ID: 1108385555

View in Genome Browser
Species Human (GRCh38)
Location 13:49896219-49896241
Sequence CTGTGGAAGGTCAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108385547_1108385555 11 Left 1108385547 13:49896185-49896207 CCAGGAGTGGTGGCCCATGTCTG No data
Right 1108385555 13:49896219-49896241 CTGTGGAAGGTCAAGGTGGGTGG No data
1108385549_1108385555 -3 Left 1108385549 13:49896199-49896221 CCATGTCTGTAATCTCAGCACTG No data
Right 1108385555 13:49896219-49896241 CTGTGGAAGGTCAAGGTGGGTGG No data
1108385548_1108385555 -2 Left 1108385548 13:49896198-49896220 CCCATGTCTGTAATCTCAGCACT 0: 8
1: 186
2: 1462
3: 2932
4: 3462
Right 1108385555 13:49896219-49896241 CTGTGGAAGGTCAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108385555 Original CRISPR CTGTGGAAGGTCAAGGTGGG TGG Intergenic
No off target data available for this crispr