ID: 1108379283

View in Genome Browser
Species Human (GRCh38)
Location 13:49841090-49841112
Sequence GTGAACCATAAGAATATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108379275_1108379283 26 Left 1108379275 13:49841041-49841063 CCCCTCTGCAGAGGTGACATTTG No data
Right 1108379283 13:49841090-49841112 GTGAACCATAAGAATATGGGAGG No data
1108379277_1108379283 24 Left 1108379277 13:49841043-49841065 CCTCTGCAGAGGTGACATTTGCA No data
Right 1108379283 13:49841090-49841112 GTGAACCATAAGAATATGGGAGG No data
1108379280_1108379283 -5 Left 1108379280 13:49841072-49841094 CCTAAATGAAGAGAGGAAGTGAA No data
Right 1108379283 13:49841090-49841112 GTGAACCATAAGAATATGGGAGG No data
1108379279_1108379283 1 Left 1108379279 13:49841066-49841088 CCAAGACCTAAATGAAGAGAGGA No data
Right 1108379283 13:49841090-49841112 GTGAACCATAAGAATATGGGAGG No data
1108379276_1108379283 25 Left 1108379276 13:49841042-49841064 CCCTCTGCAGAGGTGACATTTGC No data
Right 1108379283 13:49841090-49841112 GTGAACCATAAGAATATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108379283 Original CRISPR GTGAACCATAAGAATATGGG AGG Intergenic
No off target data available for this crispr