ID: 1108385102

View in Genome Browser
Species Human (GRCh38)
Location 13:49892523-49892545
Sequence CCTTCTTTGGATAAAATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108385098_1108385102 4 Left 1108385098 13:49892496-49892518 CCAGCAGAACTCAGAAGTTTTAA No data
Right 1108385102 13:49892523-49892545 CCTTCTTTGGATAAAATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108385102 Original CRISPR CCTTCTTTGGATAAAATGGA TGG Intergenic
No off target data available for this crispr