ID: 1108386475

View in Genome Browser
Species Human (GRCh38)
Location 13:49903908-49903930
Sequence CCTGTAGTCCCAGCCTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108386475_1108386481 26 Left 1108386475 13:49903908-49903930 CCAGAGCAGGCTGGGACTACAGG No data
Right 1108386481 13:49903957-49903979 TTTGTATTTTTTAGTAGAGGTGG 0: 178
1: 7576
2: 7796
3: 10242
4: 36565
1108386475_1108386482 27 Left 1108386475 13:49903908-49903930 CCAGAGCAGGCTGGGACTACAGG No data
Right 1108386482 13:49903958-49903980 TTGTATTTTTTAGTAGAGGTGGG 0: 70
1: 3271
2: 10520
3: 12565
4: 30400
1108386475_1108386483 28 Left 1108386475 13:49903908-49903930 CCAGAGCAGGCTGGGACTACAGG No data
Right 1108386483 13:49903959-49903981 TGTATTTTTTAGTAGAGGTGGGG 0: 66
1: 3026
2: 8145
3: 13057
4: 30222
1108386475_1108386480 23 Left 1108386475 13:49903908-49903930 CCAGAGCAGGCTGGGACTACAGG No data
Right 1108386480 13:49903954-49903976 TTTTTTGTATTTTTTAGTAGAGG 0: 115
1: 213
2: 548
3: 1372
4: 7800

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108386475 Original CRISPR CCTGTAGTCCCAGCCTGCTC TGG (reversed) Intergenic
No off target data available for this crispr