ID: 1108406695

View in Genome Browser
Species Human (GRCh38)
Location 13:50110696-50110718
Sequence TGGCCACCAATGCTGTAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108406695_1108406697 8 Left 1108406695 13:50110696-50110718 CCAAGCTACAGCATTGGTGGCCA 0: 1
1: 0
2: 3
3: 10
4: 92
Right 1108406697 13:50110727-50110749 TTAATAATAATATTTTTCAAAGG 0: 1
1: 1
2: 12
3: 177
4: 1487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108406695 Original CRISPR TGGCCACCAATGCTGTAGCT TGG (reversed) Intronic
902268933 1:15289313-15289335 TGGGCAGCAATGCTGTGGCTGGG + Intronic
903527408 1:24002184-24002206 TGGCCTCCAATGTTGGAGGTGGG - Intergenic
905205927 1:36342843-36342865 GGCCCAGCAATGCTGTTGCTCGG + Intronic
910548907 1:88454047-88454069 TGGCCACCAATCCTCTGCCTTGG + Intergenic
915711373 1:157902291-157902313 TGTCCACCATTGCTGAGGCTTGG + Intergenic
916400918 1:164447851-164447873 TGACCTCCAATGTTGGAGCTGGG - Intergenic
917960182 1:180136563-180136585 TAGCTACAAATGCTGTATCTTGG - Intergenic
920303007 1:205000960-205000982 TGGCCACCAAGGCTGCAGCTTGG + Intronic
920509770 1:206542212-206542234 TGGCCTCCAATGTTGGAGGTGGG + Intronic
921893149 1:220372632-220372654 TGGCCACCGATGGGGAAGCTTGG - Intergenic
923280242 1:232436621-232436643 TGGCCACCCATGCCCCAGCTGGG + Intronic
924196625 1:241614561-241614583 TGGGCACCTGTGCAGTAGCTTGG + Intronic
1064477867 10:15710786-15710808 TGGCTTCCACTGCTGTACCTGGG + Intronic
1068629399 10:59284398-59284420 TGCCCACCCCTGCTGGAGCTGGG - Intronic
1076032710 10:127173120-127173142 TGGCCAGCAATGCTGGAGCAGGG - Intronic
1076046120 10:127295440-127295462 TGACCCCCAATGCTGGAGATGGG - Intronic
1076393343 10:130120319-130120341 TGACCACCAGTGCTGGAGGTGGG - Intergenic
1078154214 11:8784975-8784997 TGGCCACCTATGATGCAGCATGG + Intronic
1079030490 11:16982712-16982734 TGGCCCTCCATGCTTTAGCTTGG + Intronic
1082733147 11:56824771-56824793 TGGCAACCCAAGCTGTACCTGGG + Intergenic
1084899526 11:72299222-72299244 TGGCCTCCCCAGCTGTAGCTTGG + Intronic
1085541459 11:77274344-77274366 TGACCACCAATACTGGAGGTGGG + Intronic
1087628313 11:100621791-100621813 TGGCTGCCAAAGCTGTACCTGGG + Intergenic
1100692221 12:97050354-97050376 TGGCCACCAATCCAGTGGCTGGG - Intergenic
1102506415 12:113387222-113387244 TGGACACCAGTGCAGCAGCTCGG + Intronic
1103911806 12:124356040-124356062 TGGCCACCACTGCCGAAGCTCGG - Intronic
1106843138 13:33708113-33708135 TGGCCACTTCTGCTGCAGCTGGG - Intergenic
1108323869 13:49311043-49311065 TGGCCTGCACTGCTGTAGCGTGG - Intronic
1108406695 13:50110696-50110718 TGGCCACCAATGCTGTAGCTTGG - Intronic
1112967288 13:105212265-105212287 CTGCCACCAATTCTGTAACTTGG + Intergenic
1121774925 14:96584262-96584284 TGGCCACCAATGCCCTTGCCAGG - Intergenic
1125816663 15:42590914-42590936 TGACCCCCAATGTTGGAGCTGGG - Intronic
1129680692 15:77656895-77656917 TGGGCACCTGTGCAGTAGCTTGG - Intronic
1129942435 15:79510078-79510100 TTGCCATCAATTATGTAGCTGGG + Intergenic
1130091588 15:80825575-80825597 TGGCCATGCATGCTGTGGCTTGG - Intronic
1130288084 15:82571984-82572006 TGGCCACCATTGCTGGAGACCGG - Intronic
1131638752 15:94266612-94266634 TGGAGACCATTGCTGTAGTTGGG + Intronic
1132175460 15:99710681-99710703 TCGCCAGGAATGCTGTCGCTGGG + Exonic
1139847608 16:69931934-69931956 TGGCCATTGATGCTGTAGCCTGG - Intronic
1148956655 17:51359799-51359821 TGGCTAGCAATGCTGTGGATTGG + Intergenic
1150475501 17:65471568-65471590 TGGCCACCAACGCTGAAGGAGGG - Intergenic
1156811843 18:41262395-41262417 TGGTCACCACGGCTCTAGCTAGG - Intergenic
926076348 2:9946190-9946212 TGGCCACTAAAGATGTAACTTGG + Intergenic
927918127 2:26949548-26949570 TGGCCACCACCGCTGCTGCTGGG - Exonic
930772372 2:55141123-55141145 TGGCCATCTTTGCTGTACCTTGG + Intergenic
945836340 2:214839802-214839824 TGATCCCCAATGCTGGAGCTGGG - Intergenic
946015739 2:216602663-216602685 TGGCCACCATCACTGTAGCCAGG - Intergenic
1174761176 20:53208645-53208667 TCGCCAACAATCCTGTAGGTTGG + Intronic
1175665843 20:60859317-60859339 TGGCCAGCAACCCTGCAGCTAGG + Intergenic
1180171383 21:46060518-46060540 GGGCCACCAAGGCTGTGGGTTGG - Intergenic
1180976481 22:19851527-19851549 TGGCCACCCCTGCTGTGTCTGGG - Exonic
1182612412 22:31559897-31559919 TGGCCACCATGGCTGTACCATGG + Intronic
949226202 3:1699324-1699346 GGGCCACCCATGCTGCAGCTGGG - Intergenic
950000689 3:9653828-9653850 TGGCCAGGAAGTCTGTAGCTGGG + Intronic
950297605 3:11845673-11845695 AGGCCATCTATGCTGTTGCTTGG - Intronic
953875306 3:46663307-46663329 TAGCCACCCACGCTGTCGCTTGG + Intergenic
954988234 3:54814490-54814512 TGGCCACAGATGCTGCTGCTGGG - Intronic
957852615 3:85829588-85829610 TTTCCACCCATGCTGTACCTTGG + Intronic
960636854 3:119792907-119792929 TGGCCTCCAATGTTGGAGGTAGG + Intronic
962301562 3:134248281-134248303 TGCCCAGAAATGCTGTTGCTGGG - Intronic
963980249 3:151529024-151529046 AGTCCACCAATGCTGAGGCTTGG + Intergenic
969703026 4:8778016-8778038 TCTCCACCAGTGCTGGAGCTGGG - Intergenic
972364937 4:38365656-38365678 TGCCCACAAATGCAGAAGCTGGG - Intergenic
974340077 4:60603713-60603735 TGGCCACCATTGCTGTGGTTTGG - Intergenic
974614468 4:64264484-64264506 GAACTACCAATGCTGTAGCTTGG - Intergenic
975046431 4:69809649-69809671 TGGACACCAATGTTGTAGCTAGG - Intergenic
984488853 4:180406601-180406623 TGGCCCCCGATGCTGTAGGTGGG - Intergenic
986337815 5:6768098-6768120 TGGCCACCAATGCTGGAGGTGGG + Intergenic
989389674 5:40886921-40886943 TGGTCACCAATGTTGGAGGTGGG + Intergenic
995172930 5:109138393-109138415 TCACCACCCATGCTGTACCTTGG - Intronic
995416210 5:111916343-111916365 TGGCCATATATGCTGTAGCTTGG - Intronic
1004868211 6:19875203-19875225 TGGCCACCAGTGTTGGAGGTGGG + Intergenic
1006621545 6:35368245-35368267 TGGCTATCACTGCTGAAGCTTGG - Intronic
1008940620 6:57041573-57041595 TGGCCACCAATACTGGGACTGGG - Intergenic
1009989826 6:70828502-70828524 TGACCACCATTGTTGTAGGTGGG - Intronic
1013281680 6:108643716-108643738 TGGGCAACACTGCTATAGCTGGG - Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1025036350 7:55594648-55594670 TGGCCACCAAGACTGCAGCGTGG - Intergenic
1026399768 7:69997783-69997805 TGACAACCAATGTTGAAGCTGGG - Intronic
1028350445 7:89840450-89840472 CTGGCACCAATGCTGTAGATAGG - Intergenic
1029162824 7:98564673-98564695 CGGCCTCCAATGCTGGAGGTGGG + Intergenic
1032081354 7:128860043-128860065 TGGGCACCCATGCTGTAATTTGG + Intergenic
1032317746 7:130855636-130855658 TGGCCCCTCCTGCTGTAGCTGGG - Intergenic
1034231822 7:149535608-149535630 TGGACACCAAAGGTGAAGCTGGG - Intergenic
1037428391 8:18782766-18782788 TGGCACCCAAAGCTGTAGCTTGG - Intronic
1039408416 8:37331904-37331926 TGGCCACCTTTGGTGTCGCTTGG + Intergenic
1043108634 8:76149436-76149458 TGGTCAACAAAGCTATAGCTTGG - Intergenic
1046634097 8:116653022-116653044 TCATCACCAATGCTGTGGCTGGG + Intronic
1054826434 9:69578302-69578324 TGGCCAGCTGTGCTGTGGCTTGG - Intronic
1055858435 9:80720184-80720206 TGACCACCAATGTTGGAGATGGG + Intergenic
1056070724 9:82983886-82983908 TGGCCACCGGGGCTGTGGCTCGG - Intronic
1058198469 9:102008615-102008637 TGGCCACCAATGGTGGGGGTAGG - Intergenic
1058739391 9:107928127-107928149 TCCCCACCACTCCTGTAGCTAGG - Intergenic
1059335056 9:113563906-113563928 TGGCCACCTAGGCTGAAGCACGG - Intronic
1060726178 9:126007343-126007365 TGGCCACCAGAGCTATAACTAGG - Intergenic
1061509382 9:131051107-131051129 TGTCCACCAAAGCTGTGGCGGGG + Intronic
1203489438 Un_GL000224v1:89520-89542 TGGCCTCCAATGTTGGAGGTGGG - Intergenic
1203502059 Un_KI270741v1:31408-31430 TGGCCTCCAATGTTGGAGGTGGG - Intergenic
1185672575 X:1824527-1824549 TGGTCACCAATGTTGGAGTTGGG - Intergenic
1192305975 X:69959994-69960016 TGGCCAACAAGGCTCTAGATTGG - Intronic
1193559331 X:82998175-82998197 TGGCCAGCAATTCTGTTGTTGGG - Intergenic
1197758058 X:130010059-130010081 TGGCCAGGACTGCTGTTGCTTGG + Intronic
1199793482 X:151175818-151175840 TGGCCACCAATGCCTTCCCTAGG + Intergenic
1199804946 X:151290075-151290097 TAGCCACCCATGCTGTACATTGG + Intergenic
1200069682 X:153521966-153521988 AGGCCACTAATGCAGCAGCTTGG + Intronic
1200273471 X:154710010-154710032 TGGCCACCCATGCTGTACATTGG - Intronic