ID: 1108397803

View in Genome Browser
Species Human (GRCh38)
Location 13:50007196-50007218
Sequence ACGCTGGGCCCTATTTTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108397803_1108397812 13 Left 1108397803 13:50007196-50007218 CCCAAAAAAATAGGGCCCAGCGT 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1108397812 13:50007232-50007254 TATAATCCCAGCACTTTGGGAGG 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
1108397803_1108397814 19 Left 1108397803 13:50007196-50007218 CCCAAAAAAATAGGGCCCAGCGT 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1108397814 13:50007238-50007260 CCCAGCACTTTGGGAGGCTGAGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
1108397803_1108397817 26 Left 1108397803 13:50007196-50007218 CCCAAAAAAATAGGGCCCAGCGT 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1108397817 13:50007245-50007267 CTTTGGGAGGCTGAGGCAGGTGG 0: 25296
1: 77323
2: 157079
3: 168016
4: 148902
1108397803_1108397816 23 Left 1108397803 13:50007196-50007218 CCCAAAAAAATAGGGCCCAGCGT 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1108397816 13:50007242-50007264 GCACTTTGGGAGGCTGAGGCAGG 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
1108397803_1108397809 9 Left 1108397803 13:50007196-50007218 CCCAAAAAAATAGGGCCCAGCGT 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1108397809 13:50007228-50007250 CGCCTATAATCCCAGCACTTTGG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
1108397803_1108397810 10 Left 1108397803 13:50007196-50007218 CCCAAAAAAATAGGGCCCAGCGT 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1108397810 13:50007229-50007251 GCCTATAATCCCAGCACTTTGGG 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108397803 Original CRISPR ACGCTGGGCCCTATTTTTTT GGG (reversed) Intronic
904684841 1:32252394-32252416 ACTCTGAGCCTTAATTTTTTTGG + Intronic
905092578 1:35441212-35441234 ATGCAGGGCCCTATTTTGGTGGG + Intronic
911139226 1:94480451-94480473 TCGCTGGGCCCTATTATTATTGG - Exonic
911785237 1:101938197-101938219 ATAGTGGGCCCTATTTGTTTAGG - Intronic
912236865 1:107861627-107861649 ACACTGGACACTATTTTTATTGG - Intronic
916010621 1:160702334-160702356 AGGCTGGGACCTATTTGGTTTGG + Intronic
1066953606 10:42145263-42145285 ACGCTGGACCCTGTTTTCCTGGG + Intergenic
1069564818 10:69456854-69456876 ACTCAGGGCCCTCTTGTTTTCGG + Intronic
1076320176 10:129573774-129573796 ACCCTTGACCATATTTTTTTTGG + Intronic
1079365684 11:19807419-19807441 AAGCTGGGCCTTTCTTTTTTGGG + Intronic
1092668104 12:10829411-10829433 TCGCTGGACTCTATTTTGTTTGG - Intronic
1101151861 12:101890370-101890392 GAGCCCGGCCCTATTTTTTTTGG + Intronic
1104496229 12:129242136-129242158 GCCCTTGGCCCTATTTTCTTAGG + Intronic
1107414363 13:40187537-40187559 AAGCTGGGCTTTATCTTTTTTGG - Intergenic
1108397803 13:50007196-50007218 ACGCTGGGCCCTATTTTTTTGGG - Intronic
1109287903 13:60433667-60433689 AGGCTGAGCCCTGTTTTGTTTGG + Intronic
1109451079 13:62515045-62515067 ATGCTGAGACCTGTTTTTTTAGG + Intergenic
1111624618 13:90768726-90768748 AGGCTGGAACATATTTTTTTTGG - Intergenic
1117838465 14:59832141-59832163 ACACTGGGCCTTCATTTTTTTGG - Intronic
1119248947 14:73136214-73136236 ACGCTGGGCCCAATTTATATAGG + Intergenic
1119697166 14:76722078-76722100 TCACTGGGCCCCATTTTTGTTGG + Intergenic
1120126520 14:80750516-80750538 ATGCTGGGACCGATTTTGTTTGG - Intronic
1122518953 14:102329258-102329280 ACGCCCGGCCCAATTTCTTTGGG + Intronic
1129273034 15:74429342-74429364 AAGCTGGGCTCTGTTTTTTGAGG - Intronic
1136388394 16:29945265-29945287 ACTCAGAGCCCCATTTTTTTTGG + Intronic
1140688754 16:77460507-77460529 ACGCTAGGCTCTTTTTTTTTTGG + Intergenic
1143166040 17:4897709-4897731 TCACTGGGCCCTAGATTTTTGGG + Exonic
1147236980 17:39065312-39065334 ATGCTTGGTTCTATTTTTTTGGG - Exonic
1161185518 19:2916556-2916578 ACGCTCGGCTATTTTTTTTTTGG - Intronic
1163994361 19:21029248-21029270 ACAGTGGCCCCAATTTTTTTTGG - Intronic
1164604187 19:29584402-29584424 ATGCTGGGCTTTTTTTTTTTTGG + Intergenic
935273138 2:101452184-101452206 ACACTGGCCTCTATTTTCTTCGG - Intronic
938508347 2:131911293-131911315 ATGTTTGGCCCTATTTTCTTAGG - Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1176785146 21:13247270-13247292 ATGTTTGGCCCTATTTTCTTAGG + Intergenic
1177068404 21:16469035-16469057 ACACTGAGCCCTTTTTCTTTTGG - Intergenic
1177983184 21:27941028-27941050 ACGTTTGGCCCTATTTTCTTAGG + Intergenic
1178480715 21:32977434-32977456 AGGCTGAGCCCTATTTATGTTGG + Intergenic
1179046149 21:37847024-37847046 ATGCTGTGGCCTATATTTTTCGG - Intronic
957359687 3:79138319-79138341 ACACTGGGCCATAGTTTTGTTGG + Intronic
957497230 3:81007810-81007832 AGGCAGGGCCCTATCTTTATGGG + Intergenic
963602286 3:147389128-147389150 CCTCTGGGCCCTATTGTATTAGG + Intronic
966365859 3:179186647-179186669 ACAATGAGCCCTATTTTTTTTGG + Intronic
966644338 3:182226584-182226606 GCTCTGGGCCCTCTTTATTTTGG + Intergenic
970625620 4:17875727-17875749 ACTTGGGGACCTATTTTTTTTGG + Intronic
971625811 4:28918547-28918569 ATGTTGGTCCCTATTTTTTGTGG - Intergenic
972425317 4:38927424-38927446 TCCCTGGGGCCTCTTTTTTTAGG + Intronic
975453029 4:74552187-74552209 ACGCTGGGATTTATTCTTTTGGG + Intergenic
976066948 4:81198502-81198524 AGGCTGGGGGCTATTTTTGTGGG - Intronic
982183754 4:152775527-152775549 ACTATGGTCCCTAGTTTTTTTGG + Intronic
991448905 5:66730866-66730888 ACTCTTTTCCCTATTTTTTTTGG - Intronic
992343059 5:75846088-75846110 ATGCTCGGCCCTAGTTTCTTGGG - Intergenic
998409626 5:141899688-141899710 AAGGTGGGCCCTATTTACTTGGG - Intergenic
1018014395 6:159699091-159699113 AGGCTGGGCCCAATTCTTTTGGG - Intronic
1018598261 6:165507736-165507758 CTGATGGGCCCTATTGTTTTGGG + Intronic
1023936936 7:44747095-44747117 ACTCTGTGCTCTATTTCTTTTGG - Intergenic
1033052765 7:138021454-138021476 ACACTGGGCCTCCTTTTTTTTGG + Intronic
1033238691 7:139659087-139659109 AGACAGGGCCCTATTGTTTTTGG - Intronic
1038803248 8:30768334-30768356 ACGCTTGGCCTCATTTTTTTTGG - Intergenic
1042816786 8:72886903-72886925 TCGCTGGGCCCTAATTTTCAAGG + Intronic
1047675390 8:127196261-127196283 ACTCTGGAGCCAATTTTTTTAGG - Intergenic
1199854407 X:151748460-151748482 ACTCTGTGCTCTCTTTTTTTTGG - Intergenic