ID: 1108377407

View in Genome Browser
Species Human (GRCh38)
Location 13:49826347-49826369
Sequence CTCATGAAGGGGAATTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108377398_1108377407 16 Left 1108377398 13:49826308-49826330 CCAGACATGTCATGGACGGTCTG No data
Right 1108377407 13:49826347-49826369 CTCATGAAGGGGAATTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108377407 Original CRISPR CTCATGAAGGGGAATTTGTG AGG Intergenic
No off target data available for this crispr