ID: 1108376671

View in Genome Browser
Species Human (GRCh38)
Location 13:49820453-49820475
Sequence TTGTAGATGGAAAGTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108376668_1108376671 -2 Left 1108376668 13:49820432-49820454 CCTCAGCTTTCCAAGGAGTTATT No data
Right 1108376671 13:49820453-49820475 TTGTAGATGGAAAGTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108376671 Original CRISPR TTGTAGATGGAAAGTGAAGA AGG Intergenic
No off target data available for this crispr