ID: 1108380359

View in Genome Browser
Species Human (GRCh38)
Location 13:49848652-49848674
Sequence CCCATGTGGCCCCAGCTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108380349_1108380359 30 Left 1108380349 13:49848599-49848621 CCTCTCTACAAAAATTAAAAAGT 0: 2
1: 7
2: 51
3: 359
4: 2183
Right 1108380359 13:49848652-49848674 CCCATGTGGCCCCAGCTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108380359 Original CRISPR CCCATGTGGCCCCAGCTACT AGG Intergenic
No off target data available for this crispr