ID: 1108389645

View in Genome Browser
Species Human (GRCh38)
Location 13:49936014-49936036
Sequence GCGCAGCGTCGCCGGCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108389636_1108389645 30 Left 1108389636 13:49935961-49935983 CCCAGGTGGAGTCCGCCGGCTTC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1108389645 13:49936014-49936036 GCGCAGCGTCGCCGGCGCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 138
1108389639_1108389645 18 Left 1108389639 13:49935973-49935995 CCGCCGGCTTCTGGAGAGATCTG 0: 1
1: 0
2: 1
3: 11
4: 101
Right 1108389645 13:49936014-49936036 GCGCAGCGTCGCCGGCGCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 138
1108389640_1108389645 15 Left 1108389640 13:49935976-49935998 CCGGCTTCTGGAGAGATCTGCGA 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1108389645 13:49936014-49936036 GCGCAGCGTCGCCGGCGCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 138
1108389637_1108389645 29 Left 1108389637 13:49935962-49935984 CCAGGTGGAGTCCGCCGGCTTCT 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1108389645 13:49936014-49936036 GCGCAGCGTCGCCGGCGCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108389645 Original CRISPR GCGCAGCGTCGCCGGCGCGG CGG Intronic
900131360 1:1088551-1088573 GCGCAGCGTCGGCCTGGCGGGGG - Intronic
900240774 1:1616235-1616257 GCGCACGGGCGCCGGCGCAGGGG - Intronic
900269174 1:1778424-1778446 GCTCGGCGGCGCCGGCGCCGGGG - Intronic
900525283 1:3125492-3125514 GGGCAGAGTCGCCGGCTCAGCGG + Intronic
910758984 1:90717498-90717520 GCGCGGCGGTGGCGGCGCGGAGG + Intergenic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920912609 1:210232824-210232846 GCGCAGCGCCCCAGTCGCGGCGG + Exonic
922518268 1:226223920-226223942 GCGCTGCGACGCCGACGGGGCGG - Exonic
1064981954 10:21174162-21174184 GCGCGGCGGCGGCGGCGAGGCGG - Intronic
1065373814 10:25016647-25016669 GCGCAGAGTCCACTGCGCGGGGG + Exonic
1066126464 10:32347199-32347221 GCGCAGCGGCGCGGGCACGCGGG + Intronic
1070570786 10:77638178-77638200 GCGCAGGGGCGCCCGGGCGGAGG - Intronic
1077107896 11:849813-849835 GCGCGGGGTCGGGGGCGCGGGGG + Intronic
1077238614 11:1498439-1498461 TCGCAGCGTCGCAGCCGTGGTGG + Intronic
1077253751 11:1571804-1571826 GCGCCGCGTCGGGGGCGCTGGGG - Intronic
1078210383 11:9265289-9265311 CTGCAGCGGCGGCGGCGCGGAGG - Exonic
1080383726 11:31798551-31798573 GCACAGAGTTGCCGGCGTGGGGG - Intronic
1083436336 11:62646214-62646236 GCGCGGGGTCGTCGGGGCGGGGG - Intronic
1085205830 11:74731362-74731384 CAGCAGCGGCGGCGGCGCGGCGG + Intronic
1085208096 11:74749156-74749178 CCGCCGCGTCGGCGGCGCGTTGG - Exonic
1091273258 11:134332404-134332426 GCCCGGCGTCACAGGCGCGGCGG - Intronic
1091823258 12:3491752-3491774 GAGCGGCGGCGGCGGCGCGGTGG - Intronic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1103407718 12:120687395-120687417 GGCCGGCGTGGCCGGCGCGGCGG + Exonic
1104601924 12:130160813-130160835 GCGCAGCGTCCCCACCGCGGGGG + Intergenic
1104961623 12:132490766-132490788 TCGCGGCGGCGGCGGCGCGGGGG - Exonic
1105413838 13:20192798-20192820 GCGCGGCGGGGCCGGGGCGGGGG + Intronic
1106422430 13:29595281-29595303 TGGCAGCGTTCCCGGCGCGGGGG + Intronic
1106517171 13:30465414-30465436 GCGGAGCGCGGCCGGGGCGGCGG - Intronic
1107481531 13:40789642-40789664 ACGCGGCCACGCCGGCGCGGCGG + Exonic
1108389645 13:49936014-49936036 GCGCAGCGTCGCCGGCGCGGCGG + Intronic
1119003848 14:70907368-70907390 GCGCACCGTAGCCGGCCCAGGGG + Intergenic
1119249241 14:73137663-73137685 GCGCAGGGTCGCCAGAGCTGAGG + Intronic
1119759656 14:77141544-77141566 GTGCGGCGGCGGCGGCGCGGGGG - Intronic
1120168065 14:81221041-81221063 GCGCAGGCGCGCCGGGGCGGAGG + Intronic
1122486800 14:102087287-102087309 GCGCATTGAGGCCGGCGCGGGGG - Intronic
1122581987 14:102777136-102777158 GCGCGGCGGCGGGGGCGCGGCGG + Intergenic
1122975308 14:105168477-105168499 GCGCTGGGAGGCCGGCGCGGCGG - Exonic
1122993213 14:105248639-105248661 GGGCAGGGTCGCAGGGGCGGGGG + Exonic
1124469369 15:29969099-29969121 GCCCAGCGGCTCCGGAGCGGGGG - Intergenic
1126087330 15:45022718-45022740 GCGCTGCAGGGCCGGCGCGGTGG + Intergenic
1128732983 15:70033635-70033657 GCCCAGCGCCCCAGGCGCGGGGG + Intergenic
1128812936 15:70585430-70585452 GAGCAGGGTCGCTGCCGCGGCGG + Intergenic
1129752822 15:78077691-78077713 GCGCAGCGGCCGCGGCGCGGAGG - Intronic
1129862399 15:78872804-78872826 GCGCAGGGGCGCGTGCGCGGCGG + Exonic
1131431893 15:92394458-92394480 GCGCAGTGTCGCCGGGGTCGAGG + Intronic
1131485897 15:92820432-92820454 CCGCCGCGTCGGCGGGGCGGTGG - Intergenic
1132028287 15:98420978-98421000 GCGCAGCTTTGCAGGCGCTGGGG - Intergenic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132419298 15:101652068-101652090 GCTCGGTGTCGCCGGAGCGGAGG + Intronic
1134509369 16:14834040-14834062 GCGCCGAGTCGCCGGGCCGGTGG + Intronic
1134681589 16:16129823-16129845 TCACAGCGTTGCCGGCGCAGTGG - Intronic
1134697074 16:16232855-16232877 GCGCCGAGTCGCCGGGCCGGTGG + Intronic
1134974769 16:18561830-18561852 GCGCCGAGTCGCCGGGCCGGTGG - Intronic
1138179222 16:54930993-54931015 GCGCAGAGGAGCGGGCGCGGCGG + Exonic
1142285908 16:89171470-89171492 GCGCAGGTGCGCCGGCGGGGCGG - Intergenic
1142762723 17:2051161-2051183 CCGCAGCCTGGCCGGCGCGGCGG + Intergenic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143583918 17:7842119-7842141 GCGCAGCGCCGCAGCCGCGCGGG - Intronic
1144339746 17:14301685-14301707 GAGCAGCAGCCCCGGCGCGGCGG - Exonic
1144825922 17:18105717-18105739 GCCCAGCGTCCCTGGGGCGGAGG - Intronic
1144953274 17:19005081-19005103 GCCCAGTTTCGCCGGCGTGGCGG + Intronic
1144991604 17:19237502-19237524 GCGCACCCACGCCGGCCCGGAGG + Exonic
1146955858 17:36936115-36936137 GAGGCGCGGCGCCGGCGCGGGGG - Intergenic
1147740798 17:42670108-42670130 GCGGAGCGGGCCCGGCGCGGCGG - Exonic
1148755768 17:49972245-49972267 GCGCTGCGGTGCCGCCGCGGGGG - Intronic
1151370788 17:73645047-73645069 GCGCCGCGTCCCCGGAGCCGGGG - Intergenic
1152357336 17:79813519-79813541 GCGCGGGGTCACCGGCGGGGGGG + Intergenic
1152654345 17:81513006-81513028 GCGCAGGGTCGCGAGCGCGCGGG - Intronic
1154169275 18:12038809-12038831 GCGCAGTGTGGCCGCCGCGTGGG - Intergenic
1160896940 19:1407554-1407576 GCGCAGGGGCGGCGGCGCGGCGG + Intronic
1160909678 19:1468847-1468869 GCTCAGCGTCGCCAGCTCCGAGG - Exonic
1161400677 19:4065399-4065421 CCGCCGCCTCGCCCGCGCGGGGG + Intronic
1161494967 19:4581616-4581638 GCGCAGCGCCGTGGGCCCGGGGG - Intergenic
1162141003 19:8585563-8585585 GCGCCGCGTCTCTGCCGCGGAGG - Exonic
1162341904 19:10096366-10096388 GCGCAGCGCCGCCAGCTCGCTGG + Exonic
1162470927 19:10871662-10871684 GCGCAGCGGCGGCGGCGGCGGGG + Exonic
1162535867 19:11262518-11262540 GCGGGGCGGGGCCGGCGCGGGGG + Intergenic
1163154497 19:15432543-15432565 GGGCGGCGGCGGCGGCGCGGGGG + Intronic
1163651798 19:18522099-18522121 GCGGGGCGTGGCCGGCGTGGCGG - Exonic
1166126336 19:40717269-40717291 GCGCAGGGGCCCCGGCGGGGCGG + Exonic
1167103836 19:47419310-47419332 GCGCATCGCCGCCGGGGCGGGGG + Intronic
1167495713 19:49817634-49817656 GGGCAGCGGGCCCGGCGCGGTGG + Intergenic
925349230 2:3189535-3189557 GCGCAGCAGCTCCGGCGGGGCGG + Intronic
929133500 2:38602158-38602180 GCGCGGCGGCGGCGGCGGGGAGG - Intronic
929789795 2:45014074-45014096 GCGGAGGGGCGCGGGCGCGGCGG + Intergenic
932236581 2:70125329-70125351 GCGCAGGGGCGCCTGCGCGCAGG + Intergenic
934566976 2:95346595-95346617 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
941580696 2:167293121-167293143 CGGCAGCGCCGGCGGCGCGGCGG - Intergenic
947538537 2:230957546-230957568 GCCCAGCACCGCCGGCGCCGCGG - Intronic
1171012421 20:21515744-21515766 GCTCAGCTTGGCCCGCGCGGAGG - Intergenic
1172284642 20:33732136-33732158 GCGCAGCGGCCGCGGGGCGGAGG + Intronic
1176278214 20:64286480-64286502 GCGCGCCTGCGCCGGCGCGGTGG + Intronic
1178513833 21:33229902-33229924 CCGCGCCGCCGCCGGCGCGGGGG - Intronic
1179885053 21:44310326-44310348 GCCCAGTGTGGCCGGCGTGGCGG + Intronic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1182087808 22:27573650-27573672 GCGCAGCCTCGCCAGCCCAGGGG + Intergenic
1183893772 22:40951349-40951371 GCGCTGCTGCGCAGGCGCGGTGG + Exonic
1185420264 22:50731023-50731045 GGGCAGCGGCGACGGCGAGGGGG - Intergenic
951411574 3:22372735-22372757 GCGGAGCGCCGCGAGCGCGGCGG - Intronic
954004236 3:47578922-47578944 GTGCGGCGGGGCCGGCGCGGCGG - Exonic
955400366 3:58587016-58587038 GGGCCGCGTCACCGTCGCGGAGG - Intronic
956414527 3:69013133-69013155 GCGCGGCGTCTCAGCCGCGGCGG - Intronic
960024396 3:112991360-112991382 GCGCTGTGACGCCGGCGCGCAGG - Intronic
968775449 4:2537019-2537041 GCGCAGCGCCGCCGCCGGGCCGG - Intronic
968965127 4:3765854-3765876 GCGCAGCGGGGCGGGCGCGCGGG - Intergenic
969378980 4:6782416-6782438 GTGCAGCTTGGCCGGGGCGGCGG - Intronic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
986330706 5:6714216-6714238 GGGCAGCGCGGCGGGCGCGGTGG - Intergenic
992078898 5:73216139-73216161 GCCCAGCATCGAGGGCGCGGCGG + Intergenic
994353071 5:98769037-98769059 AGGCAGCGCCGCCGGCCCGGAGG + Intronic
995574309 5:113513634-113513656 GCGCAGCGGCGGCCGCGCTGAGG + Intergenic
997521375 5:134526329-134526351 GCGCCCCCTCGCCGGCCCGGGGG - Intronic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
998130686 5:139649770-139649792 GTGCAGCGTGGCAGGCGCCGGGG - Intronic
1015149344 6:130020221-130020243 GCGCCGCGGCGGCGGGGCGGGGG + Intronic
1016738863 6:147508165-147508187 CCGCAGCGTCCCCAGCGCCGTGG + Intergenic
1019453129 7:1109947-1109969 GCGCAGCCTCGCCGGGCCGTGGG + Intronic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1022459902 7:30595077-30595099 GAGCAGCATGGACGGCGCGGGGG + Exonic
1022675607 7:32495907-32495929 GCGAAGGGTCGCAGGCGCTGTGG - Intronic
1023984956 7:45088951-45088973 GCGCAGGCTCGGCGGGGCGGCGG - Intergenic
1028599961 7:92590527-92590549 GCGCAGCGTCGCCTGCTCTTGGG - Intergenic
1029640763 7:101817446-101817468 GCGCGGAGTCCCCGGCGCCGCGG + Intronic
1030138701 7:106284564-106284586 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1034962997 7:155374044-155374066 GCGGGGCATCACCGGCGCGGAGG + Intergenic
1036723611 8:11200644-11200666 GCGCTGCGCCCCCGGCGTGGGGG + Exonic
1038429852 8:27491318-27491340 GCCCAGCGCCGCCGCCGCAGTGG + Intronic
1045510714 8:102810436-102810458 GCGGAGCGGCCCGGGCGCGGCGG + Intergenic
1049694092 8:143975242-143975264 ACGCAGCGGAGCCGGCGCAGCGG - Intronic
1053690490 9:40584409-40584431 GGGCGGCGGCGGCGGCGCGGCGG - Intergenic
1056386282 9:86099588-86099610 GAGCAGCGCCGGCGGCGCGAAGG + Intronic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1060406008 9:123373470-123373492 GCGCAGCGCCACCGGGGTGGCGG - Exonic
1061075741 9:128340542-128340564 GCGCTGCGCCGCCGGCTCTGTGG + Intergenic
1061144058 9:128787046-128787068 CCGCAGGGTCGGCGGCGCTGGGG + Intergenic
1062022557 9:134326353-134326375 GCGCTGCGGCGCCGGCGGGGGGG - Intronic
1062499522 9:136846282-136846304 GCGTGGCGGCGCCAGCGCGGGGG - Exonic
1062537832 9:137028569-137028591 CTGCAGAGTCGCCAGCGCGGTGG - Intronic
1062558860 9:137130179-137130201 GCGCGGCGTCGCGGGGGCCGAGG + Intergenic
1062599827 9:137314738-137314760 GGGCAGCGTCGGCGGCGAGAAGG + Intronic
1062640309 9:137515277-137515299 GCCCAGCATCGCCGCCGAGGCGG - Intronic
1062699996 9:137894269-137894291 CCACAGCCTCGCCGGCACGGGGG + Intronic
1186426091 X:9465202-9465224 GCGCTGCGGCGGCGGCGGGGCGG - Exonic
1190062260 X:47219058-47219080 GAGCCGCGGGGCCGGCGCGGCGG - Intronic
1200126814 X:153819104-153819126 GCGCCGCGACGGCGGCGGGGTGG + Intronic