_1108360783 15 Left 1108360772 13:49666295-49666317 CCCTTGATAGGGAGAGCTATCTG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG 0: 1
1: 2
2: 3
3: 68
4: 638
1108360773_1108360783 14 Left 1108360773 13:49666296-49666318 CCTTGATAGGGAGAGCTATCTGG 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG 0: 1
1: 2
2: 3
3: 68
4: 638
1108360771_1108360783 16 Left 1108360771 13:49666294-49666316 CCCCTTGATAGGGAGAGCTATCT 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG 0: 1
1: 2
2: 3
3: 68
4: 638
1108360770_1108360783 22 Left 1108360770 13:49666288-49666310 CCTGCTCCCCTTGATAGGGAGAG 0: 1
1: 0
2: 1
3: 7
4: 147
Right 1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG 0: 1
1: 2
2: 3
3: 68
4: 638

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108360783 Original CRISPR ATGTGGAAGCAGAGTGGGGA GGG Intronic
900500238 1:3000908-3000930 ATGGTGAAGCAGAGTAGGGGAGG + Intergenic
900518426 1:3094259-3094281 CTGTGGAGGCAGGGTGGGGATGG - Intronic
900585711 1:3431330-3431352 GGCTGGAAGCAGAGTGTGGAGGG + Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
901422767 1:9162215-9162237 TGGTGGGAGCAGAGAGGGGAGGG - Intergenic
902077628 1:13800504-13800526 ATGTGGAGGAAGAGGGGAGACGG + Intronic
902102844 1:14007373-14007395 ATGTTGAATCAAAGTGGTGAGGG + Intergenic
903045845 1:20563606-20563628 GTGGGGATGCAGAGAGGGGAGGG + Intergenic
904078830 1:27859154-27859176 AAGGGGAAGCAGAGAGGTGACGG - Intergenic
904458971 1:30664176-30664198 ATGTGGAAAGGGAGTGGGGGAGG + Intergenic
904796812 1:33062475-33062497 ATATGGAATGAGAGCGGGGAAGG - Intronic
904797696 1:33069822-33069844 ATATAGAATGAGAGTGGGGAAGG - Intronic
904896460 1:33821774-33821796 CTGTGGGACCACAGTGGGGAGGG + Intronic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905121878 1:35688717-35688739 TTGAGGAGGGAGAGTGGGGAAGG + Intergenic
905796289 1:40818409-40818431 ATGTGGCAGGGGACTGGGGAGGG - Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906518249 1:46452244-46452266 AAGAGGAAGCAGAGTGGGGCTGG + Intergenic
906660187 1:47576400-47576422 CTGTGGAAGCAGCATGGGGCTGG + Intergenic
906698242 1:47839264-47839286 GTGAGCAAGCAGAGTGGGCACGG + Intronic
907311155 1:53539914-53539936 CTGTGGCTGCAGCGTGGGGAGGG - Intronic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907877102 1:58501707-58501729 ATGTGTGAGCAGAGATGGGAGGG - Intronic
910682928 1:89885835-89885857 CTGTGGAGGCAGAATGGGCAAGG + Intronic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
913159413 1:116131859-116131881 ATGTGGAGGCAGTGTGGAGGGGG + Intronic
913207383 1:116552831-116552853 ATGTGGGAGTAGAGTGGAGCTGG + Intronic
914813378 1:151045973-151045995 ATGTAGAAGTAGAGTGGTTAAGG - Intronic
915365266 1:155311595-155311617 ATGGGGAAGGAAACTGGGGAGGG + Intronic
916598874 1:166273102-166273124 ATGGTGACTCAGAGTGGGGAAGG + Intergenic
917442212 1:175078013-175078035 ATCTGGAAGCTGAGCAGGGAGGG + Intronic
918159741 1:181887141-181887163 ATGTTGAAAAGGAGTGGGGAGGG + Intergenic
918447298 1:184628157-184628179 ATGTGCAGGCAGAGTGGTTAGGG - Exonic
918765162 1:188472587-188472609 ATGTGTAAGCAGAGGGTTGAAGG + Intergenic
919786600 1:201262122-201262144 TGGTGGAGGGAGAGTGGGGATGG + Intergenic
919845389 1:201639208-201639230 AGGTGAAGCCAGAGTGGGGAAGG + Intronic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
920346209 1:205307192-205307214 ATGTGTATTCAGGGTGGGGAGGG + Intronic
920819281 1:209365236-209365258 TTGTGGTTGGAGAGTGGGGAAGG - Intergenic
920903146 1:210132363-210132385 ATGTCCAAGCAGGGTGAGGAGGG - Intronic
921419753 1:214932714-214932736 ATGTGAAAGCACATTGAGGAAGG + Intergenic
921950099 1:220920656-220920678 ATGAGGAAGCAGGGAGAGGAAGG + Intergenic
922002463 1:221493904-221493926 TTGAGGAAGGAGAGAGGGGAAGG - Intergenic
922095480 1:222439641-222439663 ATGTGGAAAGAGAGTGGGGGTGG + Intergenic
922917845 1:229272695-229272717 ATGAGGAGGCAGAGAGGAGAGGG + Intronic
923023102 1:230181131-230181153 GTGTTGAAGAAGAGTGGTGAGGG + Intronic
924652869 1:245946643-245946665 ACGTACAGGCAGAGTGGGGAGGG + Intronic
924812108 1:247412065-247412087 ATGTGGCAGCACAGTGGGTGGGG + Intergenic
924832328 1:247610207-247610229 ATGTTGAATAACAGTGGGGAAGG - Intergenic
924878723 1:248134728-248134750 ATGTTGAAGCATAGTAAGGAAGG + Intergenic
1063462338 10:6222653-6222675 GTGTGGGAGCGGAGTGGGGAGGG + Intronic
1063753330 10:8977018-8977040 ATGTGGAAGGAGGGGGGGGGGGG + Intergenic
1063814241 10:9755017-9755039 ATGTTCAGGCAGAGTGTGGAGGG + Intergenic
1064185615 10:13159364-13159386 AGAAGGAAGCAGAGAGGGGATGG - Intergenic
1064642133 10:17425932-17425954 CTGTGGAAAAAGAGTGGGGATGG - Intronic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067204054 10:44198666-44198688 GTGTGTGGGCAGAGTGGGGAGGG + Intergenic
1067230050 10:44399791-44399813 GTGTGGGAGCCCAGTGGGGAAGG + Intergenic
1067283222 10:44888707-44888729 TTGTGGAACCAGAGTGCAGATGG - Intergenic
1067698138 10:48550074-48550096 ATGGGCAAGCACAGTGGGCACGG - Intronic
1067752250 10:48979337-48979359 AAGTGGAAGCAGATATGGGAGGG - Intronic
1068865940 10:61896094-61896116 ACCTAGAAGCAGAGTGGGTACGG - Intergenic
1069783676 10:70974405-70974427 AGGAGGAGGCAAAGTGGGGAAGG + Intergenic
1069856164 10:71442453-71442475 AGGTGGAAACAAAGTGGCGAGGG - Intronic
1069959371 10:72070566-72070588 GTCTGGCAGCAGTGTGGGGAGGG - Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1071018750 10:81028129-81028151 ATGCAGAGGAAGAGTGGGGAGGG - Intergenic
1072388247 10:94955063-94955085 GTGGGGTGGCAGAGTGGGGAGGG - Intronic
1072459412 10:95605529-95605551 AGATGGAGGGAGAGTGGGGAGGG + Intergenic
1072767925 10:98110839-98110861 TTGTGGAAGCACAGAGGAGAAGG + Intergenic
1072913683 10:99524002-99524024 ATGTGGGGGCTGGGTGGGGAGGG + Intergenic
1073992436 10:109277584-109277606 AAGTGGAAGCAGTGGAGGGAAGG - Intergenic
1074308583 10:112301533-112301555 TTGTGGTAGCAGAGATGGGATGG + Intronic
1074365054 10:112851039-112851061 ATGTGAAAGCAGAGTTCGGAAGG - Intergenic
1074758839 10:116649068-116649090 TTGAGGGAGAAGAGTGGGGAGGG - Intergenic
1074837922 10:117316579-117316601 AGGTGGAAGCTGAGGTGGGAGGG + Intronic
1075211386 10:120494090-120494112 TTGTGAAAGCAGAGTAGGGAGGG + Intronic
1075413684 10:122247417-122247439 TGGTGACAGCAGAGTGGGGAAGG - Intronic
1076348460 10:129797110-129797132 GTGTGGAGGCAGAGTGGTGCTGG - Intergenic
1076422448 10:130340902-130340924 ATGTAGAAGCAGAGGGCGGTGGG - Intergenic
1076631940 10:131856721-131856743 AGGAGGGAGCAGAGAGGGGAGGG + Intergenic
1076742554 10:132494005-132494027 ACGAGGAAGCAGAGTGGGGAGGG - Intergenic
1077479332 11:2806284-2806306 GTGAGGAAGAAGAGAGGGGAGGG + Intronic
1077697465 11:4407271-4407293 ATGTTGAATAAGAGTGGTGAGGG - Intergenic
1078558748 11:12352783-12352805 CTGTAAAAGGAGAGTGGGGAGGG + Intronic
1078755201 11:14202464-14202486 ATGTGTCAGGACAGTGGGGAAGG + Intronic
1079328638 11:19515777-19515799 AGGTGGAAGCAGGGTGGGGTGGG + Intronic
1079666632 11:23113919-23113941 AAGTAGAGGCAGAGTGGAGAGGG + Intergenic
1080357301 11:31464898-31464920 ATGTTGAATAAGAGTGGTGAAGG - Intronic
1080683355 11:34496060-34496082 GGGTGGAAGCAGAGAGGGGAGGG - Intronic
1081085993 11:38802092-38802114 ATGTTGAAGCAGAGTGAGTTTGG + Intergenic
1081362401 11:42196657-42196679 ATGTGGATGCATGGTGGGGTGGG - Intergenic
1081520138 11:43873537-43873559 AGGTGGAAGCAGAGCTTGGAGGG - Intergenic
1081527144 11:43934971-43934993 AGATGGAAGCAGAGAGGGGAGGG - Intronic
1083439412 11:62665953-62665975 AGGTGGGGGCAGAGTGGAGAGGG + Intronic
1083439422 11:62665978-62666000 AGGTGGGGGCAGAGTGGGGAGGG + Intronic
1083517920 11:63278191-63278213 AAGTGCAAGCAGAGTTGGAATGG + Intronic
1083657308 11:64235689-64235711 TTGTGAGGGCAGAGTGGGGAGGG + Intronic
1084361267 11:68669905-68669927 ATCTGAAACCAGGGTGGGGAGGG + Intergenic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085329227 11:75633829-75633851 AAGGGCGAGCAGAGTGGGGAGGG + Intronic
1085407143 11:76270037-76270059 CTTTGGAAGCAGCTTGGGGAAGG - Intergenic
1085917509 11:80907123-80907145 ATGTTGAAGAGGAGTGGTGAGGG - Intergenic
1086283062 11:85213387-85213409 AACTGGAAGCTGAGTGGGGGTGG + Intronic
1086931670 11:92700258-92700280 GTGTAAAGGCAGAGTGGGGATGG + Intronic
1087008665 11:93493361-93493383 AGGTGGGGGCAGCGTGGGGAAGG - Intronic
1087033222 11:93727445-93727467 ATGTGTAAGAACAGTGGAGATGG + Exonic
1088245073 11:107809930-107809952 ATGTGGCAGTAAAGTGGGAAGGG + Intronic
1088358263 11:108965789-108965811 ATGTGGAAAGAGAGTATGGAGGG + Intergenic
1088520043 11:110687459-110687481 ATAGGGAGGCAGTGTGGGGAAGG + Intronic
1088785673 11:113179529-113179551 GTGTGGCAGCACAGTGGTGAGGG + Intronic
1088971798 11:114780443-114780465 ATGTGGTAGAAGAGTTAGGAAGG + Intergenic
1089322675 11:117637094-117637116 ATGAGCAGGCAAAGTGGGGAGGG - Intronic
1089572655 11:119420553-119420575 AGGCTCAAGCAGAGTGGGGAGGG - Intronic
1089761727 11:120731098-120731120 ATGTTGAATAAAAGTGGGGATGG + Intronic
1089809835 11:121122543-121122565 ATGTGGTAGCAGTCTGGGCACGG + Intronic
1090727601 11:129541693-129541715 ATGTGGCATGAGACTGGGGAAGG - Intergenic
1090908205 11:131095842-131095864 ACGAGGAAGGAGAGTGAGGAGGG - Intergenic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092395539 12:8122367-8122389 GAGTGCAAGCAGAGTGAGGAGGG + Intergenic
1092488713 12:8925557-8925579 ATGTGGAAGGAGAGTGTTGGAGG + Intronic
1094400002 12:30052477-30052499 AAGTGGCAGCAGTGTGGAGATGG + Intergenic
1095519084 12:43040462-43040484 ATGTTGAAGGGGAGTGGTGAGGG - Intergenic
1096590869 12:52658528-52658550 ATGTGGAGGCCTGGTGGGGAAGG - Intergenic
1096613836 12:52820411-52820433 GTTTGGTAGCAGGGTGGGGAGGG + Intergenic
1096995148 12:55833632-55833654 TTGAGGAAGGAGAGTGGGGGAGG + Intergenic
1097333041 12:58353013-58353035 AAGTGGAAGAAGAGTAGGCATGG + Intergenic
1097787428 12:63776908-63776930 GTGGGGGAGGAGAGTGGGGATGG + Intergenic
1097787678 12:63779673-63779695 GTCTGGAAGCAGCGTGGGGTAGG + Intergenic
1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG + Intronic
1099709100 12:86197041-86197063 ATGTAGAAGCACAGTGTTGAAGG - Intronic
1099983127 12:89629827-89629849 ACTTAGAAGCAGGGTGGGGAGGG + Intronic
1100392733 12:94158227-94158249 ATCTTGAAGCTGAGTGGAGAAGG + Intronic
1101308641 12:103555878-103555900 GTGTGGAAGTGGAGTGGGGTGGG - Intergenic
1101834619 12:108286632-108286654 ATGTGGAAGATGGGTGGGCACGG - Intergenic
1101835210 12:108290242-108290264 ATGAGGCTGCAGAGTTGGGAAGG - Exonic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102532822 12:113559155-113559177 AGGTGGGAGTAAAGTGGGGATGG + Intergenic
1102754701 12:115328044-115328066 ATGTGGAAGAAAATTGAGGAAGG - Intergenic
1102876990 12:116456696-116456718 ATCTGCAAGCTGAGTGGCGACGG + Intergenic
1103734310 12:123049434-123049456 ATGTGGCTGGAGAGTGGCGATGG - Intronic
1103846289 12:123903875-123903897 TTCTGGATGAAGAGTGGGGAAGG - Intronic
1104318859 12:127731189-127731211 CTGTGGATGCAGAGTGAGCAAGG - Intergenic
1104437189 12:128765723-128765745 CTGTGGGAGCAGAGTGGGAAAGG - Intergenic
1104632034 12:130411386-130411408 ATGTGGAAAAGGAGTGGTGAGGG + Intronic
1104923353 12:132302794-132302816 CTGTGGCAGCAGAAAGGGGACGG + Intronic
1105046518 12:133008361-133008383 ATGTGGGAGCAGAGAAGGGGAGG - Intronic
1105580595 13:21692253-21692275 GGGAGGAAGCAAAGTGGGGAGGG - Intronic
1106574236 13:30959268-30959290 ATGAGGAATAAGAGTAGGGATGG - Intronic
1106775165 13:33001865-33001887 AGGTGGCGGCAGAGTGGGGAAGG - Intergenic
1107232584 13:38128262-38128284 GTGTGGGAGGAGAGTGAGGATGG - Intergenic
1108036787 13:46298326-46298348 ATGTGGGGGCAGGGAGGGGAAGG + Intergenic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1108556836 13:51601720-51601742 AGGAAGAGGCAGAGTGGGGAAGG + Intronic
1108793280 13:53999049-53999071 ATATAAAAGCAGAGTTGGGAGGG - Intergenic
1108872437 13:55004052-55004074 AACTTGAAGCAGGGTGGGGATGG - Intergenic
1109702968 13:66050444-66050466 ATGTGGGAGAAAAGTGGAGAGGG + Intergenic
1110218947 13:73052554-73052576 AAGTGGAAGGAGGGTGGGGATGG - Intergenic
1110375058 13:74783897-74783919 ATGTGGAGGCAGGGAAGGGAGGG + Intergenic
1112144237 13:96679973-96679995 AGGTGGTAGCAACGTGGGGAAGG + Intronic
1112705275 13:102061073-102061095 ATGTGGAGCCAGCATGGGGATGG - Intronic
1113095052 13:106654346-106654368 CTGTCAGAGCAGAGTGGGGAGGG + Intergenic
1113310567 13:109127772-109127794 CTTTGGAGGCAGGGTGGGGATGG - Intronic
1113560684 13:111278178-111278200 ATGTGACAGCAGATTTGGGAAGG + Intronic
1113595403 13:111528281-111528303 ATGTGGGGGCAGAGTGGTGGTGG + Intergenic
1114493304 14:23116757-23116779 GGGTGGGAGCAGCGTGGGGAGGG + Intergenic
1114573905 14:23695317-23695339 ATCTGGAAAAAGAGGGGGGAGGG + Intergenic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1115862309 14:37700825-37700847 AAGTCCAAGCAGAGTGGGAAAGG + Intronic
1116435082 14:44887339-44887361 GTGTGGACGCAGGGTGTGGATGG + Intergenic
1116655742 14:47651449-47651471 ATGAGGCAGCAGAGTGGGCAGGG + Intronic
1116791867 14:49348003-49348025 TTTTGGAGGCTGAGTGGGGACGG - Intergenic
1118818696 14:69330684-69330706 GGGTGAAAGCAGAGTGGGGAAGG + Intronic
1118980268 14:70710490-70710512 ATGTGGAAGGAGGTAGGGGAGGG + Intergenic
1118991410 14:70800395-70800417 ATGTGGAAAAATAGTAGGGAAGG + Intronic
1119442137 14:74635571-74635593 ATGTGGATGCAGAATTGGAAGGG + Intergenic
1119931483 14:78551767-78551789 GGGGGGAAGTAGAGTGGGGAAGG - Intronic
1119940270 14:78633448-78633470 ATGTTGAAGGGGAGTGGGGAGGG - Intronic
1120813822 14:88832138-88832160 ATGTGGATGAAGAGTGTGTAGGG - Intronic
1120852750 14:89186167-89186189 ACTTGGAAGCACACTGGGGAGGG + Intronic
1120876147 14:89377936-89377958 ATGTGGAAGACATGTGGGGAAGG + Intronic
1121014324 14:90539159-90539181 ATGTGGGTGGAGAGTGGGGGTGG + Exonic
1122274735 14:100585765-100585787 ACCTGGGAGCTGAGTGGGGAGGG - Intronic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122769809 14:104092952-104092974 GTGTGGGAGGAGGGTGGGGAGGG - Intronic
1122874302 14:104656454-104656476 GTGTGGAGGCAGTGAGGGGAGGG + Intergenic
1122879142 14:104682222-104682244 AGGAGGCAGCAGTGTGGGGAGGG + Intergenic
1122889919 14:104727495-104727517 ATGTGGCCGCAGAGCAGGGAGGG - Intronic
1123435986 15:20254820-20254842 AAGTGGGAGAACAGTGGGGAGGG - Intergenic
1124017491 15:25889659-25889681 ATTTGGAAGCATTATGGGGAAGG + Intergenic
1125462291 15:39919259-39919281 ATGGGGAAGTAGAGTGGGTTTGG + Intronic
1125697662 15:41652314-41652336 AGGTGAAAGAAGAGAGGGGAGGG - Intronic
1126462401 15:48927655-48927677 ATGTGGCAGCAAAGTGTGTAAGG - Intronic
1127674773 15:61228830-61228852 TTGCGGGAGCAGAGTGGGGCGGG - Intronic
1127983153 15:64048729-64048751 ATGTGCATGCAGAGGAGGGAAGG - Intronic
1128305243 15:66594020-66594042 GTCTGAAAGCAGAGTGAGGATGG + Intronic
1128482984 15:68055099-68055121 CTTTGGAAGCAGTGTTGGGAGGG + Intronic
1129076098 15:72997327-72997349 TTCTGGAAGGAGAGAGGGGAAGG + Intergenic
1129503990 15:76065847-76065869 AAGTGGACGCACACTGGGGAGGG - Intronic
1129684172 15:77675883-77675905 TTGGGGAGCCAGAGTGGGGATGG - Intronic
1130123739 15:81074607-81074629 ATGTGAAAGCAAAGTGAGCATGG + Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1130906598 15:88244959-88244981 CTGGGGCTGCAGAGTGGGGAAGG + Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1132257193 15:100385895-100385917 CAGTGGAAGCAATGTGGGGAAGG + Intergenic
1132271816 15:100533022-100533044 GTGTGGAAGCGGAGTGGAGCGGG - Intronic
1132855480 16:2042872-2042894 ATGGGGGAGGAGGGTGGGGAGGG - Intronic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133437901 16:5795641-5795663 ATTTGGAAGAAGAGTGGTCAGGG - Intergenic
1134827180 16:17294197-17294219 CTGACAAAGCAGAGTGGGGAAGG + Intronic
1135617389 16:23923523-23923545 ATGTGGACCAAGAGTGGGAAAGG + Intronic
1135665263 16:24330351-24330373 ATGTGGAAGGTTTGTGGGGAGGG - Intronic
1135932241 16:26747907-26747929 ATGTGGGAGCAGAGAGGAGGGGG - Intergenic
1136730863 16:32411131-32411153 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
1137489312 16:48918418-48918440 CTGTGAAAACAGAGTTGGGAGGG - Intergenic
1137756887 16:50909405-50909427 ATGAGGAAGCAGAGAAGAGAAGG - Intergenic
1138063600 16:53917112-53917134 ATGGGGTAGCAGAGTAAGGATGG - Intronic
1138297895 16:55902326-55902348 TTGTGGGGGGAGAGTGGGGATGG - Intronic
1138683704 16:58706245-58706267 ATTTGGAAGCAGGGTGCAGATGG - Intergenic
1139924531 16:70478866-70478888 AACAGGAAGCAGAGAGGGGAAGG + Intronic
1140293907 16:73689544-73689566 ATGTGGAATGAGTGGGGGGAGGG - Intergenic
1140823462 16:78684284-78684306 AGGTGTACTCAGAGTGGGGAAGG + Intronic
1141252193 16:82368903-82368925 ATGGGGAGAGAGAGTGGGGAGGG + Intergenic
1141497419 16:84419658-84419680 ATGTGGATGGGGAGTGGGGTCGG - Intronic
1141556384 16:84839308-84839330 ACCTGGAGGCAGAGTGGGGAGGG + Intronic
1141837804 16:86554111-86554133 ATGTGGAAGGGGATTGGAGAGGG - Intronic
1141977125 16:87524377-87524399 AGATGGAAGGAGAGTGGGGCAGG + Intergenic
1142200690 16:88759877-88759899 AGGGGGAAGCTGTGTGGGGAGGG + Intronic
1142364366 16:89642125-89642147 ATGTGGATGTAGAGTGGGAGGGG - Intergenic
1202995534 16_KI270728v1_random:106138-106160 ATGTTGAATAAGAGTGGTGAGGG - Intergenic
1203022221 16_KI270728v1_random:418480-418502 ATGTTGAATAAGAGTGGTGAGGG - Intergenic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1142792284 17:2276749-2276771 ATGTGGAAGTGGACTTGGGAAGG - Intronic
1143485131 17:7250060-7250082 AAGTGGAAGCAGACTGGTAAAGG + Intronic
1144649820 17:17000271-17000293 ATGTGGAGGCAGAGAGGATAGGG - Intergenic
1144735511 17:17553253-17553275 ATCTGGCAGCTGGGTGGGGAAGG + Intronic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1145018011 17:19411482-19411504 ATCGGGAAGGAGAGTGGGGTGGG + Intronic
1145791829 17:27632258-27632280 GTGGGGAGGCAGGGTGGGGAGGG + Intronic
1145817747 17:27807802-27807824 TATTGGCAGCAGAGTGGGGAGGG - Intronic
1145904503 17:28508823-28508845 ATTTGGAAGGACAGAGGGGAGGG - Intronic
1146229528 17:31095393-31095415 AGGTGGGAGCGGAGTGGGGGTGG + Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146715175 17:35079985-35080007 ATGTGCAAGCAGGGGTGGGAAGG - Intronic
1147146899 17:38490686-38490708 ATGTAGGAGCGGGGTGGGGACGG - Intronic
1147212146 17:38877886-38877908 ATGAGGAAGGAGAGAGGGGAGGG + Intronic
1147268987 17:39253631-39253653 ATTTGGAAGTAGGGTGAGGAGGG + Intergenic
1147605537 17:41771981-41772003 ATGAGGATGCAGGCTGGGGATGG + Intronic
1147976247 17:44249758-44249780 GGCTGGGAGCAGAGTGGGGAAGG + Exonic
1149284876 17:55151229-55151251 AGTTAGAAGTAGAGTGGGGAGGG + Intronic
1150378326 17:64700713-64700735 CTGTGAAAACAGAGTAGGGATGG + Intergenic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1151547705 17:74803369-74803391 ATGTGGATGGGGAGAGGGGAAGG - Intronic
1151629767 17:75302475-75302497 CTATGGAAGAAGAGGGGGGAAGG + Intergenic
1151828261 17:76535568-76535590 AAGTGGAGTCAGAGTGGTGAGGG + Intronic
1151998187 17:77625399-77625421 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
1152034023 17:77860986-77861008 AAGAGCAAGCAAAGTGGGGATGG + Intergenic
1152168856 17:78729889-78729911 CTGTGGAAAGAGAGTGGGGGAGG + Intronic
1153965533 18:10178126-10178148 ATGTTGAAGAGGAGTGGTGAGGG + Intergenic
1155227067 18:23738075-23738097 AGATGGAAGTAGAGTGTGGAGGG + Intronic
1155410682 18:25541423-25541445 ATATGGGAGCAGTGAGGGGATGG + Intergenic
1155663034 18:28274762-28274784 TTTTTAAAGCAGAGTGGGGAAGG - Intergenic
1155705695 18:28808870-28808892 ATGTGGAAGGAGAGAAGAGAAGG - Intergenic
1156697485 18:39784378-39784400 ATGGGGTAGGAGAGTGGAGATGG - Intergenic
1157119593 18:44896480-44896502 ACTTGGATGTAGAGTGGGGAGGG - Intronic
1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG + Intergenic
1157886749 18:51375248-51375270 ATGTGGAATCACAGTGGTGAAGG - Intergenic
1157914857 18:51654946-51654968 ATGGGGAGGCGGAGTGGGGAAGG - Intergenic
1158464843 18:57680896-57680918 ATGTGAGAGCAGAATGTGGAAGG - Intronic
1158794508 18:60827019-60827041 TTGGGGTAGCAGAGTGGAGAGGG + Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1159502851 18:69296208-69296230 TTGTGGAAGGGTAGTGGGGATGG - Intergenic
1159543743 18:69814086-69814108 CTCTGGTAGCAGAGTAGGGATGG + Intronic
1160375378 18:78407515-78407537 GTTAGGAAGCAGAGTGGGGGAGG + Intergenic
1160376497 18:78417468-78417490 ATGTTTAAGTAGAGTGGTGAAGG - Intergenic
1161523417 19:4738573-4738595 AGGTGGGAGAAGAGGGGGGAGGG + Intergenic
1161927598 19:7312846-7312868 TTGTGGAAAGTGAGTGGGGATGG - Intergenic
1162091566 19:8283679-8283701 ATGTAGATGCAGACTGGGGGTGG - Intronic
1162093803 19:8298528-8298550 ATGTAGATGCAGACTGGGGGTGG - Intronic
1163440376 19:17319759-17319781 GTGTGGACGCAGGGTGTGGATGG - Exonic
1163479160 19:17544476-17544498 AGGTGGATGGAGAGTGGGTAAGG + Intronic
1163721345 19:18899595-18899617 AGGTGGATGCCGGGTGGGGAGGG + Exonic
1164463833 19:28470823-28470845 TTTGGGAAGCTGAGTGGGGAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166214160 19:41325040-41325062 AGGTGGAGACAGAGTGGGGTAGG + Intronic
1166542049 19:43611947-43611969 AGGTGGGAGGAGAGAGGGGAGGG - Intronic
1166966233 19:46530824-46530846 ACCTGGAAGGAGAGTGGGGAGGG - Intronic
1167213062 19:48145653-48145675 ATGAGGCAGCAGAGTGTGGTGGG + Intronic
1167419663 19:49395480-49395502 ATGAGGAAGCAGAGGGGGTCTGG + Intronic
1167557893 19:50206781-50206803 ATGTGGGAGCGAGGTGGGGACGG + Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167741130 19:51325581-51325603 AACTGGAAGCAGAGTGGGAGGGG - Intronic
1168309098 19:55451836-55451858 ATGTGGAGACAGAGGGGTGACGG - Intergenic
1168357766 19:55713021-55713043 GTGTTGGAGCAGAGTAGGGAAGG - Intronic
925048679 2:794717-794739 ACTTGGAAGCTGAGTGGGGCTGG + Intergenic
925348782 2:3187628-3187650 AGGTGGATGAGGAGTGGGGAGGG - Intergenic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
927409583 2:22808823-22808845 ATGTGGAACCAAACTGGAGAGGG - Intergenic
927565924 2:24112935-24112957 ATTTGGAAGAAGAGTGAGTATGG - Intronic
929126509 2:38527258-38527280 CTGTGACAGCTGAGTGGGGAAGG + Intergenic
929332836 2:40704706-40704728 ATGAGGCAGTACAGTGGGGACGG + Intergenic
930007518 2:46909921-46909943 ATCTGGCAGCACAGTGGGGAAGG + Intronic
930731908 2:54735973-54735995 AGGTGGAAAAAGAATGGGGAAGG + Intronic
931220480 2:60284399-60284421 ATGGGGAAGGGGAGTGGGGCTGG - Intergenic
931304069 2:61011393-61011415 ATGTGGAAGCATTGTGGGTATGG - Intronic
932062392 2:68519569-68519591 ATGGGGAATCGTAGTGGGGAGGG - Intronic
932575348 2:72959625-72959647 AGGTGGAAGAGGAGTGGGGTGGG - Intronic
932625123 2:73291372-73291394 AGTTGGAAGAAGAGCGGGGAGGG + Exonic
932881152 2:75503342-75503364 CCCAGGAAGCAGAGTGGGGAGGG + Intronic
933174319 2:79158773-79158795 AGGTGGAAGAAGAGGGGGGAGGG + Intronic
934104227 2:88681285-88681307 ATGTGCCAGCAGACAGGGGAAGG - Intergenic
935019745 2:99218310-99218332 CTGTGACAGCAGAGTGGTGAAGG - Intronic
935578126 2:104732060-104732082 AGGTGGGAGTAGAGTGGGGTGGG - Intergenic
935828741 2:106977195-106977217 CTGTGGCATCAGAGTGTGGATGG + Intergenic
935854977 2:107263944-107263966 ATGAGGAAGCAGAGACTGGAGGG - Intergenic
936776998 2:115985975-115985997 ATGTGCAGGCAGACTGGGAAGGG - Intergenic
936894860 2:117415808-117415830 ATGTTGAATAAAAGTGGGGAGGG + Intergenic
937024052 2:118682774-118682796 AGGTGAATGCAGGGTGGGGAAGG - Intergenic
937216303 2:120315749-120315771 CTGTGGCGGCAGGGTGGGGAAGG - Intergenic
937268178 2:120630287-120630309 AGGGGGTGGCAGAGTGGGGAGGG + Intergenic
937299916 2:120832815-120832837 AGGTGGCAGCAGACCGGGGAAGG + Intronic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
938254431 2:129844292-129844314 ATGTTGAAGCAGGCTGGGCATGG - Intergenic
939076924 2:137614278-137614300 ATGAGAAAGAAGAATGGGGATGG - Intronic
939078437 2:137630425-137630447 ATGGGGAAGAAGTTTGGGGATGG - Intronic
939842737 2:147208131-147208153 ATGTGGCACCACAGTAGGGATGG + Intergenic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
940412995 2:153388077-153388099 AGGTGGAAGCAGGTAGGGGAAGG + Intergenic
940961403 2:159790496-159790518 CTCTGGCAGCAGAGAGGGGAAGG - Intronic
941407849 2:165114041-165114063 ACCTGGAAGTGGAGTGGGGAAGG - Intronic
941739838 2:169023806-169023828 AAGTGGAATGAGACTGGGGAGGG + Intronic
941969782 2:171337155-171337177 AAGAGGAAGCAGACTGGGCATGG - Intronic
942799134 2:179856641-179856663 AAGTCAAAGCAGAGTGGGAAAGG + Intronic
942836611 2:180306203-180306225 CCATGGGAGCAGAGTGGGGAGGG + Intergenic
943751191 2:191511274-191511296 AGGTGGCAGCAGAGTGGGAGAGG - Intergenic
944463438 2:199976404-199976426 ATGTGATAGGAAAGTGGGGATGG - Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945800823 2:214428100-214428122 AAATGGACGAAGAGTGGGGAAGG + Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946308149 2:218867795-218867817 AGGTGAAAGGTGAGTGGGGATGG + Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946614715 2:221497114-221497136 CTGTGGAGGCAGTTTGGGGAAGG + Intronic
946679008 2:222193998-222194020 ATTTGGGGGCAGGGTGGGGAGGG + Intergenic
946904633 2:224404813-224404835 AGGTGGAGGCAGTTTGGGGAAGG - Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947285317 2:228507552-228507574 TTGTGGAAGGGGAGTGGGTAAGG + Intergenic
947382610 2:229559856-229559878 GTGTGATAGGAGAGTGGGGAAGG - Intronic
947806261 2:232970430-232970452 TGGAGGAAGCAGAGTGGGAAGGG + Intronic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
948724196 2:239921809-239921831 ATCTGGGGGCAGGGTGGGGACGG + Intronic
948729121 2:239952282-239952304 CTCTGAAGGCAGAGTGGGGAGGG + Intronic
1168797786 20:623004-623026 GTGGGGAAGCAGAGTGGGTGAGG + Intergenic
1168881290 20:1208372-1208394 ATGTAGAGGCAGAGTGGAGGGGG + Intergenic
1169023333 20:2347249-2347271 GAGTGGAAGAGGAGTGGGGAAGG - Intergenic
1169297402 20:4412009-4412031 AGCTGGAAGCTGAGTGGGGAGGG + Intergenic
1169298829 20:4424360-4424382 ATTTGGAGGCAGGGTAGGGAGGG - Intergenic
1170144403 20:13156926-13156948 ATATGGAAGCAGAGTGTAGCAGG - Intronic
1170544546 20:17424405-17424427 CTGAGGAAGCAAAGAGGGGAAGG + Intronic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1171134537 20:22684727-22684749 ATGAGGTAAGAGAGTGGGGATGG - Intergenic
1171293347 20:23995012-23995034 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1172037194 20:32018777-32018799 GTGTGGAAGCGGAGTGGGCGGGG + Intronic
1172114044 20:32563221-32563243 GTGAGGAGGGAGAGTGGGGAGGG + Intronic
1172151488 20:32793713-32793735 ATGTGAGGGGAGAGTGGGGAGGG - Intronic
1172329098 20:34062297-34062319 ATGTTGAGGAAGGGTGGGGAAGG - Intronic
1172754195 20:37272030-37272052 CTGTGGGAGCAGAGTGGGTGTGG + Intergenic
1173031809 20:39367944-39367966 ATGAGGTAGCAGATGGGGGATGG - Intergenic
1173082904 20:39886808-39886830 ATGTGGAAACAGATTGGAGGAGG - Intergenic
1173144553 20:40513519-40513541 ATGGGGAGGCAGAGTGGGGCTGG - Intergenic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173944387 20:46939061-46939083 AGGTGGACTGAGAGTGGGGAAGG - Intronic
1174161192 20:48551649-48551671 ATATGGAAGCAGAGAGAGCAAGG - Intergenic
1174193416 20:48756273-48756295 AGGTGGGAACAGAGTGGAGAGGG - Intronic
1175617270 20:60411337-60411359 GTGTGGATGCAGAGAGGAGATGG - Intergenic
1175752484 20:61508907-61508929 CTGTGGAGGCAGAGTGGGGAGGG - Intronic
1175872023 20:62213343-62213365 GGGGGGAAGGAGAGTGGGGATGG + Intergenic
1175872033 20:62213367-62213389 TGGGGGAAGGAGAGTGGGGATGG + Intergenic
1175872188 20:62213737-62213759 GGGGGGAAGGAGAGTGGGGATGG + Intergenic
1175893034 20:62323669-62323691 ACCTGGGAGCAGGGTGGGGAGGG + Exonic
1177705991 21:24705468-24705490 CCATGGAAGCAGAGTGGAGAGGG + Intergenic
1178611869 21:34089734-34089756 AAGTTGAGGCAGAGTAGGGAGGG - Intronic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1180012171 21:45058513-45058535 AGGGGGTCGCAGAGTGGGGAGGG + Intergenic
1180012193 21:45058566-45058588 CAGTGGGGGCAGAGTGGGGAGGG + Intergenic
1180743905 22:18073839-18073861 ATGTGGAACCAGTGTGGAGAAGG + Intergenic
1180786309 22:18549691-18549713 ATGAGGAAGAAGGGAGGGGATGG - Intergenic
1180824408 22:18852727-18852749 ATGGGGAAGGAGGTTGGGGAGGG + Intronic
1181124833 22:20695881-20695903 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181131590 22:20735417-20735439 ATGAGGAAGAAGGGAGGGGATGG - Intronic
1181188326 22:21121821-21121843 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181210872 22:21288672-21288694 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181243230 22:21489244-21489266 ATGAGGAAGAAGGGAGGGGATGG - Intergenic
1181338463 22:22159548-22159570 ATGGGGAAGCAGAGAGGGTGAGG - Intergenic
1181375176 22:22452383-22452405 ATGTGGAAGGGGAGAGGGTAAGG - Intergenic
1181398636 22:22638216-22638238 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181471959 22:23145975-23145997 CAGTGGAAGTAGAGTGGGGAGGG - Intronic
1181501369 22:23317572-23317594 ATGGGGAAGGAGGTTGGGGAGGG - Exonic
1181650784 22:24257843-24257865 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181706598 22:24652896-24652918 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181863015 22:25834009-25834031 GTGAGGAAGCACAGTGTGGAAGG - Intronic
1182440736 22:30362441-30362463 ATCTAGAAGAAGTGTGGGGAAGG + Intronic
1182453290 22:30433746-30433768 ACGGGGTGGCAGAGTGGGGAGGG - Intergenic
1183048022 22:35236767-35236789 ATGTTGAAGAGGAGTGGTGAAGG + Intergenic
1183324520 22:37184118-37184140 CTGGGGAAGCTGGGTGGGGAGGG + Intronic
1184138358 22:42562539-42562561 TGGAGGACGCAGAGTGGGGAGGG + Intronic
1184914453 22:47559481-47559503 GTGAGGAAGCAGAGGAGGGAAGG + Intergenic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
1203216075 22_KI270731v1_random:6758-6780 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1203274546 22_KI270734v1_random:78631-78653 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
949205146 3:1429144-1429166 ATGTGTAGGGAGAGTGGGAAAGG + Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949808031 3:7976732-7976754 ATGTGGAGCCAGAAGGGGGATGG - Intergenic
949815206 3:8050882-8050904 ATGGTGAAGGAGGGTGGGGATGG + Intergenic
950276648 3:11666942-11666964 ATGAGGAAGCGGAGTCAGGAAGG - Intronic
950523084 3:13507876-13507898 CTGAGGCAGCAGAGTGGGGATGG - Intergenic
950577260 3:13839682-13839704 ATTTGGTGGTAGAGTGGGGAAGG - Intronic
950709748 3:14805784-14805806 TTGTGGGGGTAGAGTGGGGAGGG - Intergenic
951553195 3:23895785-23895807 AGGTGAAAGGAAAGTGGGGAAGG - Intronic
952873785 3:37924997-37925019 AGGTGAGACCAGAGTGGGGAAGG - Intronic
953226416 3:41025680-41025702 AGGTGGACACAGACTGGGGATGG + Intergenic
953345477 3:42171964-42171986 ATGGGGACGGAGAGGGGGGATGG - Intronic
953530689 3:43737204-43737226 CTGTGGAAGCAGGGTGTGGCTGG + Intergenic
956072726 3:65471643-65471665 ATGTGGACCTGGAGTGGGGAGGG - Intronic
956172986 3:66447336-66447358 ATGGGGAGGCAGTGTGGGGCTGG - Intronic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957738010 3:84226942-84226964 ATGTGCTAGCAGACAGGGGAAGG + Intergenic
958624161 3:96603370-96603392 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
960456965 3:117884196-117884218 AGAAGGAAACAGAGTGGGGAAGG + Intergenic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
960737154 3:120793315-120793337 ACATGGATGGAGAGTGGGGAAGG - Intergenic
960906418 3:122606225-122606247 ATGTGGAAGAATATAGGGGATGG - Intronic
961212465 3:125136341-125136363 ATGTGGGAGAAGAGTCTGGAAGG - Intronic
961471163 3:127113882-127113904 ATCTGGAAGCAGCCAGGGGAGGG + Intergenic
961546037 3:127634022-127634044 AGGTGGGTGCAGAGAGGGGAGGG + Intronic
962452320 3:135530608-135530630 ATGTGGAAGCAGGATTGGAAGGG - Intergenic
962672101 3:137718856-137718878 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
962826804 3:139106430-139106452 AGATGGAGGCAGAGTGGGGCAGG + Intronic
963387143 3:144611738-144611760 AGAGGGAAGCTGAGTGGGGAAGG - Intergenic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963808772 3:149753638-149753660 GTGTGGAGGAAGAGAGGGGAAGG + Intergenic
966231547 3:177657810-177657832 ATGTAGAAGCAGAGTTGTGATGG + Intergenic
966400385 3:179541735-179541757 ATGTGGAAAGAGAGTAGGAAAGG + Intergenic
966460171 3:180167597-180167619 ATGGGGTGGGAGAGTGGGGAGGG + Intergenic
966474584 3:180329178-180329200 ATGTAGAGGCAGTGTGGAGAGGG - Intergenic
966545196 3:181138451-181138473 ATGTGGAGGCAGGGTGGAGAAGG - Intergenic
967214480 3:187198931-187198953 CTGTGGGGGCTGAGTGGGGAGGG + Intronic
967680438 3:192356169-192356191 AGGAGGAAGCAGAGTGGTGGTGG - Intronic
968146299 3:196301750-196301772 ATGTAAAAATAGAGTGGGGAGGG + Intronic
968215187 3:196883392-196883414 TTATGGAAGCTGAGTGGGGAAGG + Intronic
968315015 3:197716823-197716845 ATGTGAAAGCAGAGAGGGCTGGG + Intronic
968426309 4:525838-525860 GTGAGGAAGCGGAGGGGGGACGG + Intronic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
969080724 4:4615962-4615984 ATCTGGAGGCAGCGAGGGGAAGG - Intergenic
969086106 4:4657687-4657709 ATGAGAAAGCAGGGAGGGGATGG + Intergenic
969369211 4:6720576-6720598 GTGTGCAGACAGAGTGGGGACGG + Intergenic
969676113 4:8615197-8615219 AGGTGGGAGGTGAGTGGGGATGG + Intronic
970405533 4:15759596-15759618 ATGAGGAAGAAGAAAGGGGATGG - Intergenic
970410449 4:15801902-15801924 ATGTGGAATCAGAGTAGTGAGGG - Intronic
970471010 4:16379343-16379365 ATGTGCCAGCAGACAGGGGAAGG + Intergenic
972114188 4:35607362-35607384 ATGTGAAAGAAAAGTGGGAATGG + Intergenic
972987413 4:44781049-44781071 ATGGGGGAACAGAGAGGGGAAGG - Intergenic
973779410 4:54274078-54274100 ATGTGGATGGAGTGTGGGGAAGG + Intronic
974272511 4:59669327-59669349 AAGTGGGAGCAGAGTGGAAAAGG + Intergenic
974454341 4:62106807-62106829 ATGTTGAATCAGAGTGGTGAGGG + Intergenic
975411544 4:74057792-74057814 AAGTGGGAGGAGAGTGGGGAGGG + Intergenic
976007387 4:80446110-80446132 ATGAGGAAGAAGAGAGAGGAAGG + Intronic
976084745 4:81395849-81395871 ATGGGGTAGCAGAGTGGCCAAGG - Intergenic
977482220 4:97593237-97593259 CTGTGGGAGAAGAGTGGGGGTGG - Intronic
977487216 4:97664880-97664902 AAGGGCAAGCAGAGTGGCGAGGG + Intronic
979141002 4:117174500-117174522 AGGTGGAAGGAGAGAGGGGAGGG + Intergenic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
981358091 4:143814756-143814778 TTGTGGAGGCGGAGTGGGGGAGG + Intergenic
982749225 4:159139263-159139285 ATGAGGAAGCAGTGTGGAAAAGG + Intronic
983172052 4:164547322-164547344 ATGTTGAATAAGAGTGGTGAGGG - Intergenic
983569626 4:169191179-169191201 ATGTTGAAGAGGAGTGGTGACGG - Intronic
983739762 4:171114886-171114908 AGGGAGAAGCAGAGTGGGAATGG - Intergenic
983798812 4:171901503-171901525 ATGAGGAAGGGGAGTGGGGGAGG - Intronic
984624409 4:181989294-181989316 GGATGGAAGCAGGGTGGGGATGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984940016 4:184922685-184922707 CCAGGGAAGCAGAGTGGGGAGGG + Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
986495073 5:8333202-8333224 ATGGGCAGGCAGAGTGGGTAGGG + Intergenic
986974880 5:13382552-13382574 AGGTGCCAGCAGAGTTGGGATGG - Intergenic
987091684 5:14513284-14513306 ATGGGGAAGGAGTGGGGGGATGG + Intronic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
988465618 5:31488725-31488747 CTGTGGAAACAGTGTGGGAATGG + Intronic
988626456 5:32880670-32880692 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
988975537 5:36512135-36512157 ATGTTGAATAAGAGTGGTGAGGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990589438 5:57247687-57247709 AAGTGGTGGCAGAGTGGGGATGG + Intronic
990726870 5:58765942-58765964 AGGAGGAAGAAGAGTGGGCAGGG - Intronic
992131053 5:73693209-73693231 ATGTGGCAGAGCAGTGGGGAAGG - Intronic
992765029 5:79990857-79990879 CTGGGGATGCAGAGTAGGGAGGG + Intronic
993752966 5:91692878-91692900 ATGTGGAAGCAGCTTTGGAACGG - Intergenic
994055398 5:95408539-95408561 ATTTGGAGGCAGAGTTTGGAGGG + Intronic
995247860 5:109955959-109955981 ATTTGGAAGCAAGGTAGGGAAGG + Intergenic
996246274 5:121267370-121267392 AAGTAGAAGCAGATTTGGGAGGG - Intergenic
996525491 5:124474672-124474694 TTGTGGAAACAGAGGGGGTATGG - Intergenic
997139646 5:131364924-131364946 TTGAGGAAACGGAGTGGGGATGG + Intronic
997691810 5:135832343-135832365 ATCTGGAAGCAGAGGGGAGCAGG + Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997855457 5:137368742-137368764 ATGTGGAAGCAGTGGGGACAGGG - Intronic
997991887 5:138551386-138551408 CTGTGTGAGCTGAGTGGGGAAGG + Intergenic
998586269 5:143431037-143431059 ATGTGGGAGGAGAGAGGAGAAGG + Intronic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
998820383 5:146052674-146052696 ATGTGGGAGATTAGTGGGGATGG - Intronic
998908183 5:146929140-146929162 ATGTGGAAGAAGAGAGAGGTAGG - Intronic
999049837 5:148510436-148510458 ATGTGCAAGCAGACAGGGAAGGG - Intronic
999371334 5:151057018-151057040 ATGAGGAAGCAGAGGGAGAATGG - Intronic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1001402782 5:171455860-171455882 ATCTGGGTGGAGAGTGGGGAAGG + Intronic
1001874441 5:175187272-175187294 ATGTGTCAGCAGATTGGGAAAGG + Intergenic
1002318738 5:178362508-178362530 AGGTGGACTGAGAGTGGGGAGGG - Intronic
1003269731 6:4597301-4597323 ATGTTGAAGAGGAGTGGTGAGGG + Intergenic
1004031128 6:11870574-11870596 AGGTGAAGGCAGGGTGGGGACGG - Intergenic
1004157550 6:13183624-13183646 AGGAGGAAGGAGGGTGGGGAGGG + Intronic
1004258129 6:14083866-14083888 CAGTGGAAGCAGAGTGGGCTGGG - Intergenic
1004549309 6:16631237-16631259 AAGTGGAAGGAGAGTGGGCATGG - Intronic
1004997798 6:21210943-21210965 ATGAGGAAGCAGATGGGGCATGG - Intronic
1005352496 6:24949954-24949976 TGGAGGAAGCAGAGCGGGGAAGG + Intronic
1005625680 6:27659958-27659980 ATGTGGTGGCAAAGTGTGGAGGG - Intergenic
1005822227 6:29607416-29607438 GTGTGGAAGTAGAGGGTGGATGG - Intronic
1005828987 6:29655546-29655568 ATGTGGGAGCAGAGAGGGTCAGG - Intergenic
1007112687 6:39322202-39322224 ATTTGGAAGAAGAGTGTGGTGGG - Intronic
1007207903 6:40167490-40167512 CTGAGGAAGAAGAGTGGAGAAGG - Intergenic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007874516 6:45080790-45080812 AAGTGGAGGTAAAGTGGGGATGG + Intronic
1009901448 6:69812240-69812262 AGGTGGAAGCAGAGTCAGGTGGG + Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1011211517 6:84960490-84960512 ATGAGGTAGCAGAGTGGGCAAGG + Intergenic
1011440184 6:87379268-87379290 AAGTGGAAGAAGAGTGGGCATGG - Intronic
1011632309 6:89339492-89339514 ATGGGGGAGGAGAGAGGGGAGGG + Intronic
1011632357 6:89339586-89339608 AGGGGGAAGGAGAGGGGGGAAGG + Intronic
1012218351 6:96616901-96616923 GTGTGGGGGAAGAGTGGGGAGGG - Intergenic
1012465784 6:99515253-99515275 ATCAGGAAGCCGAGTGGGGTGGG + Exonic
1013299190 6:108787050-108787072 ATTTGGATGCAGGGTGGTGATGG - Intergenic
1013474920 6:110498179-110498201 ATTTTGAAAGAGAGTGGGGAGGG - Intergenic
1013821287 6:114156174-114156196 ATGTGGAAGCTTAGTGTAGAGGG - Intronic
1013837845 6:114353806-114353828 ATGAGGAAGCAGAATGTAGAGGG + Intergenic
1013869784 6:114743156-114743178 GTGTGGAGGGGGAGTGGGGAGGG - Intergenic
1013878298 6:114861884-114861906 GTGGGGAAGCAGAGCAGGGAAGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015592617 6:134836984-134837006 ATGTGGAAGAAGAGGAGTGAAGG - Intergenic
1015697280 6:135995059-135995081 AAGAGGATGCAGAGTTGGGAGGG - Intronic
1015792404 6:136977004-136977026 AGGAGGAAGCTGAGTGGAGATGG + Intergenic
1016336223 6:143007783-143007805 ATGAGGAAACAGTGTGGGGAGGG + Intergenic
1016488295 6:144567299-144567321 GTGTTGGAGCAGACTGGGGAAGG + Intronic
1016506805 6:144791131-144791153 AACTGGAATCAGAGTGGTGAAGG - Intronic
1016577333 6:145584180-145584202 AGGTTGAAGTGGAGTGGGGAAGG + Intronic
1016655055 6:146509247-146509269 GGGTGGAAGGAGAGTGGTGATGG - Intergenic
1016850768 6:148616535-148616557 GTGATGAAGCAGAGAGGGGAAGG + Intergenic
1017030866 6:150220354-150220376 TTCTGGAAGCAGAGAGGAGAAGG + Intronic
1017035368 6:150262422-150262444 ATGAAGAAGGAGGGTGGGGAAGG - Intergenic
1017650118 6:156572990-156573012 ATTTGAATGCAGAGTTGGGAAGG + Intergenic
1018245253 6:161816351-161816373 AAGGGGAGGCAGAGTGGGGTGGG + Intronic
1018488576 6:164268681-164268703 ATGTGGAAACTGTGTGGGGTGGG + Intergenic
1018829556 6:167432932-167432954 ATGGGGTGGCAGAGTGTGGATGG + Intergenic
1018902146 6:168057031-168057053 ATGTGGAAGTGGGGTGGGCAGGG + Exonic
1019366323 7:635274-635296 ATGTGGAAGCTGCCAGGGGAGGG - Intronic
1019517371 7:1445989-1446011 GTGTGGAAGGACAGTCGGGAGGG + Intronic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019738956 7:2663424-2663446 ATGGGAGGGCAGAGTGGGGAGGG + Exonic
1019892736 7:3959602-3959624 ACATGGATGCAGAGTGTGGAAGG - Intronic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1020713529 7:11639010-11639032 TTGTTCAAGCACAGTGGGGATGG - Intronic
1020795026 7:12668514-12668536 ATGTGGAAGCAAGGTGGGGTGGG + Intergenic
1020917080 7:14207811-14207833 ATGTGGAACAAAAGAGGGGAAGG + Intronic
1021024959 7:15654447-15654469 ATGTTGAATAAGAGTGGTGAGGG + Intronic
1022049398 7:26651002-26651024 ATGAGGATGCGGAGTGGGCATGG + Intergenic
1022632998 7:32103207-32103229 ATTTGGAAGCAGAAAAGGGAGGG + Intronic
1023167966 7:37361997-37362019 AGGTGGAAGCAGAGTCTGCAAGG + Intronic
1023537811 7:41231928-41231950 GTGTGGGAGCAGAGTGAGGCCGG - Intergenic
1023762162 7:43475042-43475064 CTGGGGAAGGAGAGTGGTGATGG + Intronic
1023780916 7:43654256-43654278 ATATAGAAACAGAGTGGGGTGGG - Intronic
1024516618 7:50264800-50264822 ACCAGGCAGCAGAGTGGGGAGGG + Intergenic
1024710081 7:52005738-52005760 CTGTGGAAGCAGAGAGGGTCTGG + Intergenic
1025014293 7:55426600-55426622 CTGTGGAAGCAAAGAGGGCAGGG + Intronic
1025037729 7:55608595-55608617 ATGTGGAAGAAAAGTGGAGTGGG + Intergenic
1026728992 7:72894933-72894955 ATGTGGAAGCTGAGGTGGGAGGG - Intronic
1027229177 7:76262166-76262188 AGGTGGAGGCAGAGTGGTGCAGG + Intronic
1027808711 7:82864382-82864404 ATCTGGGATCAGAGTGGGGCTGG + Intronic
1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG + Intronic
1029137259 7:98382244-98382266 ATTTGAAAAAAGAGTGGGGAGGG + Intronic
1029449240 7:100631757-100631779 AGGAGGAAGCAGAGAGAGGAAGG - Intronic
1029785279 7:102783673-102783695 ATGTGAAAGCAGTGTGTAGAGGG + Intronic
1030153153 7:106426325-106426347 AAGAGGGAGGAGAGTGGGGAAGG - Intergenic
1030273462 7:107694520-107694542 ATCTGGTAGCAGAGTAGTGAAGG - Intronic
1030792814 7:113749838-113749860 ATGTGGAGGCACGGTGGGGCAGG + Intergenic
1032026565 7:128447247-128447269 CTGTGGAAGTAAAGTGAGGATGG - Intergenic
1032266920 7:130375967-130375989 ATGTGGCCTCAGAGTGGGCAAGG + Intergenic
1033483161 7:141761545-141761567 ATGTGGGAGCAGAGTTGAGAGGG + Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034338392 7:150337787-150337809 ATGTGGAGGGATGGTGGGGAGGG - Exonic
1034675959 7:152893040-152893062 ATGTGGCAGGAGTGTGGGAAAGG - Intergenic
1034976747 7:155453645-155453667 TTGGGGAAGCAGAGTGGGCCAGG - Intergenic
1035006200 7:155662850-155662872 AGCTGGGAGCTGAGTGGGGAGGG + Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035417598 7:158703770-158703792 ATGAGGAAGGAGTTTGGGGACGG - Intronic
1035650379 8:1259646-1259668 CTGTGGAAGCAGAGCTGGGCTGG - Intergenic
1035722864 8:1805294-1805316 ATCTGGGGGCAGGGTGGGGAGGG - Intergenic
1036011570 8:4731217-4731239 GTGTGGAGGCTGAGTGGGAAAGG - Intronic
1036727770 8:11234951-11234973 ATGTGGAGGTGCAGTGGGGAAGG + Intergenic
1036943209 8:13070720-13070742 ATGAGGAAGCAGAGATTGGAAGG - Intergenic
1037286999 8:17311935-17311957 ATGTGGAAACTCAGAGGGGAGGG - Intronic
1037559291 8:20058087-20058109 ATGTGGATGGAGAGATGGGAAGG - Intergenic
1037560255 8:20067225-20067247 ATGTTGAAGAAGACTGGTGAGGG + Intergenic
1037590359 8:20306732-20306754 ATGAGAAGGCAGAGTGGAGAAGG + Intergenic
1037752946 8:21694438-21694460 AGTTGGGGGCAGAGTGGGGATGG - Intronic
1037912023 8:22749136-22749158 AGTAGGAAGGAGAGTGGGGATGG + Intronic
1038863758 8:31416049-31416071 TTGTAGAAGCATAGTTGGGAAGG + Intergenic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039032409 8:33324720-33324742 TTGTGGGAGAAGAGTGGGGTTGG - Intergenic
1040611316 8:48984973-48984995 CTTGGGAAGGAGAGTGGGGAAGG + Intergenic
1041048502 8:53909835-53909857 ATGTGGAAGGACAGAGGTGATGG + Intronic
1041084106 8:54241453-54241475 ATCTGGAAGTGGAGTGGGGCTGG - Intergenic
1041302580 8:56428602-56428624 ATGTTGAACAAGAGTGGTGAGGG + Intergenic
1042566011 8:70112772-70112794 ATGGGGAATGAGAGAGGGGAAGG + Exonic
1042648107 8:71009655-71009677 ATGGGGAAGAAGAGTGCTGAGGG + Intergenic
1043021915 8:75012530-75012552 ATTTGGGAGCACACTGGGGAAGG + Exonic
1043128251 8:76427776-76427798 ATTAGGAAGCAGGGTGTGGAGGG - Intergenic
1043420268 8:80090428-80090450 AAGAGGAAGCACAGTGGGGATGG + Intronic
1043526559 8:81104083-81104105 ATGTGGAAGGTGGGTGGGAAAGG - Intronic
1043869321 8:85413933-85413955 ATGTGGATGCAGAGAGGCCAAGG - Intronic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044175710 8:89119341-89119363 AGGAGGAAACAGAGTGGGGAGGG - Intergenic
1044208624 8:89522560-89522582 AAGTGGCAGCAAAGTAGGGAAGG + Intergenic
1044628059 8:94253925-94253947 TTGTGAAAATAGAGTGGGGATGG - Intronic
1044737088 8:95290101-95290123 TTGAGGAAGCAGTGGGGGGAAGG - Intergenic
1044885680 8:96774428-96774450 ATGTGGAAGATGAGTTGGAAAGG + Intronic
1044936968 8:97302702-97302724 TTCTGGAAGCATAGTGGGAACGG + Intergenic
1045750373 8:105476796-105476818 ATTTGGATGGAGAGTGGGGTGGG + Intronic
1045769738 8:105722207-105722229 AGCAGGAAGCAGGGTGGGGAAGG - Intronic
1046885866 8:119366365-119366387 ATGTGGATGCACAGTGGGCAGGG - Intergenic
1047981867 8:130191836-130191858 ATGAGGGAGCAGAGAGGGGCGGG + Intronic
1048124256 8:131615452-131615474 AAGTGCAAGCAAAGTGGGCAAGG + Intergenic
1048473375 8:134722633-134722655 ATGAGGAAGCAGAGGAGGGGAGG + Intergenic
1048903238 8:139060531-139060553 CTGTGGAAGCAGAGATTGGAGGG - Intergenic
1049519340 8:143080278-143080300 ATTTGGAAGCAGACGGGGGAGGG - Intergenic
1049525169 8:143121765-143121787 ATGTGGCAGATGGGTGGGGAGGG + Intergenic
1049600563 8:143505555-143505577 GTGTGGGAGTGGAGTGGGGAGGG - Intronic
1050091883 9:2023717-2023739 ATGGGGAAGCAGTGCGGGGTGGG - Intronic
1050566924 9:6894699-6894721 ATGTGGAAGTAGAGTGGGTGTGG + Intronic
1051029549 9:12658122-12658144 AAGGGCAAGCAGAGTGGTGAGGG + Intergenic
1051159671 9:14192612-14192634 ATGTCAAAGCAGAGGAGGGAAGG - Intronic
1051829104 9:21256166-21256188 ATGTGCCAGCAGACAGGGGAAGG - Intergenic
1052164271 9:25304311-25304333 ATGGGGAAGGAGAGAGGGAAGGG + Intergenic
1052935025 9:34085801-34085823 ATGTGGCAGAAGAATAGGGACGG + Intergenic
1052979417 9:34437395-34437417 CTGTGGAAGGACACTGGGGATGG - Intronic
1053485724 9:38454622-38454644 AAGTGGAAGCAGAATGGGGCTGG - Intergenic
1055222875 9:73959194-73959216 CTGAGGAAGCAGCCTGGGGATGG + Intergenic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1057917762 9:99070828-99070850 ATGTGGAAGCAGACCTGGGGTGG + Intergenic
1058310382 9:103493563-103493585 GTGTTGAAGAAGAGTGGGTAAGG + Intergenic
1058508937 9:105694948-105694970 ATGGGGAAACAGCGTGGGGGAGG + Intronic
1059371521 9:113843400-113843422 ATGCGGAAGGAGAGGGAGGAAGG - Intergenic
1059927219 9:119221862-119221884 GTGTGGAAGCAGAGTTTGAAAGG + Intronic
1059990734 9:119862840-119862862 TTGTGGAAGCTGATTGGGGGGGG - Intergenic
1060497917 9:124131405-124131427 ATGGGGAAGCAGAGGGGAGCGGG + Intergenic
1060556128 9:124507926-124507948 AGGTGGAAGAAGAGGGGGGCCGG + Intergenic
1060674322 9:125498817-125498839 AAAGGGAAGGAGAGTGGGGAGGG - Intronic
1061054969 9:128217741-128217763 GGGTTGAAGAAGAGTGGGGAAGG - Intronic
1061074805 9:128334607-128334629 ATGGGGACTCAGAGAGGGGAAGG - Intergenic
1061272606 9:129551854-129551876 CTGTGGGAACAGAGTGGGCAAGG - Intergenic
1061545877 9:131304018-131304040 ATGGGGAAGCACAGGGGGCAGGG + Intronic
1061930311 9:133828991-133829013 CTGTGGGAGCAGAGTGGGGCTGG - Intronic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062280662 9:135750317-135750339 ATTTGGAAGCAGGGTGGGGGTGG + Intronic
1185573804 X:1154496-1154518 ATGGGGAAGCAGGGAGGGGAGGG - Intergenic
1185589845 X:1268749-1268771 ATGAGGAAGCAGGGGAGGGAGGG + Intergenic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1187887448 X:23902863-23902885 ATGTTTGTGCAGAGTGGGGATGG - Intronic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189209563 X:39273140-39273162 ATGTTGAATAAGAGTGGTGAGGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189290544 X:39882331-39882353 AGGATGAAGCAGAGTGGGGAGGG + Intergenic
1189417656 X:40829285-40829307 TTGGGGTAGAAGAGTGGGGAGGG + Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1189731889 X:44029551-44029573 AAGTCGAAGCAGAGAGGCGACGG + Intergenic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1190981954 X:55464098-55464120 AAGTGGCAGCAAAGTGGAGATGG + Intergenic
1190986744 X:55509082-55509104 AAGTGGCAGCAAAGTGGAGATGG - Intergenic
1192438335 X:71156252-71156274 ATGTGGAAGTAGGGTGTGCAGGG - Intronic
1192638458 X:72842902-72842924 CTGAGGTAGCAGAGAGGGGAAGG - Intronic
1192643256 X:72877906-72877928 CTGAGGTAGCAGAGAGGGGAAGG + Intronic
1192771015 X:74190738-74190760 ATGTGGAATAAAAGTGGTGAAGG + Intergenic
1192922799 X:75724828-75724850 GAGTGGAAGCAGGGTGGGGGGGG - Intergenic
1193101922 X:77624009-77624031 ATGTTGAAGAGGAGTGGTGAGGG - Intronic
1193220885 X:78924848-78924870 ATGTTGAAGAGGAGTGGTGAGGG + Intergenic
1193331229 X:80237646-80237668 ATGTGCTAGCAGACAGGGGAAGG + Intergenic
1193399063 X:81020904-81020926 ATGTGCAAGCAAAGTGATGAAGG + Intergenic
1193444093 X:81577961-81577983 AGGTGGCAGCAGAGTTGGAATGG - Intergenic
1194115109 X:89887397-89887419 ATGTGGAAGAACAGTGGTGAAGG + Intergenic
1194170526 X:90575189-90575211 ATGTGCCAGCAGAAAGGGGAAGG + Intergenic
1194449246 X:94022832-94022854 TCCTGGAAGGAGAGTGGGGAGGG + Intergenic
1195494447 X:105514016-105514038 AAATGGCAGCAGAATGGGGAAGG + Intronic
1195679288 X:107531719-107531741 GTGTGGTAGCAGAGGGTGGAGGG - Intronic
1196305781 X:114101269-114101291 ATGTGGAGGTTGAGTGGGGAAGG - Intergenic
1197551727 X:127900342-127900364 ATGTGCCAGCAGACAGGGGAAGG - Intergenic
1199504334 X:148544396-148544418 GAGTGAAAGCAGGGTGGGGATGG - Intronic
1200014479 X:153147886-153147908 AGGTTGAAGAAGAGTGGGGCTGG - Intergenic
1200025123 X:153252068-153252090 AGGTTGAAGAAGAGTGGGGCTGG + Intergenic
1200467904 Y:3544537-3544559 ACGTGGAAGAACAGTGGTGAAGG + Intergenic
1200516769 Y:4152949-4152971 ATGTGCCAGCAGAAAGGGGAAGG + Intergenic
1201294509 Y:12452175-12452197 GGGTGGGAGGAGAGTGGGGATGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic