ID: 1108372697

View in Genome Browser
Species Human (GRCh38)
Location 13:49786769-49786791
Sequence CAACTATGTGTGGCATGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108372697 Original CRISPR CAACTATGTGTGGCATGCTA AGG Intronic
900768177 1:4519474-4519496 CAACTGTGTCTGGGATGCTGTGG + Intergenic
905293129 1:36936742-36936764 CAAGTGAGTCTGGCATGCTAGGG + Intronic
916554941 1:165886408-165886430 CAGCTACGTGTGGCAGGCTAAGG - Intronic
917847765 1:179036162-179036184 CAGCTATATGGGGCTTGCTACGG - Intronic
922113978 1:222591078-222591100 CAACTATTTGTAGCATTTTAAGG - Intergenic
1064463725 10:15559180-15559202 GACCTGTGTGTGCCATGCTAGGG - Intronic
1065431723 10:25664999-25665021 AAACAATTTGTGGCATGCCATGG + Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1069588419 10:69626754-69626776 CAAATAAGGGTGGCATCCTAGGG + Intergenic
1071708111 10:88021466-88021488 CCACTATGTGTGGAAAACTAAGG + Intergenic
1074342350 10:112645438-112645460 CAATCATGGGTGACATGCTAGGG - Intronic
1076104870 10:127813655-127813677 CACCCTTGTGAGGCATGCTAGGG - Intergenic
1092459956 12:8677664-8677686 TAGCTATGTATGTCATGCTAAGG - Intergenic
1095306398 12:40643404-40643426 CAACTATTTCTGGCCTGATATGG - Intergenic
1095376941 12:41541405-41541427 CAACTTTGGGTGACATACTATGG - Intronic
1097292405 12:57929163-57929185 CCACTGTGTCTGGCCTGCTATGG + Intergenic
1098341089 12:69451904-69451926 CTACTATGTGTGAGGTGCTAAGG - Intergenic
1098693360 12:73518918-73518940 CAACTATTTGTGGCATCCAGGGG - Intergenic
1099339864 12:81416118-81416140 CAACTAAGAGTGGCATAATATGG + Intronic
1100228690 12:92585427-92585449 CAATTATGTGTGGGATTCAAAGG - Intergenic
1103709272 12:122899226-122899248 TAGCTATGTGTGCTATGCTATGG - Intergenic
1106704677 13:32267763-32267785 CAGCTATGGCTGGCATGCTAAGG - Intronic
1108372697 13:49786769-49786791 CAACTATGTGTGGCATGCTAAGG + Intronic
1109610607 13:64760178-64760200 GGATTATGTGTGGCATACTAAGG + Intergenic
1114778258 14:25511243-25511265 AAACCATGTGTGTCATGCTAAGG - Intergenic
1115125651 14:29989765-29989787 CAATTATGTGAGGCCTGCCAAGG - Intronic
1115668637 14:35583168-35583190 CAACTATGGTTAACATGCTATGG + Intronic
1115862022 14:37698000-37698022 CAAATATTTTTGGCATGCTCAGG - Intronic
1119159676 14:72442468-72442490 GAACTATTTGTGGGGTGCTATGG - Intronic
1121581728 14:95037042-95037064 CAACTATCAGTGGCATTGTAGGG - Intergenic
1122050191 14:99053608-99053630 CAGCTCTGAGTGGCATGCTCAGG - Intergenic
1122174887 14:99909573-99909595 CAACTATGTGAGGGATCCCAAGG - Intronic
1124244086 15:28055593-28055615 AAGCTATGTGTGGAATGCTGTGG + Intronic
1128102849 15:65018533-65018555 CAACAATGTATGGCAAGATAAGG - Intronic
1131303133 15:91217371-91217393 GAAATATGTGTGCAATGCTATGG + Intronic
1136062263 16:27734839-27734861 CCACTATGGCTGGCATGCTAAGG - Intronic
1137747153 16:50830913-50830935 CAACTGTGTGAGGCCTGCTTAGG - Intergenic
1137867246 16:51913089-51913111 CAACTATTTCTGGCTTTCTAGGG - Intergenic
1138341665 16:56293561-56293583 AAAGTATGTGTGCCATGCCAGGG - Intronic
1139936832 16:70577616-70577638 CAACTACTTGTGGCATGCATTGG + Exonic
1140596272 16:76418623-76418645 CAACTATGATTGATATGCTAAGG - Intronic
1142372504 16:89690918-89690940 CATCTATGTGGGGCATGGCAGGG - Intronic
1144370914 17:14590817-14590839 CTACTATGTGTTGAATGCTGTGG + Intergenic
1146236360 17:31168217-31168239 TAACTGTTTCTGGCATGCTATGG + Intronic
1146302325 17:31699034-31699056 CAACTATGTGTGGGAGGCTGAGG + Intergenic
1149264409 17:54911913-54911935 GAAGTTTGTGTGGCATGCAAAGG - Intronic
1150501982 17:65659977-65659999 TGACTGTGTGTGGCATGCTTAGG + Intronic
1150917199 17:69448950-69448972 CAGCCATGTGTGGCGTGCCAAGG + Intronic
1151044018 17:70898005-70898027 AAACTATGTGTGCCATGATAAGG + Intergenic
1151122492 17:71808426-71808448 CAAATATGTGTGGCAAGGCAGGG - Intergenic
1155164607 18:23222186-23222208 GAACTATGGGTAGCTTGCTAGGG - Intronic
1162847983 19:13408575-13408597 CCACTGTGTGTGGGGTGCTAGGG + Intronic
925156922 2:1656043-1656065 TGAGTATGTGTGGTATGCTATGG - Intronic
925934155 2:8737115-8737137 CAAATATGTTTAGCATGGTAAGG + Intronic
929066889 2:37985992-37986014 AAACTAGGTGTGGCATGTAAGGG + Intronic
931203541 2:60124674-60124696 CAACTATGTGTGACAGGCACTGG + Intergenic
931489816 2:62733025-62733047 CAACTATGATTGATATGCTAAGG - Intronic
931495382 2:62800717-62800739 CACCTATATGTGGCAGGATATGG - Intronic
936639862 2:114299915-114299937 CAAATATGTATTGCATGGTATGG + Intergenic
937199442 2:120189388-120189410 GAACTTTGTGTGTCATACTAAGG - Intergenic
939440384 2:142241229-142241251 CAACAGTTTGTGGCATGTTATGG + Intergenic
939861161 2:147422244-147422266 CAATTATATGTGGCATGTTATGG - Intergenic
942239659 2:173948873-173948895 CATGTATGTATTGCATGCTATGG - Intronic
947980110 2:234401493-234401515 CAAGTATCTGTAGCATGCTCTGG + Intergenic
1168861385 20:1048362-1048384 CAGCTATGTTTCGCCTGCTATGG - Intergenic
1184015416 22:41782373-41782395 TAACCATGTGTGGCATTCCACGG - Intronic
955316950 3:57947159-57947181 GCACTATGTTTGGCATGCAACGG - Intergenic
957151317 3:76489396-76489418 CAAAAATGTGTGGCTTGCTCAGG - Intronic
963918211 3:150880197-150880219 CACCTGTGAGTGGCATGGTAAGG + Intronic
969632056 4:8344499-8344521 CAAATATGTGTGGCATGCTCTGG - Intergenic
972051725 4:34743307-34743329 CCAATATCTGTGGCATGCCATGG + Intergenic
977010790 4:91629751-91629773 CTAGCATGTGGGGCATGCTACGG + Intergenic
982457653 4:155629257-155629279 CCACTTTATGTGGAATGCTATGG - Intergenic
998168734 5:139859630-139859652 CCCCTATGTGAGGGATGCTACGG + Intronic
1001268916 5:170296330-170296352 GAACTAGGTGTGGTATGGTAGGG - Intronic
1003893948 6:10589448-10589470 CAACTATGTGAGGCTTGTCAGGG + Intronic
1005429860 6:25744171-25744193 AACCTTTGTGTGGCATGCTAAGG + Intergenic
1005808615 6:29499230-29499252 CAACTATGTGTTGCATCTGAGGG - Intergenic
1006671600 6:35732713-35732735 CAACTACCTGTGGAATCCTAAGG - Intergenic
1006940458 6:37748622-37748644 AAACTATGTGTGGCCTCCTGGGG + Intergenic
1010151622 6:72739371-72739393 CAACTATCTGGGGTATGCTATGG + Intronic
1011018511 6:82784990-82785012 CAAATATTTGTGGCTTGCTTAGG - Intergenic
1013183670 6:107738908-107738930 CAAATATGTGTGACTTGTTAGGG - Intronic
1015611781 6:135029919-135029941 CACATATGTGTAACATGCTAGGG + Intronic
1016071210 6:139741321-139741343 CACCTATGTGAGGGATGTTAGGG + Intergenic
1021329424 7:19317389-19317411 AAACAATGTGTGGCATACTATGG - Intergenic
1023987120 7:45103204-45103226 CCACTATGTGTGGCATGGGAGGG - Intronic
1030298507 7:107952675-107952697 CAAACATGTGTGGAATGCTAGGG - Intronic
1034782770 7:153896148-153896170 AAACTATGTGTGGCTTAATAGGG - Intronic
1036405801 8:8454286-8454308 CAAATTTGCGTGGCATCCTAAGG + Intergenic
1036410459 8:8494977-8494999 CAACTATGTGGGGAAAGTTAGGG + Intergenic
1037848133 8:22302837-22302859 CAAGGATGTGTGGCCTTCTATGG + Intronic
1039312533 8:36333243-36333265 CAACTATGATTAGTATGCTAAGG + Intergenic
1039841416 8:41295940-41295962 CAACTATTTGTGGGATGCGGAGG + Intronic
1040939164 8:52815314-52815336 CAGCTCTGTGTGGCATCCTGAGG - Intergenic
1041012128 8:53555335-53555357 TAACTATGAGTGGAATGCTTGGG - Intergenic
1041399436 8:57426529-57426551 CAACTCTGTGTAGCATGTGAGGG + Intergenic
1044106747 8:88217643-88217665 CAACTGTCTGTGGCATGCAGAGG - Intronic
1044197529 8:89395675-89395697 CAATGATCTGAGGCATGCTAGGG - Intergenic
1045736675 8:105304072-105304094 CACCTTTGTGTGGGTTGCTATGG - Intronic
1048220338 8:132535131-132535153 CAAATATCTGTGAAATGCTATGG - Intergenic
1048815631 8:138331129-138331151 CTACCATATGTGGCATGCCAGGG - Intronic
1051161029 9:14207489-14207511 CCTCAATTTGTGGCATGCTATGG - Intronic
1056248908 9:84728214-84728236 CAACGATGTGAGGCTTCCTAAGG + Intronic
1056453535 9:86739147-86739169 CAACTGTGTGTGCCATGCTGAGG - Intergenic
1059452102 9:114376968-114376990 CATCTATCTGTGGCATGCTGCGG + Exonic
1060352830 9:122874004-122874026 CTACTATGTATGGAGTGCTATGG + Intronic
1189492638 X:41481921-41481943 GAACTATGTGTGACATCCTGTGG - Intergenic
1194853894 X:98904432-98904454 CAAATATTTATGTCATGCTAGGG + Intergenic
1198156770 X:133968327-133968349 CCAGTATGTGTGAGATGCTAGGG - Intronic