ID: 1108380125

View in Genome Browser
Species Human (GRCh38)
Location 13:49847202-49847224
Sequence TCATGCAAGGCTCTGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108380125_1108380137 3 Left 1108380125 13:49847202-49847224 CCACAGCACAGAGCCTTGCATGA No data
Right 1108380137 13:49847228-49847250 GGAGGGAGGGAGGGATGGATGGG No data
1108380125_1108380133 -7 Left 1108380125 13:49847202-49847224 CCACAGCACAGAGCCTTGCATGA No data
Right 1108380133 13:49847218-49847240 TGCATGAGAGGGAGGGAGGGAGG No data
1108380125_1108380138 13 Left 1108380125 13:49847202-49847224 CCACAGCACAGAGCCTTGCATGA No data
Right 1108380138 13:49847238-49847260 AGGGATGGATGGGTGATTGCCGG No data
1108380125_1108380132 -10 Left 1108380125 13:49847202-49847224 CCACAGCACAGAGCCTTGCATGA No data
Right 1108380132 13:49847215-49847237 CCTTGCATGAGAGGGAGGGAGGG No data
1108380125_1108380135 -2 Left 1108380125 13:49847202-49847224 CCACAGCACAGAGCCTTGCATGA No data
Right 1108380135 13:49847223-49847245 GAGAGGGAGGGAGGGAGGGATGG 0: 492
1: 6360
2: 12646
3: 23418
4: 40489
1108380125_1108380134 -6 Left 1108380125 13:49847202-49847224 CCACAGCACAGAGCCTTGCATGA No data
Right 1108380134 13:49847219-49847241 GCATGAGAGGGAGGGAGGGAGGG No data
1108380125_1108380136 2 Left 1108380125 13:49847202-49847224 CCACAGCACAGAGCCTTGCATGA No data
Right 1108380136 13:49847227-49847249 GGGAGGGAGGGAGGGATGGATGG 0: 74
1: 5746
2: 12254
3: 21658
4: 48750

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108380125 Original CRISPR TCATGCAAGGCTCTGTGCTG TGG (reversed) Intergenic
No off target data available for this crispr