ID: 1108376671 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:49820453-49820475 |
Sequence | TTGTAGATGGAAAGTGAAGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1108376668_1108376671 | -2 | Left | 1108376668 | 13:49820432-49820454 | CCTCAGCTTTCCAAGGAGTTATT | No data | ||
Right | 1108376671 | 13:49820453-49820475 | TTGTAGATGGAAAGTGAAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1108376671 | Original CRISPR | TTGTAGATGGAAAGTGAAGA AGG | Intergenic | ||
No off target data available for this crispr |