ID: 1108373104

View in Genome Browser
Species Human (GRCh38)
Location 13:49790630-49790652
Sequence GTAATGTTGTGACCAATACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108373101_1108373104 29 Left 1108373101 13:49790578-49790600 CCATTTGAATGTCTATTTCATGT 0: 1
1: 0
2: 2
3: 44
4: 417
Right 1108373104 13:49790630-49790652 GTAATGTTGTGACCAATACCAGG 0: 1
1: 0
2: 1
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108373104 Original CRISPR GTAATGTTGTGACCAATACC AGG Intronic
904964596 1:34361671-34361693 GGAATCATGTGACCAATATCTGG - Intergenic
913964462 1:143363940-143363962 GAAATGTTTTGACAAATACGTGG - Intergenic
914058831 1:144189546-144189568 GAAATGTTTTGACAAATACGTGG - Intergenic
914120318 1:144776825-144776847 GAAATGTTTTGACAAATACGTGG + Intergenic
1073809829 10:107140823-107140845 CTAATATTGTGACCACTAACAGG - Intronic
1084129308 11:67120379-67120401 GTAATGTAGTGACAAAAACGGGG + Intronic
1095137074 12:38617828-38617850 GTAATCATGTGACCAAGATCTGG - Intergenic
1103510711 12:121471779-121471801 TTAATGTTGAGACCAATGACGGG + Intronic
1103990869 12:124798440-124798462 GTCATGTTGTCACAAATAACAGG - Intronic
1108373104 13:49790630-49790652 GTAATGTTGTGACCAATACCAGG + Intronic
1111365135 13:87233981-87234003 GTCATGTTGTAACCACTCCCTGG + Intergenic
1119992234 14:79211901-79211923 TTAATGTTCAGAGCAATACCAGG - Intronic
1124903687 15:33848210-33848232 GTTAATTTGTGACAAATACCTGG + Intronic
1134100949 16:11450972-11450994 GTAATGTTGTGACTCATGACAGG + Intronic
1141442825 16:84040541-84040563 GTAGGGTTGTGGCCAATCCCCGG - Intronic
1157979173 18:52361089-52361111 GTCATGTTGAGACAAAAACCTGG + Intronic
1202698234 1_KI270712v1_random:141431-141453 GAAATGTTTTGACAAATACGTGG - Intergenic
926369200 2:12163463-12163485 GTAATGTTGTGATCAATGCTAGG + Intergenic
926844666 2:17123237-17123259 GTAGTGTTGTAACCAAAAGCAGG + Intergenic
930327552 2:49939351-49939373 GTAACATTGTTACCAATAGCTGG + Intronic
934279486 2:91599214-91599236 GAAATGTTTTGACAAATACGTGG - Intergenic
942114428 2:172713599-172713621 GCAAAGTTGTGACCAAGCCCAGG - Intergenic
944741914 2:202620810-202620832 GTAATGGTGTGTCCATTAGCAGG + Intergenic
1183053391 22:35284034-35284056 GTAATGTTCTTACCTATACCTGG - Exonic
1183507137 22:38215446-38215468 GTTGTGTTGGGACCAAAACCTGG + Exonic
952245022 3:31578572-31578594 GTAATTTTGTCAGCAATACTGGG - Intronic
959852055 3:111098995-111099017 GTCATTTTGTTACCAATACTTGG + Intronic
959926693 3:111929763-111929785 GTAATGCTGTGACCACTACCTGG - Intronic
961071368 3:123931145-123931167 GTAATGTTATCCCCAATATCTGG + Exonic
963411435 3:144932122-144932144 GGCATGTTGTAACCAATCCCTGG - Intergenic
964422128 3:156514218-156514240 ATAATGTTGTCACCAATATTAGG + Intronic
968057684 3:195705274-195705296 GTCAGGTTGTCACCAAGACCAGG - Intergenic
969031266 4:4216682-4216704 GAAATGTTCTGACAAATACGTGG + Intronic
970090476 4:12401329-12401351 GAAATGTGGTGAACAATTCCTGG - Intergenic
974521268 4:62983803-62983825 TTAATTTTGTTGCCAATACCCGG + Intergenic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
980862236 4:138513425-138513447 ATAATGTTGTGTCCATTGCCAGG - Intergenic
990337084 5:54785579-54785601 GCAATATTGTGACAAATACTTGG - Intergenic
991211731 5:64113274-64113296 ACAATGTTGAGTCCAATACCTGG + Intergenic
992230090 5:74655254-74655276 AGAATGTTCTAACCAATACCTGG + Intronic
995610817 5:113908886-113908908 GAAAAGTTGTGACAAAAACCTGG - Intergenic
997682634 5:135766868-135766890 GTAATATTGTTCCCAATATCAGG + Intergenic
999735952 5:154513236-154513258 GTAAAGGTGTGGCTAATACCTGG - Intergenic
1000201417 5:159014713-159014735 GTAACCATGTGACCAATTCCTGG + Intronic
1000885720 5:166745263-166745285 GTGATGTTGTTTGCAATACCAGG + Intergenic
1001135692 5:169100736-169100758 GTGATCCTGTGACCAATTCCAGG + Intronic
1004811269 6:19266432-19266454 GAAATGTGAGGACCAATACCTGG + Intergenic
1006588117 6:35132226-35132248 GACATGTTGTCACCACTACCTGG + Intronic
1009778225 6:68233907-68233929 GTAAGCATGTGACCAAAACCTGG + Intergenic
1010349735 6:74859067-74859089 AAAATGTTTTGACCAAAACCAGG - Intergenic
1012330362 6:97978117-97978139 GGAATGTTGTGACAAATATGTGG + Intergenic
1021492934 7:21239655-21239677 GTAATGTTGTGAACTCCACCTGG + Intergenic
1028053160 7:86209057-86209079 GTAAAGTTGTGGCCAAGCCCAGG - Intergenic
1029434313 7:100553768-100553790 GGAATATGGTGTCCAATACCTGG + Intronic
1034106919 7:148498040-148498062 GAAAGGTAGTGACCAATAACTGG + Intergenic
1036435887 8:8732791-8732813 GTAATAATGTCACCAATTCCAGG - Intergenic
1040589403 8:48776497-48776519 GTAATCTTGTTACCAAGTCCAGG - Intergenic
1040978398 8:53219372-53219394 GTCATCTTGTGACAAATCCCAGG - Intergenic
1047682593 8:127269652-127269674 ATAATGTTGTCACCAATGCAAGG + Intergenic
1048805512 8:138237554-138237576 GTAATGTTGGACCAAATACCTGG - Intronic
1054907932 9:70427062-70427084 TAAATGTTGTGAACAATACTAGG + Intergenic
1055618837 9:78102066-78102088 GAAATGCTGTTACCAATAGCAGG + Intergenic
1198623808 X:138545096-138545118 GTAATTTTTTGACCATTTCCTGG - Intergenic
1199833517 X:151566072-151566094 GAAATGTTGAAACCAAAACCAGG - Intronic
1199908135 X:152256666-152256688 ATTATGCTGTTACCAATACCTGG - Intronic
1200761864 Y:7046010-7046032 GTAAAAGTGTGACCAAAACCTGG + Intronic
1200907351 Y:8497619-8497641 GTCAAGTTGTGACATATACCAGG + Intergenic