ID: 1108401142

View in Genome Browser
Species Human (GRCh38)
Location 13:50045294-50045316
Sequence CAAACTGCACATAGTTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108401142_1108401144 19 Left 1108401142 13:50045294-50045316 CCTATATAACTATGTGCAGTTTG No data
Right 1108401144 13:50045336-50045358 AAAATAAGATTAACACTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108401142 Original CRISPR CAAACTGCACATAGTTATAT AGG (reversed) Intergenic
No off target data available for this crispr