ID: 1108373099

View in Genome Browser
Species Human (GRCh38)
Location 13:49790515-49790537
Sequence CTTGTTACACAGATTAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108373098_1108373099 -9 Left 1108373098 13:49790501-49790523 CCACACTTCATATACTTGTTACA 0: 1
1: 0
2: 2
3: 18
4: 216
Right 1108373099 13:49790515-49790537 CTTGTTACACAGATTAAATAAGG 0: 1
1: 0
2: 1
3: 29
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108373099 Original CRISPR CTTGTTACACAGATTAAATA AGG Intronic
901620387 1:10580876-10580898 GTTGTTATAAAGATTAAATAAGG - Intronic
903073891 1:20746612-20746634 TTTGTTTCAAAGAATAAATAAGG + Intronic
904348456 1:29889458-29889480 CTTGTTACATAGATATAATTAGG + Intergenic
905229415 1:36505406-36505428 ATTGTTAGAAATATTAAATAGGG + Intergenic
906397500 1:45479686-45479708 ATCATTATACAGATTAAATATGG - Intronic
906992896 1:50757684-50757706 ATTGTTACACTGAATAAAAAAGG - Intronic
907154208 1:52317693-52317715 CTAGTTAGACTGATTAGATAGGG + Intronic
907640756 1:56188031-56188053 TTTGTTACGAAGATTAAATAAGG + Intergenic
908178545 1:61580543-61580565 ATTGTTGCAAGGATTAAATAAGG - Intergenic
911165712 1:94722758-94722780 GTTGTTTAAAAGATTAAATATGG - Intergenic
911260109 1:95675669-95675691 GTTGTTGGACAGATTAAATGTGG + Intergenic
911693503 1:100862048-100862070 CTTGTTGAACAGATTAGATGTGG - Intergenic
913340726 1:117755480-117755502 GTTGTCACGTAGATTAAATAAGG + Intergenic
918683333 1:187383035-187383057 CTAGAAACAAAGATTAAATATGG + Intergenic
918964532 1:191325018-191325040 CTTTTTTCACAAATTAAAGAGGG - Intergenic
919324030 1:196082595-196082617 CTTATTACCCAGATTATATAAGG + Intergenic
919875698 1:201865638-201865660 CTTGTTTCAGAGATTATTTAAGG - Intronic
921210099 1:212888218-212888240 AAAGTTACACAGATTAAGTAAGG - Intronic
921429347 1:215045655-215045677 CATTTTACACAAATTAAAGAGGG - Intronic
921542272 1:216430798-216430820 GTTGTTATAAAGATCAAATAAGG - Intergenic
1065103959 10:22360993-22361015 CCTCTTACACATATTAAACATGG - Intronic
1066500133 10:35984833-35984855 CTTGCTACACAAATTAATTTGGG + Intergenic
1068084586 10:52359351-52359373 TTTATTACACATATTAAAAATGG - Intergenic
1068920977 10:62483741-62483763 GTTTTTACACAGATAAAATGAGG - Intronic
1069356399 10:67591405-67591427 CATATTACACAAATTAGATATGG + Intronic
1072215635 10:93285167-93285189 CTTGTTACGCAGATGAAAGTCGG + Intergenic
1074541296 10:114367344-114367366 CTTGTTACAGAGAGCAAATTTGG + Intronic
1074566163 10:114579930-114579952 ATTGTTTCACAGATCACATAAGG + Intronic
1080818522 11:35782453-35782475 TTTGTTTCACAGAATAAATTTGG + Intronic
1081601196 11:44495869-44495891 CTTGTTAGAAAAATTAAATTGGG + Intergenic
1086281764 11:85197930-85197952 GTTGTTACAAGGATTAAATGAGG + Intronic
1086451707 11:86923748-86923770 CTTTTTACACTTATTAAATGAGG - Intronic
1086846996 11:91763009-91763031 TTTGGAACACAGATTAAAGATGG - Intergenic
1087883184 11:103444405-103444427 ATTGTTACACTTATTAAATAAGG + Intronic
1088511645 11:110581660-110581682 GTTGTTGTAAAGATTAAATAAGG - Intronic
1088902836 11:114131485-114131507 ATTGTTCCACAGAACAAATAGGG + Intronic
1090284600 11:125488768-125488790 TATGTTACACAAATTAAAGAAGG - Intronic
1090315214 11:125780495-125780517 CTTCTTAAACACATGAAATATGG + Intergenic
1090403269 11:126462362-126462384 GTTGTTGTAAAGATTAAATAAGG + Intronic
1092766786 12:11860307-11860329 TTTGTTACACATATTAACCACGG + Intronic
1093592964 12:20928350-20928372 CTTGTTTCATAGATGAATTAGGG + Intergenic
1093887499 12:24479434-24479456 GTTGTTGCAAAGATTAAATGAGG - Intergenic
1094642139 12:32286349-32286371 TTTTTTATACATATTAAATAAGG + Intronic
1095233711 12:39772322-39772344 GTTGTTACAAAGATTAAACAAGG + Intronic
1095769187 12:45932920-45932942 CTTGTTAAACAGATAAATTAAGG + Intronic
1097420354 12:59370648-59370670 CTTGTGAAACATACTAAATAAGG + Intergenic
1099213307 12:79820870-79820892 CTTGTTCCAGAGATTCAATACGG + Exonic
1099277330 12:80593462-80593484 CCTGTAAAACAGAATAAATAAGG + Intronic
1099628593 12:85110120-85110142 CATGTTAACCAGATTATATATGG + Intronic
1102135871 12:110574314-110574336 GTAGTTACAAAGATTAAATAAGG + Intronic
1104755382 12:131265963-131265985 CCAGTTCCACACATTAAATATGG + Intergenic
1107285547 13:38786434-38786456 CTTATTACACTGATCAATTAAGG - Intronic
1108373099 13:49790515-49790537 CTTGTTACACAGATTAAATAAGG + Intronic
1109248686 13:59990572-59990594 GTTGTTAGGCAGATGAAATATGG - Intronic
1109547659 13:63848517-63848539 TTTGTTGCACAGTTTACATAGGG + Intergenic
1109756706 13:66770525-66770547 CTTTTTAGACAGTTTCAATAGGG + Intronic
1111555721 13:89879020-89879042 CATCTTTCACAGATTCAATATGG - Intergenic
1113063523 13:106350710-106350732 ATTCTTACACAGAATCAATAGGG + Intergenic
1118226712 14:63907494-63907516 ATTGTTATAAAGATTAAATGAGG + Intronic
1118861385 14:69666940-69666962 CTTGTTACTCAGAATAACAAAGG - Intronic
1120061491 14:79988655-79988677 CTTTTCTAACAGATTAAATATGG - Intergenic
1120566883 14:86071004-86071026 TTTGTTATAAAGACTAAATAAGG + Intergenic
1121304614 14:92898274-92898296 GTTGTTACAAAGATTAAATGAGG - Intergenic
1123663129 15:22583573-22583595 CTTGTAACTCAGAATATATAAGG + Intergenic
1124316931 15:28677876-28677898 CTTGTAACTCAGAATATATAAGG + Intergenic
1124550341 15:30675066-30675088 CATTTTACACAGACAAAATAAGG - Intronic
1124566520 15:30819628-30819650 CTTGTAACCCAGAATATATAAGG - Intergenic
1124601272 15:31134548-31134570 TTTGTTACACAGATTGAAGTTGG - Intronic
1125192475 15:37009850-37009872 ATAGATACACAGAGTAAATATGG + Intronic
1125337088 15:38637349-38637371 TTGGTTACACAGAATTAATATGG + Intergenic
1125779982 15:42256589-42256611 CTTGTTACAGTGATTAAAACTGG - Intronic
1127311310 15:57754413-57754435 CTACTCACACAGATTTAATATGG - Intronic
1128869319 15:71140640-71140662 GTTGTTATAAAGATTAAATGAGG - Intronic
1130691751 15:86087629-86087651 ATTGTTGCAAAGATTAAATGAGG - Intergenic
1130923758 15:88369914-88369936 GTTGCTGCAAAGATTAAATAAGG - Intergenic
1131850219 15:96534169-96534191 CTTGTTACAGAAAGCAAATATGG + Intergenic
1131956876 15:97746327-97746349 CTGATTACACAAATTAACTAGGG - Intergenic
1134059430 16:11190185-11190207 CTTGTTACACACTTTAGAAATGG - Intergenic
1137954155 16:52811918-52811940 CCTTTTACACAGAGAAAATATGG + Intergenic
1138097142 16:54220668-54220690 CCTGTTTCAAAGATTAAATGAGG - Intergenic
1138163303 16:54776462-54776484 GTTGTTGCAAAGATTAAATGAGG + Intergenic
1138360091 16:56420985-56421007 GTTGTAAAACAAATTAAATAAGG + Intronic
1138946412 16:61855946-61855968 CTTGTAAAACACATTAATTAGGG - Intronic
1141022318 16:80508868-80508890 CCTGTTACACAGATAAGACAGGG - Intergenic
1142950288 17:3472588-3472610 ACTGTTACTCAAATTAAATAAGG - Intronic
1145815331 17:27791356-27791378 CTTGTTAAACTGACTAAGTAGGG - Intronic
1148245648 17:46028317-46028339 GTTATTACTCTGATTAAATAAGG + Exonic
1149694879 17:58608988-58609010 CTTTTAACTCAGATTAAAAATGG + Intronic
1150173535 17:63024700-63024722 TTTGCTACACAGATTAAATTAGG - Intronic
1152096336 17:78273967-78273989 CTTGTTACACAGCCTGATTATGG - Intergenic
1155786328 18:29905916-29905938 CTAATTAGAGAGATTAAATATGG - Intergenic
1158346110 18:56518742-56518764 GTTGTTTTAAAGATTAAATAAGG - Intergenic
1158527997 18:58232557-58232579 CCGGTTACACAGATCAATTACGG - Intronic
1158901201 18:61963349-61963371 CTGGTTAAACAGATGAAAAAAGG + Intergenic
1163928436 19:20366495-20366517 CTTGTAACAGTCATTAAATATGG - Intergenic
1167341160 19:48917244-48917266 CTGATTAAAAAGATTAAATAAGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
925019708 2:558620-558642 CTTGTTTTACTGATTTAATATGG - Intergenic
925110378 2:1330480-1330502 CTTGCTGCACAGATTACAAAAGG - Intronic
925774957 2:7325880-7325902 CTGGTTTCACAGATAAAATTTGG + Intergenic
927184001 2:20469057-20469079 TTTGTTGAACAGATTAAATAGGG + Intergenic
927251146 2:20995873-20995895 GTTGTTACAAAGATTAAATGAGG - Intergenic
928464142 2:31504531-31504553 CTTGGTACACAGATAAAGTTGGG + Intergenic
928485851 2:31730059-31730081 CTTATCAAACAGACTAAATAAGG + Intergenic
929904396 2:46033497-46033519 CTTGAGATACAGATTCAATAGGG + Intronic
930350124 2:50241553-50241575 CTTGCTGCACAGCTTAAATGTGG - Intronic
933687324 2:85153204-85153226 ATAGTTGCAAAGATTAAATAAGG + Intronic
935071483 2:99698149-99698171 ATTGTTGCACAGATTAGATTAGG - Intronic
938876141 2:135532694-135532716 CTTGTTTCACATATTATAAATGG - Intronic
939432229 2:142125707-142125729 TTTGTGACACAGGTTAAATTTGG + Intronic
939491873 2:142886276-142886298 ATTTTTATTCAGATTAAATAAGG + Intronic
939990229 2:148871397-148871419 CTTGTATCACAGATAATATAGGG + Intergenic
940324282 2:152409132-152409154 CTTGTTATATAAATGAAATATGG - Intronic
940484795 2:154284445-154284467 CATGTTACACAGCTGAAAAAAGG - Intronic
941725284 2:168853783-168853805 CCTGTGACACAGATAAAAGAAGG - Intronic
942027749 2:171927322-171927344 GTGGTTACAAAGATTAAATATGG + Intronic
942379439 2:175373332-175373354 CTGATTACACAGATTGACTAAGG - Intergenic
943145599 2:184040830-184040852 ATTTTCACACAGATTAAAAATGG + Intergenic
943650445 2:190452421-190452443 ACTGTTAAAAAGATTAAATAGGG - Intronic
943709973 2:191081704-191081726 ACAGTTACACAAATTAAATATGG + Intronic
944143006 2:196477235-196477257 ATTCTTCCACATATTAAATATGG - Intronic
945708749 2:213269184-213269206 CCTTTTACAGAGATTAAACAAGG - Intergenic
946018909 2:216626113-216626135 CTTGTTGCAAAGAGTAAATTAGG - Intergenic
946049198 2:216847697-216847719 CTTAATACACAGTTTATATATGG + Intergenic
947012887 2:225585166-225585188 GTTTTCACACAGATCAAATAAGG + Intronic
947979181 2:234394866-234394888 CTTCTCACACAGCTTAACTATGG + Intergenic
1170027910 20:11910638-11910660 CTTTATACATAGGTTAAATATGG - Intronic
1170367234 20:15611193-15611215 TTTGTTACAAGGACTAAATAAGG - Intronic
1171286720 20:23945706-23945728 CTTTTTACACATTTTAAATTTGG - Intergenic
1172041261 20:32047682-32047704 CTTGTTCCAAAGATAAAAGAAGG - Intergenic
1172272356 20:33661949-33661971 ATTGTTACAAAGGTTAAATGAGG - Intronic
1173284489 20:41657882-41657904 CTTGTTTCACTGAGAAAATACGG + Intergenic
1173735439 20:45358138-45358160 CTTGTTTTAGAAATTAAATAAGG + Intergenic
1174269896 20:49360290-49360312 CTCTGTACACAGATTAAAGAGGG + Intergenic
1176243463 20:64085595-64085617 CTTATTCCACAGTTTAAATTAGG + Intronic
1176705473 21:10116211-10116233 CTAGTTACAAAGATTAATTTTGG + Intergenic
1177187670 21:17816082-17816104 TTTCTTACAAAGATTAAATTGGG + Intronic
1177205403 21:18004799-18004821 ATTGTTGCAAAGATTAAATGAGG + Intronic
1177372982 21:20230271-20230293 CTCTTTATATAGATTAAATAAGG - Intergenic
1177705422 21:24698183-24698205 CTTATTCCACAGATTAAACCAGG - Intergenic
1177903176 21:26942620-26942642 CTTGTTTCAAAGATTACTTAGGG + Intronic
1178192712 21:30304312-30304334 CTTGTCACAAAAATTAAATGAGG - Intergenic
949662546 3:6295830-6295852 ATGATTACACAAATTAAATAGGG + Intergenic
952582393 3:34849854-34849876 GTTGTTACACACTTTAAATCTGG + Intergenic
953204171 3:40806737-40806759 TATGTTACACATATTATATATGG - Intergenic
955841793 3:63120490-63120512 CTTGTTACAAATATTTAAGAAGG + Intergenic
955841907 3:63121496-63121518 CTTGTTACAAATATTTAAGAAGG - Intergenic
955928087 3:64027648-64027670 CTTGCAACACAGATAAAAAAAGG - Intergenic
959978843 3:112492174-112492196 CTTGTTACACAGAGTAGACAGGG - Intronic
960197546 3:114788322-114788344 ATGGTTACACAGTTTGAATATGG - Intronic
960545335 3:118907661-118907683 CTTGTTACGAACATTAAATGAGG - Intronic
962918661 3:139932174-139932196 CTTGTTGCAAAGATTAAAGAAGG + Intergenic
963088267 3:141458476-141458498 ATTGTTAAACAAATGAAATAAGG - Intergenic
963231600 3:142914010-142914032 CTTGCCACACACATAAAATATGG - Intergenic
964396944 3:156255657-156255679 ATTGTTAGACAGATAAAACAAGG - Intronic
965366247 3:167803530-167803552 ATTGTTGGAAAGATTAAATAAGG - Intronic
965399175 3:168197630-168197652 ATTGTTACCCAGAGGAAATACGG + Intergenic
965898497 3:173609511-173609533 ATTGTTATACATATTAAATTAGG - Intronic
965973553 3:174592722-174592744 ATTGTTACACAGATTAATAATGG - Intronic
967277617 3:187791885-187791907 CTGACTACACAGAATAAATATGG - Intergenic
969943445 4:10758575-10758597 CTTGTTTTACAGATGAAATCAGG + Intergenic
970293272 4:14600366-14600388 GCTGTTACATAGATTAAATGAGG - Intergenic
970604807 4:17669087-17669109 CTAGTTACATAGAGTAAAGAGGG - Intronic
970898300 4:21128957-21128979 CTTGACGGACAGATTAAATAAGG + Intronic
970940145 4:21622261-21622283 CTTGTCCCAGAGATCAAATAAGG - Intronic
971653186 4:29306209-29306231 AATGTTACACAAATTACATAAGG - Intergenic
971669271 4:29534888-29534910 CTTTTTATAAAGCTTAAATAAGG - Intergenic
972883845 4:43460367-43460389 CTTGATGAACAGATGAAATAAGG - Intergenic
972974394 4:44615747-44615769 CTTGTGAGACAGATTGAAGATGG - Intergenic
972981007 4:44701352-44701374 ATTTTTACATAGATTGAATAAGG - Intronic
973751679 4:54026024-54026046 CTTGTTGTGCAGATTAAGTAAGG - Intronic
974752222 4:66155809-66155831 ACTGTGACACAGATTTAATAAGG - Intergenic
976223453 4:82776758-82776780 ATTGTTACATAGACAAAATAAGG - Intronic
977063053 4:92279316-92279338 CTTTTTACAGAAATTTAATATGG + Intergenic
977474950 4:97493941-97493963 GTTGTTAAACAGATTTAACAAGG + Intronic
977546199 4:98381990-98382012 CTTTTTAAACCCATTAAATAAGG + Intronic
978011513 4:103691281-103691303 CTTGATACACGGATTAACTTGGG + Intronic
979565350 4:122148569-122148591 CTTCTGAGTCAGATTAAATAAGG - Intergenic
980344755 4:131599128-131599150 CTTTTTACACAGAGTATATATGG - Intergenic
980377734 4:131972912-131972934 CTAGTTACAAAGATTAATTTTGG + Intergenic
981462157 4:145025947-145025969 CCAGTTAGACAGATTAAAGAGGG + Intronic
982216348 4:153085664-153085686 GTTTTTAAACAGATTAAATTAGG + Intergenic
982261264 4:153496304-153496326 CCTGGTACAAAAATTAAATACGG + Intronic
982967651 4:161934047-161934069 ATTGTTACAAAGATCAAATGAGG - Intronic
983097900 4:163586658-163586680 CCTGTTAAATAGATTAAATTGGG - Intronic
983531781 4:168817080-168817102 CTTGTTCCACAAAATAAACAGGG + Intronic
984325932 4:178250525-178250547 GTTGGTACACACATTATATATGG - Intergenic
984339003 4:178429690-178429712 ATTGTTACAAAGAATAAATAAGG + Intergenic
984464492 4:180080439-180080461 CTTGTTAGAGAGATTGAGTAGGG + Intergenic
987290154 5:16501180-16501202 TTTGTTTTATAGATTAAATATGG - Intronic
987745826 5:21970511-21970533 CTTCTTAGACCGTTTAAATATGG + Intronic
987926005 5:24342732-24342754 CTTATTACACAGATCATACACGG + Intergenic
988010722 5:25479352-25479374 TTTGTCACACAGCTTAAATTAGG - Intergenic
990076918 5:51857519-51857541 CTCTTTAAACAGATTAGATAAGG - Intergenic
990658104 5:57980534-57980556 CATGTTATACATATTAGATAAGG + Intergenic
991766031 5:69980641-69980663 CTTCTTAGACCGTTTAAATATGG + Intergenic
991781290 5:70137519-70137541 CTTCTTAGACCGTTTAAATATGG - Intergenic
991845266 5:70855714-70855736 CTTCTTAGACCGTTTAAATATGG + Intergenic
991873735 5:71137833-71137855 CTTCTTAGACCGTTTAAATATGG - Intergenic
993486501 5:88494041-88494063 CTTGTCACGCAGTTTAAATATGG + Intergenic
993867330 5:93211041-93211063 CTGGTTACACATCTTAAAGAAGG - Intergenic
994349508 5:98728315-98728337 GTTGTTACAAAGATTAAATTAGG + Intergenic
994604272 5:101946474-101946496 CATGTTATACAGAGTATATATGG - Intergenic
995007574 5:107218729-107218751 GTTGTTACAGAGATTAAAAGTGG - Intergenic
999578728 5:153010412-153010434 AGAGTTACACAGATGAAATAGGG + Intergenic
1000418030 5:161005042-161005064 GTTGTTCCACAGAATGAATAGGG + Intergenic
1000456755 5:161458860-161458882 CATGTAACACAGAATAAATTAGG + Intronic
1000719479 5:164688983-164689005 ATGGTTATACAGATTAAATCAGG + Intergenic
1002803977 6:553803-553825 GTTGTTACACAGTTTTAAAATGG + Intronic
1004365886 6:15012308-15012330 ATTCTCACAGAGATTAAATAAGG - Intergenic
1008050583 6:46896611-46896633 GTTGTTAGGAAGATTAAATAAGG - Intronic
1008826370 6:55699266-55699288 TTTGTTACACAGGTTAAATCAGG - Intergenic
1008848845 6:55999395-55999417 CTTGTTAAGCATATTAAATTTGG + Intergenic
1009248244 6:61266716-61266738 CATGTTACAGAGATAAAATTGGG + Intergenic
1010115588 6:72304963-72304985 TTCCTTTCACAGATTAAATAAGG + Intronic
1010565369 6:77405407-77405429 CTTGTCTTACAGACTAAATATGG + Intergenic
1010641077 6:78328525-78328547 ATTCTTACACACATTAATTAAGG + Intergenic
1011568809 6:88711519-88711541 ATTGTTATATAGATTAAATGAGG - Intronic
1012842820 6:104351670-104351692 TTTGTTGCAATGATTAAATAGGG - Intergenic
1015016588 6:128420400-128420422 GTTGATTCACAGATTAAAGAAGG - Intronic
1015089317 6:129335697-129335719 GTTGTTAGGTAGATTAAATAAGG - Intronic
1015381044 6:132569616-132569638 TTTGTTACAAAGATACAATAGGG - Intergenic
1016057195 6:139590912-139590934 CCTGTTAAACAGATCAAATAAGG + Intergenic
1018180076 6:161215554-161215576 CTTGTTATACATTTAAAATATGG - Intronic
1020230648 7:6315801-6315823 CTTGTTAAACAGCTCAAATCTGG - Intergenic
1021774790 7:24042223-24042245 CTGGTTACATAGTATAAATACGG + Intergenic
1022763673 7:33385289-33385311 TTTGTTACACACATAAATTAAGG + Intronic
1023192248 7:37595185-37595207 CCTGTTACAGAGAGTAACTATGG + Intergenic
1026159310 7:67854618-67854640 TTTGTAACATAGATTAAATTTGG + Intergenic
1027915700 7:84318243-84318265 TTTGAAACACAGTTTAAATAAGG + Intronic
1028027383 7:85862925-85862947 ATTGTTGCAAAGATTAAATTAGG + Intergenic
1028454507 7:91024225-91024247 CTTGGTAAAAAGATTAAATAAGG - Intronic
1028890634 7:95984488-95984510 CTTGAAAAACAGCTTAAATATGG - Intronic
1029152831 7:98492969-98492991 CTTGCAACACTGATTAAATGGGG - Intergenic
1029697427 7:102223110-102223132 CATTTTACACAGGTAAAATATGG - Intronic
1030113866 7:106048788-106048810 CTTGTTATGCAGATGAAAAAAGG + Intergenic
1039143466 8:34419407-34419429 TTTTTTACATAGATTAATTATGG + Intergenic
1042990966 8:74639362-74639384 CCTGTTACAAAGATCATATAAGG - Intronic
1043209446 8:77492463-77492485 CTTGTAACACATGTTAAACATGG + Intergenic
1043278882 8:78438190-78438212 GTTATTACACAGATTATAGAAGG + Intergenic
1043888660 8:85631994-85632016 GTTGCTATGCAGATTAAATAAGG + Intergenic
1044422255 8:92010628-92010650 GTTGTTACAAAGATAAAATTAGG + Intronic
1044894100 8:96870360-96870382 ATTGATATACAGATTAAATACGG + Intronic
1045144434 8:99324846-99324868 CTAGTTACAAAGATTATATATGG + Intronic
1046485863 8:114887451-114887473 TTTGTTAGAAAGATCAAATAAGG + Intergenic
1046933182 8:119861784-119861806 TTTGTGACACAGATTAAAGGGGG + Intergenic
1047034983 8:120927707-120927729 GCTGTGAAACAGATTAAATAAGG + Intergenic
1047559095 8:125966920-125966942 GTTGTTCCACAGGGTAAATAAGG - Intergenic
1049486828 8:142869510-142869532 CTGCTTATACAGATCAAATAAGG + Intronic
1051057047 9:13000198-13000220 CTTGATACACAGAATAACTAGGG + Intergenic
1053642756 9:40103328-40103350 CTAGTTACAAAGATTAATTTTGG + Intergenic
1053763398 9:41362162-41362184 CTAGTTACAAAGATTAATTTTGG - Intergenic
1054323611 9:63700579-63700601 CTAGTTACAAAGATTAATTTTGG + Intergenic
1054542007 9:66273328-66273350 CTAGTTACAAAGATTAATTTTGG - Intergenic
1056318778 9:85417325-85417347 CTAGGTACCCAGTTTAAATAGGG - Intergenic
1056882229 9:90406678-90406700 TTTATAACACAGATGAAATAAGG - Intergenic
1056988071 9:91383492-91383514 CTAGGTACACAGATTAAACCCGG - Intergenic
1058528146 9:105880417-105880439 ATTGTTACAGTGAATAAATAGGG + Intergenic
1058605532 9:106718399-106718421 CTTGTTAAACAGAAATAATATGG + Intergenic
1059858236 9:118425913-118425935 CTTCATACACAGAGGAAATACGG - Intergenic
1061269449 9:129529292-129529314 CTTGTTACACATTTTCAATCTGG - Intergenic
1202790506 9_KI270719v1_random:86320-86342 CTAGTTACAAAGATTAATTTTGG + Intergenic
1186628829 X:11326007-11326029 CTTGTTGCACAGATTAAACTGGG - Intronic
1187404638 X:18992164-18992186 TCTGTGACACAGATCAAATAGGG + Intronic
1189312095 X:40026376-40026398 CTAGTTACACATAAAAAATACGG + Intergenic
1190823395 X:53995359-53995381 ATTGTTAAAAGGATTAAATAAGG - Intronic
1192207199 X:69104426-69104448 ATTGTTATGAAGATTAAATAAGG + Intergenic
1192538953 X:71952097-71952119 CTTGATAGACAGACAAAATAGGG - Intergenic
1193104016 X:77648659-77648681 CTTTTTGCACAGATTAATCAAGG + Intronic
1193326311 X:80181898-80181920 CTAGTTACACAGATATAACAAGG + Intergenic
1193526942 X:82603269-82603291 CTGGTTTCAAAGATTAAATTAGG - Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1196383779 X:115124685-115124707 GTTGTTGCACAGATTAAATAAGG - Intronic
1196570306 X:117259123-117259145 ATTGTTATGAAGATTAAATAAGG - Intergenic
1196605165 X:117648762-117648784 CTTGTTACAAAGGTAAAAAAAGG - Intergenic
1196754227 X:119143798-119143820 GTTGTCACAAAGATTAAATTAGG - Intronic
1197952339 X:131911097-131911119 CTTGCTATACAAATTAAATGGGG + Intergenic
1198013914 X:132589423-132589445 CTTTTTACACAGATCAAATCAGG - Intergenic
1199141228 X:144315398-144315420 TTTGTTACACATATTCAAAATGG - Intergenic
1199412463 X:147540269-147540291 CTTCTTACAAGGATTAAATAAGG - Intergenic
1200098421 X:153674917-153674939 GTTTTTACACAGAGTATATATGG - Intronic
1200933043 Y:8714489-8714511 CTTTTAACACAGATTAAAGGAGG + Intergenic